MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-337J11
Chromosome	11 (Build37)
Map Location	61,559,009 - 61,742,135
singlet/doublet	doublet
Overlap gene	Prpsap2, Ulk2, Akap10
Upstream gene	Top3a, LOC100042517, Smcr8, Shmt1, LOC625958, LOC637900, Dhrs7b, Tmem11, Gtlf3b, Map2k3, Kcnj12, LOC668228, Tnfrsf13b, Usp22, LOC668239, Aldh3a1, Aldh3a2, 4933429E10Rik, 1300013J15Rik, LOC100042602, LOC626150, Zfp179, Mfap4, Mapk7, 3110043A19Rik, Eppb9, Epn2, Grap, Slc5a10, 2310040C09Rik
Downstream gene	D630015H07, LOC626325, LOC100041558, Specc1, Adora2b, 2410012H22Rik, Ttc19, Ncor1, Pigl, Prr6, Ubb, Trpv2, 2410006H16Rik, BC046404, BC025076, Zfp287, LOC626482, LOC100042766, Zfp286, Trim16, Fbxw10, Fam18b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Top3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21975 MGI:1197527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Smcr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237782 MGI:2444720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20425 MGI:98299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC637900 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 113 ESTs, 4 Proteins

name	Dhrs7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216820 MGI:2384931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216821 MGI:2144726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtlf3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24083 MGI:1344388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26397 MGI:1346868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16515 MGI:108495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Tnfrsf13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57916 MGI:1889411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216825 MGI:2144157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1086 ESTs, 1 Protein

name	Aldh3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11670 MGI:1353451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh3a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11671 MGI:1353452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933429E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380701 MGI:3588190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300013J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67473 MGI:1914723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042602 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC626150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 303 ESTs, 21 Proteins

name	Zfp179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22671 MGI:106611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76293 MGI:1342276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23939 MGI:1346347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110043A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73216 MGI:1920466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Eppb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27078 MGI:1351471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13855 MGI:1333766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71520 MGI:1918770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109342 MGI:1926089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69640 MGI:1916890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpsap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212627 MGI:2384838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ulk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29869 MGI:1352758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56697 MGI:1890218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630015H07 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:327939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC626325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626325
definition	note : endothelial differentiation-related factor 1 pseudogene pseudo : _no_value

name	LOC100041558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Specc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432572 MGI:2442356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adora2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11541 MGI:99403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410012H22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69747 MGI:1916997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 3 Proteins

name	Ttc19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72795 MGI:1920045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ncor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20185 MGI:1349717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327942 MGI:2681271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73139 MGI:1920389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 78 ESTs, 4 Proteins

name	Ubb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22187 MGI:98888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trpv2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22368 MGI:1341836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410006H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69221 MGI:1916471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs

name	BC046404 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192976 MGI:2682293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216829 MGI:2448491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 55 ESTs, 3 Proteins

name	Zfp287 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170740 MGI:2176561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 135 ESTs, 3 Proteins pseudo : _no_value

name	LOC100042766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs

name	Zfp286 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192651 MGI:2384758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94092 MGI:2137356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213980 MGI:3052463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fam18b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67510 MGI:1914760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Top3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344076 GeneID:21975 MGI:1197527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : topoisomerase (DNA) III alpha transcript_id : NM_009410.2

name	LOC100042517 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261943 GeneID:100042517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042517 transcript_id : XM_001478819.1

name	Smcr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801967 GeneID:237782 MGI:2444720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) transcript_id : NM_175491.3

name	Shmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846102 GeneID:20425 MGI:98299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine hydroxymethyltransferase 1 (soluble) transcript_id : NM_009171.2

name	LOC637900 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390140 GeneID:637900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 113 ESTs, 4 Proteins product : similar to ribosomal protein L21 transcript_id : XM_484035.4

name	Dhrs7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703853 GeneID:216820 MGI:2384931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 7B transcript_id : NM_145428.1

name	Tmem11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801759 GeneID:216821 MGI:2144726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 11 transcript_id : NM_173453.2

name	Gtlf3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372070 GeneID:24083 MGI:1344388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene trap locus F3b transcript_id : NM_025294.4

name	Map2k3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227250 GeneID:26397 MGI:1346868
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 3 transcript_id : NM_008928.2

name	Kcnj12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803056 GeneID:16515 MGI:108495
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 12 transcript_id : NM_010603.4

name	Tnfrsf13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946667 GeneID:57916 MGI:1889411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 13b transcript_id : NM_021349.1

name	Usp22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802354 GeneID:216825 MGI:2144157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 22 transcript_id : NM_001004143.3

name	LOC668239 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261911 GeneID:668239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1086 ESTs, 1 Protein product : similar to Rps13 protein transcript_id : XM_001000226.2

name	Aldh3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680675 GeneID:11670 MGI:1353451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase family 3, subfamily A1 transcript_id : NM_007436.1

name	Aldh3a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802078 GeneID:11671 MGI:1353452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase family 3, subfamily A2 transcript_id : NM_007437.3

name	4933429E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802846 GeneID:380701 MGI:3588190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933429E10 gene transcript_id : NM_001033542.2

name	1300013J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387278 GeneID:67473 MGI:1914723
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300013J15 gene transcript_id : NM_026183.3

name	LOC100042602 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261947 GeneID:100042602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042602 transcript_id : XM_001478935.1

name	LOC626150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261949 GeneID:626150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 303 ESTs, 21 Proteins product : similar to H3 histone, family 3A transcript_id : XM_890719.3

name	Zfp179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20127401 GeneID:22671 MGI:106611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 179 transcript_id : NM_009548.2

name	Mfap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130625 GeneID:76293 MGI:1342276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 4 transcript_id : NM_029568.2

name	Mapk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754633 GeneID:23939 MGI:1346347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 7 transcript_id : NM_011841.1

name	3110043A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261912 GeneID:73216 MGI:1920466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 3110043A19 gene transcript_id : XM_001476479.1

name	Eppb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367793 GeneID:27078 MGI:1351471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial precursor protein B9 transcript_id : NM_013717.2

name	Epn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129929 GeneID:13855 MGI:1333766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epsin 2 transcript_id : NM_010148.2

name	Grap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802524 GeneID:71520 MGI:1918770
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRB2-related adaptor protein transcript_id : NM_027817.2

name	Slc5a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361551 GeneID:109342 MGI:1926089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium/glucose cotransporter), member 10 transcript_id : NM_001033227.2

name	2310040C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647254 GeneID:69640 MGI:1916890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310040C09 gene transcript_id : NM_178618.3

name	Prpsap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450168 GeneID:212627 MGI:2384838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoribosyl pyrophosphate synthetase-associated protein 2 transcript_id : NM_144806.1

name	Ulk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982529 GeneID:29869 MGI:1352758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Unc-51 like kinase 2 (C. elegans) transcript_id : NM_013881.3

name	Akap10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40807353 GeneID:56697 MGI:1890218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 10 transcript_id : NM_019921.2

name	D630015H07 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261952 GeneID:327939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein D630015H07 transcript_id : XM_001479118.1

name	LOC100041558 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261914 GeneID:100041558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : hypothetical protein LOC100041558 transcript_id : XM_001476580.1

name	Specc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131156 GeneID:432572 MGI:2442356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm antigen with calponin homology and coiled-coil domains 1 transcript_id : NM_001029936.2

name	Adora2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369546 GeneID:11541 MGI:99403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine A2b receptor transcript_id : NM_007413.3

name	2410012H22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261954 GeneID:69747 MGI:1916997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 3 Proteins product : RIKEN cDNA 2410012H22 gene transcript_id : XM_126343.5

name	Ttc19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347536 GeneID:72795 MGI:1920045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 19 transcript_id : NM_028360.2

name	Ttc19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347532 GeneID:72795 MGI:1920045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 19 transcript_id : NM_029704.1

name	Ncor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299754 GeneID:20185 MGI:1349717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor co-repressor 1 transcript_id : NM_011308.2

name	Pigl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386417 GeneID:327942 MGI:2681271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class L transcript_id : NM_001039536.2

name	Prr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390122 GeneID:73139 MGI:1920389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 78 ESTs, 4 Proteins product : proline-rich polypeptide 6, transcript variant 1 transcript_id : XM_203393.4

name	Ubb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351666 GeneID:22187 MGI:98888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin B transcript_id : NM_011664.3

name	Trpv2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053864 GeneID:22368 MGI:1341836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 2 transcript_id : NM_011706.2

name	2410006H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261960 GeneID:69221 MGI:1916471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs product : RIKEN cDNA 2410006H16 gene transcript_id : XM_001479267.1

name	BC046404 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38524603 GeneID:192976 MGI:2682293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC046404 transcript_id : NM_198861.1

name	BC025076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261963 GeneID:216829 MGI:2448491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 54 ESTs, 3 Proteins product : cDNA sequence BC025076, transcript variant 5 transcript_id : XM_901503.3

name	BC025076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261962 GeneID:216829 MGI:2448491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs, 3 Proteins product : cDNA sequence BC025076, transcript variant 1 transcript_id : XM_618882.4

name	Zfp287 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865958 GeneID:170740 MGI:2176561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 287 transcript_id : NM_133208.2

name	LOC100042766 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261964 GeneID:100042766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : hypothetical protein LOC100042766 transcript_id : XM_001479316.1

name	Zfp286 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865961 GeneID:192651 MGI:2384758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 286 transcript_id : NM_138949.3

name	Trim16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778827 GeneID:94092 MGI:2137356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 16 transcript_id : NM_053169.2

name	Fbxw10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991691 GeneID:213980 MGI:3052463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 10 transcript_id : NM_001033669.1

name	Fam18b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368688 GeneID:67510 MGI:1914760
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : family with sequence similarity 18, member B transcript_id : NM_026210.3

name	Top3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678403 CCDS:CCDS24797.1 GeneID:21975 MGI:1197527
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003916 - DNA topoisomerase activity [Evidence IEA]; GO:0003917 - DNA topoisomerase type I activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006304 - DNA modification [Evidence IEA]; GO:0006265 - DNA topological change [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IEA] codon_start : 1 note : topoisomerase 3 alpha; Top IIIa; topoisomerase (DNA) 3 alpha product : topoisomerase (DNA) III alpha protein_id : NP_033436.1

name	LOC100042517 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261944 GeneID:100042517
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478869.1

name	Smcr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425240 CCDS:CCDS24798.1 GeneID:237782 MGI:2444720
definition	codon_start : 1 product : Smith-Magenis syndrome chromosome region, candidate 8 homolog protein_id : NP_780700.1

name	Shmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846103 CCDS:CCDS24799.1 GeneID:20425 MGI:98299
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004372 - glycine hydroxymethyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006544 - glycine metabolism [Evidence IEA]; GO:0006563 - L-serine metabolism [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : serine hydroxymethyl transferase 1 (soluble) product : serine hydroxymethyltransferase 1 (soluble) protein_id : NP_033197.2

name	LOC637900 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390141 GeneID:637900
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484035.3

name	Dhrs7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703854 CCDS:CCDS24800.1 GeneID:216820 MGI:2384931
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dehydrogenase/reductase (SDR family) member 7B protein_id : NP_663403.1

name	Tmem11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734998 CCDS:CCDS24801.1 GeneID:216821 MGI:2144726
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 11 protein_id : NP_775655.1

name	Gtlf3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384646 CCDS:CCDS24802.1 GeneID:24083 MGI:1344388
definition	codon_start : 1 product : transcript expressed during hematopoiesis 2 protein_id : NP_079570.1

name	Map2k3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094081 CCDS:CCDS24804.1 GeneID:26397 MGI:1346868
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004708 - MAP kinase kinase activity [Evidence IMP] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IDA] [Evidence IMP]; GO:0042035 - regulation of cytokine biosynthesis [Evidence IMP] codon_start : 1 note : protein kinase, mitogen-activated, kinase 3; MAP kinase kinase 3 product : mitogen activated protein kinase kinase 3 protein_id : NP_032954.1

name	Kcnj12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560572 CCDS:CCDS24805.1 GeneID:16515 MGI:108495
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium inwardly-rectifying channel J12 protein_id : NP_034733.2

name	Tnfrsf13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946668 CCDS:CCDS24806.1 GeneID:57916 MGI:1889411
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP] codon_start : 1 note : transmembrane activator and calcium-modulating and cyclophilin ligand interactor product : tumor necrosis factor receptor superfamily, member 13b protein_id : NP_067324.1

name	Usp22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625685 CCDS:CCDS24807.1 GeneID:216825 MGI:2144157
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IC] codon_start : 1 product : ubiquitin specific protease 22 protein_id : NP_001004143.2

name	LOC668239 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390143 GeneID:668239
definition	codon_start : 1 product : similar to Rps13 protein protein_id : XP_001000226.1

name	Aldh3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680676 CCDS:CCDS24808.1 GeneID:11670 MGI:1353451
definition	EC_number : 1.2.1.3 GO_component : GO:0005737 - cytoplasm [Evidence IEP]; GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0004028 - 3-chloroallyl aldehyde dehydrogenase activity [Evidence IDA] [Evidence IMP]; GO:0008106 - alcohol dehydrogenase (NADP+) activity [Evidence ISS]; GO:0004029 - aldehyde dehydrogenase (NAD) activity [Evidence ISS]; GO:0004030 - aldehyde dehydrogenase [NAD(P)+] activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006081 - aldehyde metabolism [Evidence ISS] [Evidence IEA]; GO:0006118 - electron transport [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : aldehyde dehydrogenase 3, stomach cytosolic (class 3); alcohol dehydrogenase family 3, subfamily A1 product : aldehyde dehydrogenase family 3, subfamily A1 protein_id : NP_031462.1

name	Aldh3a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677435 CCDS:CCDS24809.1 GeneID:11671 MGI:1353452
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0004029 - aldehyde dehydrogenase (NAD) activity [Evidence IEA]; GO:0004030 - aldehyde dehydrogenase [NAD(P)+] activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006081 - aldehyde metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : aldehyde dehydrogenase 4, liver microsomal (class 3); aldehyde dehydrogenase 4, liver microsomal (class 3) regulator; alcohol dehydrogenase family 3, subfamily A2 product : aldehyde dehydrogenase family 3, subfamily A2 protein_id : NP_031463.2

name	4933429E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702045 CCDS:CCDS24810.1 GeneID:380701 MGI:3588190
definition	codon_start : 1 product : hypothetical protein LOC380701 protein_id : NP_001028714.1

name	1300013J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385694 CCDS:CCDS24811.1 GeneID:67473 MGI:1914723
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0015238 - drug transporter activity [Evidence IEA] GO_process : GO:0006855 - multidrug transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67473 protein_id : NP_080459.1

name	LOC100042602 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261948 GeneID:100042602
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478985.1

name	LOC626150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82934691 GeneID:626150
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895812.1

name	Zfp179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20127402 CCDS:CCDS24812.1 GeneID:22671 MGI:106611
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : brain finger protein product : zinc finger protein 179 protein_id : NP_033574.2

name	Mfap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313152 CCDS:CCDS24813.1 GeneID:76293 MGI:1342276
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : microfibrillar-associated protein 4 protein_id : NP_083844.1

name	Mapk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754634 CCDS:CCDS24814.1 GeneID:23939 MGI:1346347
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0045765 - regulation of angiogenesis [Evidence IMP] codon_start : 1 note : extracellular signal regulated kinase 5; big MAP kinase 1; mitogen-activated protein kinase 7; mitogen-activated kinase 7 product : mitogen activated protein kinase 7 protein_id : NP_035971.1

name	3110043A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261913 GeneID:73216 MGI:1920466
definition	codon_start : 1 product : hypothetical protein LOC73216 protein_id : XP_001476529.1

name	Eppb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305039 CCDS:CCDS24815.1 GeneID:27078 MGI:1351471
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B9 protein protein_id : NP_038745.1

name	Epn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468893 CCDS:CCDS24816.1 GeneID:13855 MGI:1333766
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : epsin 2 protein_id : NP_034278.1

name	Grap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362273 CCDS:CCDS24817.1 GeneID:71520 MGI:1918770
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : GRB2-related adaptor protein protein_id : NP_082093.1

name	Slc5a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794617 CCDS:CCDS24818.1 GeneID:109342 MGI:1926089
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 5 (sodium/glucose cotransporter), member 10 protein_id : NP_001028399.1

name	2310040C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647255 GeneID:69640 MGI:1916890
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69640 protein_id : NP_848733.2

name	Prpsap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450169 CCDS:CCDS24819.1 GeneID:212627 MGI:2384838
definition	GO_function : GO:0004749 - ribose phosphate diphosphokinase activity [Evidence IEA] GO_process : GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0009165 - nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : phosphoribosyl pyrophosphate synthetase-associated protein 2 protein_id : NP_659055.1

name	Ulk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982530 CCDS:CCDS24820.1 GeneID:29869 MGI:1352758
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Unc-51 like kinase 2 protein_id : NP_038909.2

name	Akap10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40807354 CCDS:CCDS24821.1 GeneID:56697 MGI:1890218
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA]; GO:0051018 - protein kinase A binding [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008104 - protein localization [Evidence ISS] [Evidence IDA] codon_start : 1 note : protein kinase A anchoring protein product : A kinase (PRKA) anchor protein 10 protein_id : NP_064305.2

name	D630015H07 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261953 GeneID:327939
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479168.1

name	LOC100041558 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261915 GeneID:100041558
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476630.1

name	Specc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71979930 GeneID:432572 MGI:2442356
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : sperm antigen HCMOGT-1-like product : spectrin domain with coiled-coils 1 protein_id : NP_001025107.1

name	Adora2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560741 CCDS:CCDS24822.1 GeneID:11541 MGI:99403
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001612 - A2B adenosine receptor activity, G-protein coupled [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : adenosine A2b receptor protein_id : NP_031439.2

name	2410012H22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261955 GeneID:69747 MGI:1916997
definition	codon_start : 1 product : hypothetical protein LOC69747 protein_id : XP_126343.3

name	Ttc19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347537 GeneID:72795 MGI:1920045
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tetratricopeptide repeat domain 19 isoform 1 protein_id : NP_082636.3

name	Ttc19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347533 GeneID:72795 MGI:1920045
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tetratricopeptide repeat domain 19 isoform 2 protein_id : NP_083980.1

name	Ncor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68299755 GeneID:20185 MGI:1349717
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IMP] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : retinoid X receptor interacting protein 13 product : nuclear receptor co-repressor 1 protein_id : NP_035438.2

name	Pigl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014552 CCDS:CCDS24824.1 GeneID:327942 MGI:2681271
definition	GO_function : GO:0000225 - N-acetylglucosaminylphosphatidylinositol deacetylase activity [Evidence ISS] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS] codon_start : 1 note : ortholog of human and rat phosphatidylinositol glycan class L PIGL; phosphatidylinositol glycan, class L product : phosphatidylinositol glycan anchor biosynthesis, class L protein_id : NP_001034625.1

name	Prr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82934627 GeneID:73139 MGI:1920389
definition	codon_start : 1 product : proline-rich polypeptide 6 isoform 1 protein_id : XP_203393.3

name	Ubb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755919 CCDS:CCDS24826.1 GeneID:22187 MGI:98888
definition	codon_start : 1 product : ubiquitin B protein_id : NP_035794.1

name	Trpv2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053865 CCDS:CCDS24827.1 GeneID:22368 MGI:1341836
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA] [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0009266 - response to temperature stimulus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vanilloid receptor-like protein 1; growth factor regulated channel product : transient receptor potential cation channel, subfamily V, member 2 protein_id : NP_035836.2

name	2410006H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261961 GeneID:69221 MGI:1916471
definition	codon_start : 1 product : hypothetical protein LOC69221 protein_id : XP_001479317.1

name	BC046404 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38524604 CCDS:CCDS24828.1 GeneID:192976 MGI:2682293
definition	codon_start : 1 product : hypothetical protein LOC192976 protein_id : NP_942561.1

name	BC025076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63622129 GeneID:216829 MGI:2448491
definition	codon_start : 1 product : hypothetical protein LOC216829 isoform 1 protein_id : XP_618882.1

name	BC025076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82934638 GeneID:216829 MGI:2448491
definition	codon_start : 1 product : hypothetical protein LOC216829 isoform 5 protein_id : XP_906596.1

name	Zfp287 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865959 CCDS:CCDS24830.1 GeneID:170740 MGI:2176561
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0042035 - regulation of cytokine biosynthesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein SKAT2 product : zinc finger protein 287 protein_id : NP_573471.2

name	LOC100042766 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261965 GeneID:100042766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479366.1

name	Zfp286 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543186 CCDS:CCDS24831.1 GeneID:192651 MGI:2384758
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 286 protein_id : NP_620399.3

name	Trim16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778828 CCDS:CCDS24832.1 GeneID:94092 MGI:2137356
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : estrogen-responsive B box product : tripartite motif protein 16 protein_id : NP_444399.2

name	Fbxw10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75991692 CCDS:CCDS24833.1 GeneID:213980 MGI:3052463
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : F-box and WD-40 domain protein 10 protein_id : NP_001028841.1

name	Fam18b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312930 CCDS:CCDS24834.1 GeneID:67510 MGI:1914760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : ortholog of human family with sequence similarity 18 member B FAM18B product : hypothetical protein LOC67510 protein_id : NP_080486.1

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 1 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 2 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 3 pseudo : _no_value

name	LOC625958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625958
definition	number : 4 pseudo : _no_value

name	LOC668228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668228
definition	number : 2 pseudo : _no_value

name	LOC668228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668228
definition	number : 1 pseudo : _no_value

name	LOC626482 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261917 GeneID:626482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 135 ESTs, 3 Proteins product : similar to SOCS box-containing WD protein SWiP-2 pseudo : _no_value transcript_id : XR_032900.1

clone name	MSMg01-092O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161D24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523H06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037H01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-337J11.b	B6Ng01-337J11.g
ACC	GA122166	GA122167
length	1,114	1,135
definition	B6Ng01-337J11.b	B6Ng01-337J11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(61,741,018 - 61,742,135)	(61,559,009 - 61,560,130)
sequence	gaattcagtatgtaaccttgaaacgtaaaactagaggatcagtagtagaa tgtaactttagagaggtcaggaaagacactggaggtaccaggaataaaga gctggtgccctttaggaaaggcaaggtggccactgtggctgaggcataga gaagcagataggcagacaccacattatcgagagttttattccaaatgcag agagaatatattgtaaagcttttgaagagaggtgaccttacaataaaggg tgatctgattatttgcttagaaagtttattctagagccagatgctcagca gataaagacccttgctgtgcagcctaaccatcagagttagagccccagga cccacaatggtggagggaaagagtaactcccattaagttgtcctctgacc tccacacatgtgctgtgtggtacatccactcccacaaaataaataaatgt acttaaggagtaaaaagattattccagatgatttctggagattgaatgtg gcaagagagctagaaacaacctttttgaggggttgggagtcaagacagtc tggctttgtagtcctggccttagcatttcctgttgagatggggaccttgt ggacattcttcttcctctaatttagtatttggattataggcatgtatcac cacacccaacctctgaaaacagcctcataaagatccttcaatttaatttt ctttcttgttagaggtttatcatatttcattaaaaatggtaaatctaaaa tcaggaaaagagggctggaggtggctcagcccttcagaacttatgttgtt cttacacagaacctgggtttagttcccagaaccttcatggcagcttagaa ccatctgtaactccaggtccagggactcccctactcttctctggcctcct tggcacttggcatctacatgtatagatgtaggcaaaccactcacacacca caacaaaatggaaacaatttgtaagattaccttagtgtttccccagttta cctgtctatgtattttttcttttgagatatgcactttgtaatctactgtc atgagttttgtctttttttaattttgatttcaaatcagtattttgatatg gagtcataactagc	gaattccaggagagccagggctacacagagaaaccctgtcttgaaaaaaa caaacaaacgaataagcaaatcaacaacaagcccttaaagtacagaaaca gcagaaaatcttaacaaagaaatatttctacaagtgtttttacagctgat tgtctctcctacaattttccttagcagggatgacaaaacccaacataaga taccaagacctcttcacccacactgtgacatctgaaatgattaacagaaa aaggtacgagaacattttagaagtagtgttgtccaaaagagtaaggagct gaacctgtgtggtccatccaagcctataagagaaaggagaaagcgtccag aagactcagtgagctagcctgtttcctctgtcaaagcttgttagtgtttc aaaggggttcagtggttaataagtcaactagataggatttacagtcacct agaggtgagtctgggagacacatgtgagtgatcagtgtctggcatgacta tgagggttattttgattacactgaagcaagaagattcattgggccgggcg tggtggtgcacgcctttaaccccagcactcgggaggcggaggcagaggca ggcggacttctgagttcgaggccagcctggtctacaaagtgagttccagg acgtcagagctatacagagaaatccttgtctcgaaaaaccaaaaaaaaaa aaaaaaaaaaaagatgattcattgggtgacatcacacctgggctgatgtc tgtgtgaataaggaggaaactagctgagcccagtatctgtccttcctccc ttcctgactgaaagtgcagtatggaagggcccagctacctttacctttct acgtgatggattgtacctcaactgggagtcagaataaacgttctctccct ccaggtgtgtttggtcaggtgttctgtcacatcaataacataaaatacta ctatggtttccccaggactgaagttgctaggtttatatttttttaagccg tgtttttgtttctgcctttctttttaaagctatacttggaaatgttattt ttctataagtgagttattctgtagagttgtgaccctggcaagtttcagtt cctttgtctgtcaccaaacttctgtgaatgtatgc
quality values	Open. Hide. 58 31 28 24 58 38 23 62 62 47 47 62 62 62 62 62 62 62 62 49 31 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 59 36 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 62 59 62 54 59 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 59 62 62 62 62 59 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 53 62 62 62 62 54 41 58 58 58 58 58 58 58 54 49 54 58 58 58 58 58 58 54 58 58 54 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 49 58 58 58 54 58 58 58 58 58 52 58 54 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 50 58 58 58 58 50 58 53 54 58 58 52 58 58 58 52 58 58 49 40 45 35 58 58 58 58 37 22 43 58 41 58 54 58 54 51 42 50 51 54 54 54 58 52 51 49 43 46 51 53 53 50 51 49 58 49 58 52 53 53 36 58 58 58 51 41 34 49 50 50 49 54 58 50 53 49 58 50 50 51 54 50 50 54 35 58 51 54 58 43 38 51 50 46 54 50 51 51 58 41 58 43 43 50 49 54 58 51 52 45 52 49 54 54 50 42 40 49 50 40 54 45 42 44 38 54 42 42 50 49 54 54 52 52 49 54 50 53 53 52 54 31 53 53 52 53 32 51 29 54 52 51 39 53 52 38 53 53 54 51 41 40 52 53 26 54 54 54 44 39 54 54 37 52 54 45 39 53 45 46 54 54 51 40 44 38 31 54 47 49 49 40 40 39 25 49 33 31 32 40 49 20 7 47 31 32 46 23 45 32 39 22 40 40 40 39 41 36 31 26 49 37 35 45 41 31 31 42 31 46 40 29 32 43 31 31 31 45 18 31 30 34 38 32 28 40 31 42 51 51 31 51 17 33 34 31 37 21 33 22 32 33 37 43 25 21 23 29 28 23 27 31 36 20 28 21 31 41 31 32 14 27 18 9 13 19 30 36 34 42 32 29 33 22 31 26 26 23 30 39 30 26 32 31 37 46 29 12 16 30 28 46 46 29 27 31 29 31 30 13 33 30 27 28 27 30 28 8 26 32 24 33 23 20 36 31 27 33 26 23 22 33 38 32 32 31 32 33 33 31 24 32 42 30 27 22 27 32 30 32 34 31 24 25 19 25 30 36 28 26 26 29 26 31 31 18 16 17 29 17 27 11 16 30 12 10 14 17 36 48 32 18 17 26 20 37 18 8 6 24 7 31 10 24 14 19 17 10 17 4 5 13 25 11 17 14 17 7 6 21 16 48 22 30 39 34 18 21 10 21 34 15 16 18 18 17 23 11 21 8 10 27 20 5 20 27 34 34 47 40 24 28 15 30 30 14 20 20 9 21 7 12 25 28 24 24 22 13 30 18 15 11 15 11 6 13 9 13 16 7 13 12 28 24 24 16 16 7 18 28 27 12 9 4 6 10 28 30 29 28 29 21 6 10 3 13 5 9 13 3 3 13 17 5 4 25 14 5 10 16 13 12 10 9 17 17 13 7 8 7 7 11 9 6 13 7 7 16 8 16 4 5 12 8 16 6 8	Open. Hide. 62 47 41 41 62 62 47 30 62 62 47 47 47 56 62 62 54 62 62 49 62 54 62 62 62 62 62 59 59 59 44 62 62 59 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 56 49 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 42 49 42 62 54 62 62 62 62 62 49 62 62 58 45 42 58 58 54 54 58 58 54 58 58 58 58 54 58 58 58 54 58 58 58 58 49 42 58 58 58 58 54 54 58 58 58 58 58 54 58 54 58 50 58 58 58 58 58 52 58 58 58 54 58 58 54 54 30 58 58 54 58 58 58 54 58 48 58 54 58 58 54 58 58 58 49 49 58 58 51 58 53 53 41 50 53 49 49 51 51 46 50 49 47 41 43 32 49 51 51 58 58 53 58 58 58 34 25 51 40 51 54 36 17 39 40 51 53 58 31 44 53 49 51 58 46 51 54 41 33 54 51 50 58 58 58 50 58 49 35 47 58 49 58 21 48 46 53 38 43 44 58 58 53 52 53 36 50 40 39 37 49 52 54 58 53 51 50 35 43 39 41 58 41 27 50 51 40 50 43 58 28 51 50 33 50 42 52 45 47 46 37 54 54 37 52 39 51 50 40 51 41 42 51 32 42 49 54 39 50 40 35 50 30 17 17 26 28 12 10 17 17 22 46 46 9 7 42 54 49 33 35 28 28 15 25 28 17 37 34 31 49 32 23 49 15 32 54 35 29 47 39 21 21 45 52 29 33 24 25 38 36 51 42 38 31 45 32 40 34 34 34 33 52 52 33 32 34 31 37 33 32 52 31 13 36 33 32 31 32 51 33 27 40 32 31 38 27 23 51 22 42 41 37 31 31 42 36 39 31 31 51 31 24 20 34 45 28 31 31 29 32 19 20 29 14 22 26 28 31 21 31 37 25 46 23 32 31 30 23 31 30 15 22 30 37 38 38 13 9 42 31 9 37 7 7 18 28 32 19 14 18 6 22 18 19 15 18 18 41 13 25 31 31 36 26 21 31 27 27 30 38 10 11 27 26 15 23 24 16 22 27 46 17 21 31 31 47 19 24 24 34 32 20 6 10 31 15 21 47 18 28 25 23 7 23 30 22 20 15 24 14 25 23 31 20 17 28 5 24 16 31 20 44 33 12 18 24 32 22 9 29 7 19 15 21 16 23 37 31 26 17 19 20 32 25 17 18 22 25 17 20 7 9 19 48 48 19 7 29 9 13 19 34 16 17 21 17 26 5 31 10 26 34 26 23 7 4 5 15 16 31 32 26 6 15 15 24 6 10 27 26 27 20 18 32 25 16 20 17 15 34 33 40 34 32 21 22 7 6 13 12 20 13 28 10 40 34 27 7 11 16 34 28 24 18 27 14 11 15 26 7 8 24 47 40 29 18 18 28 18 20 10 13 8 6 7 11 21 13 3 13 13 29 13 13 17 9 5 8 7 28 28 26 13 21 13 6 12 7 7 10 7 12 9 16 8 7 14 5 7 6 4 6 11 15 4 8 6 4 4 2 2 3 11 7 17 9 11 2 3 1 3 3 3 3 11 14 16 12 5 5 5 22 14 10 23 18 7 4 6 6 5 6 4 4 7 4 7 17 21 13 23 6 5 8 9 4 5 6 8 5 8 13 16 18 8 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_61741018_61742135
seq2: B6Ng01-337J11.b_43_1156 (reverse)

seq1  GCTAGTAATGACTTCATATCAAAATACTGATTTGAAAATTCAAAAATTAA  50
      |||||| |||||| |||||||||||||||||||||||  || ||||||||
seq2  GCTAGTTATGACTCCATATCAAAATACTGATTTGAAA--TC-AAAATTAA  47

seq1  AAAAAGACAAAACTCATGACAGTAGATTACAAAGTGCATATCTCAAAAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGACAAAACTCATGACAGTAGATTACAAAGTGCATATCTCAAAAGA  97

seq1  AAAAATACAATAGACAGGTAAACTGGGGAAACACTAAGGTAATTCTTAC-  149
      |||||||| ||||||||||||||||||||||||||||||||| |||||| 
seq2  AAAAATAC-ATAGACAGGTAAACTGGGGAAACACTAAGGTAA-TCTTACA  145

seq1  AATTGTTTCCATTTTGTTGTGGTGTGTGAGTGGTTTGCCTACATCTATAC  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGTTTCCATTTTGTTGTGGTGTGTGAGTGGTTTGCCTACATCTATAC  195

seq1  ATGTAGATGCCAAGTGCCAAGGAGGCCAGAGAAGAGTAGGGGAGTCCCTG  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAGATGCCAAGTGCCAAGGAGGCCAGAGAAGAGTAGGGGAGTCCCTG  245

seq1  GACCTGGAGTTACAGATGGTTCTAAGCTGCCATGAAGGTTCTGGGAACTA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTGGAGTTACAGATGGTTCTAAGCTGCCATGAAGGTTCTGGGAACTA  295

seq1  AACCCAGGTTCTGTGTAAGAACAACATAAGTTCTGAAGGGCTGAGCCACC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCAGGTTCTGTGTAAGAACAACATAAGTTCTGAAGGGCTGAGCCACC  345

seq1  TCCAGCCCTCTTTTCCTGATTTTAGATTTACCATTTTTAATGAAATATGA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGCCCTCTTTTCCTGATTTTAGATTTACCATTTTTAATGAAATATGA  395

seq1  TAAACCTCTAACAAGAAAGAAAATTAAATTGAAGGATCTTTATGAGGCTG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCTCTAACAAGAAAGAAAATTAAATTGAAGGATCTTTATGAGGCTG  445

seq1  TTTTCAGAGGTTGGGTGTGGTGATACATGCCTATAATCCAAATACTAAAT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCAGAGGTTGGGTGTGGTGATACATGCCTATAATCCAAATACTAAAT  495

seq1  TAGAGGAAGAAGAATGTCCACAAGGTCCCCATCTCAACAGGAAATGCTAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGGAAGAAGAATGTCCACAAGGTCCCCATCTCAACAGGAAATGCTAA  545

seq1  GGCCAGGACTACAAAGCCAGACTGTCTTGACTCCCAACCCCTCAAAAAGG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGGACTACAAAGCCAGACTGTCTTGACTCCCAACCCCTCAAAAAGG  595

seq1  TTGTTTCTAGCTCTCTTGCCACATTCAATCTCCAGAAATCATCTGGAATA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTCTAGCTCTCTTGCCACATTCAATCTCCAGAAATCATCTGGAATA  645

seq1  ATCTTTTTACTCCTTAAGTACATTTATTTATTTTGTGGGAGTGGATGTAC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTTTACTCCTTAAGTACATTTATTTATTTTGTGGGAGTGGATGTAC  695

seq1  CACACAGCACATGTGTGGAGGTCAGAGGACAACTTAATGGGAGTTACTCT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAGCACATGTGTGGAGGTCAGAGGACAACTTAATGGGAGTTACTCT  745

seq1  TTCCCTCCACCATTGTGGGTCCTGGGGCTCTAACTCTGATGGTTAGGCTG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCTCCACCATTGTGGGTCCTGGGGCTCTAACTCTGATGGTTAGGCTG  795

seq1  CACAGCAAGGGTCTTTATCTGCTGAGCATCTGGCTCTAGAATAAACTTTC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCAAGGGTCTTTATCTGCTGAGCATCTGGCTCTAGAATAAACTTTC  845

seq1  TAAGCAAATAATCAGATCACCCTTTATTGTAAGGTCACCTCTCTTCAAAA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCAAATAATCAGATCACCCTTTATTGTAAGGTCACCTCTCTTCAAAA  895

seq1  GCTTTACAATATATTCTCTCTGCATTTGGAATAAAACTCTCGATAATGTG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTACAATATATTCTCTCTGCATTTGGAATAAAACTCTCGATAATGTG  945

seq1  GTGTCTGCCTATCTGCTTCTCTATGCCTCAGCCACAGTGGCCACCTTGCC  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTGCCTATCTGCTTCTCTATGCCTCAGCCACAGTGGCCACCTTGCC  995

seq1  TTTCCTAAAGGGCACCAGCTCTTTATTCCTGGTACCTCCAGTGTCTTTCC  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTAAAGGGCACCAGCTCTTTATTCCTGGTACCTCCAGTGTCTTTCC  1045

seq1  TGACCTCTCTAAAGTTACATTCTACTACTGATCCTCTAGTTTTACGTTTC  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCTCTCTAAAGTTACATTCTACTACTGATCCTCTAGTTTTACGTTTC  1095

seq1  AAGGTTACATACTGAATTC  1118
      |||||||||||||||||||
seq2  AAGGTTACATACTGAATTC  1114

seq1: chr11_61559009_61560130
seq2: B6Ng01-337J11.g_65_1199

seq1  GAATTCCAGGAGAGCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGAGAGCCAGGGCTACACAGAGAAACCCTGTCTTGAAAAAAA  50

seq1  CAAACAAACGAATAAGCAAATCAACAACAAGCCCTTAAAGTACAGAAACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACAAACGAATAAGCAAATCAACAACAAGCCCTTAAAGTACAGAAACA  100

seq1  GCAGAAAATCTTAACAAAGAAATATTTCTACAAGTGTTTTTACAGCTGAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAAAATCTTAACAAAGAAATATTTCTACAAGTGTTTTTACAGCTGAT  150

seq1  TGTCTCTCCTACAATTTTCCTTAGCAGGGATGACAAAACCCAACATAAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTCCTACAATTTTCCTTAGCAGGGATGACAAAACCCAACATAAGA  200

seq1  TACCAAGACCTCTTCACCCACACTGTGACATCTGAAATGATTAACAGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAAGACCTCTTCACCCACACTGTGACATCTGAAATGATTAACAGAAA  250

seq1  AAGGTACGAGAACATTTTAGAAGTAGTGTTGTCCAAAAGAGTAAGGAGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTACGAGAACATTTTAGAAGTAGTGTTGTCCAAAAGAGTAAGGAGCT  300

seq1  GAACCTGTGTGGTCCATCCAAGCCTATAAGAGAAAGGAGAAAGCGTCCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCTGTGTGGTCCATCCAAGCCTATAAGAGAAAGGAGAAAGCGTCCAG  350

seq1  AAGACTCAGTGAGCTAGCCTGTTTCCTCTGTCAAAGCTTGTTAGTGTTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACTCAGTGAGCTAGCCTGTTTCCTCTGTCAAAGCTTGTTAGTGTTTC  400

seq1  AAAGGGGTTCAGTGGTTAATAAGTCAACTAGATAGGATTTACAGTCACCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGGGTTCAGTGGTTAATAAGTCAACTAGATAGGATTTACAGTCACCT  450

seq1  AGAGGTGAGTCTGGGAGACACATGTGAGTGATCAGTGTCTGGCATGACTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGTGAGTCTGGGAGACACATGTGAGTGATCAGTGTCTGGCATGACTA  500

seq1  TGAGGGTTATTTTGATTACACTGAAGCAAGAAGATTCATTGGGCCGGGCG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGTTATTTTGATTACACTGAAGCAAGAAGATTCATTGGGCCGGGCG  550

seq1  TGGTGGTGCACGCCTTTAACCCCAGCACTCGGGAGGCGGAGGCAGAGGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGGTGCACGCCTTTAACCCCAGCACTCGGGAGGCGGAGGCAGAGGCA  600

seq1  GGCGGACTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGGACTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGG  650

seq1  ACGTCAGAGCTATACAGAGAAATCCTTGTCTCGAAAAACCAAAAAAAAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTCAGAGCTATACAGAGAAATCCTTGTCTCGAAAAACCAAAAAAAAAA  700

seq1  AAAAAAAAAAAAGATGATTCATTGGGTGACATCACACCTGGGCTGATGTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAAAAGATGATTCATTGGGTGACATCACACCTGGGCTGATGTC  750

seq1  TGTGTGAATAAGGAGGAAACTAGCTGAGCCCAGTATCTGTCCTTCCTCCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGAATAAGGAGGAAACTAGCTGAGCCCAGTATCTGTCCTTCCTCCC  800

seq1  TTCCTGACTGAAAGTGCAGTATGGAA-GGCCCAGCTACC-TTACC-TTCT  847
      |||||||||||||||||||||||||| |||||||||||| ||||| ||||
seq2  TTCCTGACTGAAAGTGCAGTATGGAAGGGCCCAGCTACCTTTACCTTTCT  850

seq1  ACGTGATGGATTGTACCTCAAACTGGGAGTCAGAATAAACGTTCTCTCCC  897
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  ACGTGATGGATTGTACCTC-AACTGGGAGTCAGAATAAACGTTCTCTCCC  899

seq1  TCCAGGTGTGTTT-GTCAGGTGTTCTGTCACATCAATAACATAAATAACT  946
      ||||||||||||| |||||||||||||||||||||||||||||||  |||
seq2  TCCAGGTGTGTTTGGTCAGGTGTTCTGTCACATCAATAACATAAAATACT  949

seq1  ACTATGG-TTCCCCAGGACTGAAGTTGCTAGGGTTTATATTTTTTAAAGC  995
      ||||||| |||||||||||||||||||||| |||||||||||||| ||||
seq2  ACTATGGTTTCCCCAGGACTGAAGTTGCTA-GGTTTATATTTTTTTAAGC  998

seq1  CGTG-TTTTGTTTCTGCC-TTCTTTTTAAAGCTA-CTTTGGAAATGT--A  1040
      |||| ||||||||||||| |||||||||||||||   ||||||||||   
seq2  CGTGTTTTTGTTTCTGCCTTTCTTTTTAAAGCTATACTTGGAAATGTTAT  1048

seq1  TTTTCTAT-AGTGAGT--ATCTGTAAGAAGTGGTGACCTGGGGAAGTTTC  1087
      |||||||| |||||||   ||||||   ||| ||||||  || |||||||
seq2  TTTTCTATAAGTGAGTTATTCTGTA--GAGTTGTGACCCTGGCAAGTTTC  1096

seq1  AG-TCCTTTGTCTG-CA-CAAACTTCTGTG-ATGTATGC  1122
      || ||||||||||| || |||||||||||| ||||||||
seq2  AGTTCCTTTGTCTGTCACCAAACTTCTGTGAATGTATGC  1135

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information