MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-054C05
Chromosome	11 (Build37)
Map Location	118,285,323 - 118,285,450
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Tnrc6c, Tmc6, Tmc8, 6030468B19Rik, Syngr2, Tk1, Afmid, Birc5, LOC546519, Tha1, Socs3, Pgs1, Dnahc17, Pscd1, Usp36, Timp2, Ddc8, Lgals3bp, Cant1
Downstream gene	C1qtnf1, D230014K01Rik, D11Bwg0517e, Enpp7, Cbx2, Cbx8, Cbx4, Tbc1d16, Ccdc40, Gaa, Eif4a3, Card14, Sgsh, Slc26a11, LOC672511
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tnrc6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217351 MGI:2443265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217353 MGI:1098686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217356 MGI:2669037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030468B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77727 MGI:1924977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	Syngr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20973 MGI:1328324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21877 MGI:98763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afmid (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71562 MGI:2448704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Birc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11799 MGI:1203517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC546519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71776 MGI:1919026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Socs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12702 MGI:1201791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74451 MGI:1921701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69926 MGI:1917176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins

name	Pscd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19157 MGI:1334257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72344 MGI:1919594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 107 ESTs, 3 Proteins

name	Timp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21858 MGI:98753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58251 MGI:1929713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals3bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19039 MGI:99554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cant1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	C1qtnf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56745 MGI:1919254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230014K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217364 MGI:2443788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Bwg0517e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Enpp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238011 MGI:3027917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12416 MGI:88289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30951 MGI:1353589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12418 MGI:1195985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207592 MGI:2652878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207607 MGI:2443893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gaa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14387 MGI:95609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192170 MGI:1923731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170720 MGI:2386258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgsh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27029 MGI:1350341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268512 MGI:2444589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Tnrc6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378034 GeneID:217351 MGI:2443265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 6C transcript_id : NM_198022.2

name	Tmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703875 GeneID:217353 MGI:1098686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 6 transcript_id : NM_145439.1

name	Tmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803122 GeneID:217353 MGI:1098686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like gene family 6 transcript_id : NM_181321.3

name	Tmc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469502 GeneID:217356 MGI:2669037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane channel-like 8 transcript_id : NM_181856.1

name	6030468B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390956 GeneID:77727 MGI:1924977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : RIKEN cDNA 6030468B19 gene transcript_id : XM_126537.4

name	Syngr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106428 GeneID:20973 MGI:1328324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 2 transcript_id : NM_009304.1

name	Tk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678356 GeneID:21877 MGI:98763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymidine kinase 1 transcript_id : NM_009387.1

name	Afmid (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560783 GeneID:71562 MGI:2448704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylformamidase transcript_id : NM_027827.2

name	Birc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59859889 GeneID:11799 MGI:1203517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : baculoviral IAP repeat-containing 5 transcript_id : NM_001012273.1

name	Birc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59859886 GeneID:11799 MGI:1203517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : baculoviral IAP repeat-containing 5 transcript_id : NM_009689.2

name	LOC546519 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390957 GeneID:546519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC546519 transcript_id : XM_621267.2

name	Tha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374714 GeneID:71776 MGI:1919026
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : threonine aldolase 1 transcript_id : NM_027919.2

name	Socs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982458 GeneID:12702 MGI:1201791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of cytokine signaling 3 transcript_id : NM_007707.2

name	Pgs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367139 GeneID:74451 MGI:1921701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylglycerophosphate synthase 1 transcript_id : NM_133757.2

name	Dnahc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262521 GeneID:69926 MGI:1917176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins product : dynein, axonemal, heavy chain 17 transcript_id : XM_126677.7

name	Pscd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543515 GeneID:19157 MGI:1334257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology, Sec7 and coiled-coil domains 1 transcript_id : NM_011180.2

name	Usp36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390967 GeneID:72344 MGI:1919594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 107 ESTs, 3 Proteins product : ubiquitin specific peptidase 36, transcript variant 1 transcript_id : XM_126772.6

name	Timp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61835847 GeneID:21858 MGI:98753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue inhibitor of metalloproteinase 2 transcript_id : NM_011594.3

name	Ddc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946811 GeneID:58251 MGI:1929713
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific protein, Ddc8 transcript_id : NM_021440.1

name	Lgals3bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130236 GeneID:19039 MGI:99554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactoside-binding, soluble, 3 binding protein transcript_id : NM_011150.2

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043963 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_001025618.1

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043971 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_001025617.1

name	Cant1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043950 GeneID:76025 MGI:1923275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium activated nucleotidase 1 transcript_id : NM_029502.2

name	C1qtnf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892163 GeneID:56745 MGI:1919254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1q and tumor necrosis factor related protein 1 transcript_id : NM_019959.2

name	D230014K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369815 GeneID:217364 MGI:2443788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230014K01 gene transcript_id : NM_172573.1

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677494 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001039168.1

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677498 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001024931.2

name	D11Bwg0517e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677496 GeneID:52897 MGI:106368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed transcript_id : NM_001039167.1

name	Enpp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71892413 GeneID:238011 MGI:3027917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleotide pyrophosphatase/phosphodiesterase 7 transcript_id : NM_001030291.1

name	Cbx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542345 GeneID:12416 MGI:88289
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 2 (Drosophila Pc class) transcript_id : NM_007623.2

name	Cbx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304946 GeneID:30951 MGI:1353589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 8 (Drosophila Pc class) transcript_id : NM_013926.1

name	Cbx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680861 GeneID:12418 MGI:1195985
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 4 (Drosophila Pc class) transcript_id : NM_007625.1

name	Tbc1d16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347142 GeneID:207592 MGI:2652878
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 16 transcript_id : NM_172443.2

name	Ccdc40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803137 GeneID:207607 MGI:2443893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 40 transcript_id : NM_175430.3

name	Gaa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982354 GeneID:14387 MGI:95609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, alpha, acid transcript_id : NM_008064.2

name	Eif4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149755 GeneID:192170 MGI:1923731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A, isoform 3 transcript_id : NM_138669.1

name	Card14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131044 GeneID:170720 MGI:2386258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase recruitment domain family, member 14 transcript_id : NM_130886.3

name	Sgsh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270982 GeneID:27029 MGI:1350341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-sulfoglucosamine sulfohydrolase (sulfamidase) transcript_id : NM_018822.3

name	Slc26a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85540462 GeneID:268512 MGI:2444589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 11 transcript_id : NM_178743.3

name	LOC672511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262525 GeneID:672511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical LOC672511 transcript_id : XM_001477846.1

name	Tnrc6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378035 GeneID:217351 MGI:2443265
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : trinucleotide repeat containing 6C protein_id : NP_932139.2

name	Tmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32441274 CCDS:CCDS25687.1 GeneID:217353 MGI:1098686
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; transmembrane channel-like protein 6 product : transmembrane channel-like protein 6 isoform 1 protein_id : NP_663414.2

name	Tmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044457 CCDS:CCDS25688.1 GeneID:217353 MGI:1098686
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transmembrane channel-like protein 6 product : transmembrane channel-like protein 6 isoform 2 protein_id : NP_851838.1

name	Tmc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469503 CCDS:CCDS25689.1 GeneID:217356 MGI:2669037
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane channel-like gene family 8 product : epidermodysplasia verruciformis 2 protein_id : NP_862904.1

name	6030468B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20913795 GeneID:77727 MGI:1924977
definition	codon_start : 1 product : hypothetical protein LOC77727 protein_id : XP_126537.1

name	Syngr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106429 CCDS:CCDS25691.1 GeneID:20973 MGI:1328324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 product : synaptogyrin 2 protein_id : NP_033330.1

name	Tk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678357 CCDS:CCDS25692.1 GeneID:21877 MGI:98763
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004797 - thymidine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 exception : mismatches in translation product : thymidine kinase 1 protein_id : NP_033413.1

name	Afmid (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746157 CCDS:CCDS25693.1 GeneID:71562 MGI:2448704
definition	EC_number : 3.5.1.9 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004061 - arylformamidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006569 - tryptophan catabolism [Evidence IEA]; GO:0019441 - tryptophan catabolism to kynurenine [Evidence IDA] codon_start : 1 note : fFormylkynureninase; formylkynureninase product : kynurenine formamidase protein_id : NP_082103.1

name	Birc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753090 CCDS:CCDS25694.1 GeneID:11799 MGI:1203517
definition	GO_component : GO:0005814 - centriole [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005881 - cytoplasmic microtubule [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0031021 - interphase microtubule organizing center [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0030496 - midbody [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0048037 - cofactor binding [Evidence ISS]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS] [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0051303 - establishment of chromosome localization [Evidence ISS]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007067 - mitosis [Evidence IEA]; GO:0043154 - negative regulation of caspase activity [Evidence ISS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence ISS]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence ISS]; GO:0031503 - protein complex localization [Evidence ISS]; GO:0031577 - spindle checkpoint [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; survivin; apoptosis inhibitor 4 product : baculoviral IAP repeat-containing 5 isoform 1 protein_id : NP_033819.1

name	Birc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59859890 CCDS:CCDS25695.1 GeneID:11799 MGI:1203517
definition	GO_component : GO:0005814 - centriole [Evidence ISS]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005881 - cytoplasmic microtubule [Evidence ISS]; GO:0005829 - cytosol [Evidence ISS]; GO:0031021 - interphase microtubule organizing center [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0030496 - midbody [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0048037 - cofactor binding [Evidence ISS]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS] [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0051303 - establishment of chromosome localization [Evidence ISS]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007067 - mitosis [Evidence IEA]; GO:0043154 - negative regulation of caspase activity [Evidence ISS]; GO:0043524 - negative regulation of neuron apoptosis [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence ISS]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence ISS]; GO:0031503 - protein complex localization [Evidence ISS]; GO:0031577 - spindle checkpoint [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; survivin; apoptosis inhibitor 4 product : baculoviral IAP repeat-containing 5 isoform 3 protein_id : NP_001012273.1

name	LOC546519 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390958 GeneID:546519
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621267.2

name	Tha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229133 GeneID:71776 MGI:1919026
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : threonine aldolase 1 protein_id : NP_082195.1

name	Socs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671758 CCDS:CCDS25697.1 GeneID:12702 MGI:1201791
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence IDA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : cytokine inducible SH2-containing protein 3; STAT-induced STAT inhibitor 3; cytokine-inducible SH2 protein 3; E2a-Pbx1 target gene in fibroblasts 10 product : suppressor of cytokine signaling 3 protein_id : NP_031733.1

name	Pgs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626163 CCDS:CCDS25698.1 GeneID:74451 MGI:1921701
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008444 - CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity [Evidence ISS] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence ISS] codon_start : 1 product : silencer-associated factor protein_id : NP_598518.1

name	Dnahc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262522 GeneID:69926 MGI:1917176
definition	codon_start : 1 note : overriding stop codons product : similar to hCG1813078 protein_id : XP_126677.7 transl_except : (pos:complement(117887371..117887373),aa:OTHER)

name	Pscd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543516 GeneID:19157 MGI:1334257
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 note : cytohesin 1 product : pleckstrin homology, Sec7 and coiled-coil domains 1 protein_id : NP_035310.2

name	Usp36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390968 GeneID:72344 MGI:1919594
definition	codon_start : 1 product : ubiquitin specific protease 36 isoform 1 protein_id : XP_126772.5

name	Timp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543867 CCDS:CCDS25699.1 GeneID:21858 MGI:98753
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0009986 - cell surface [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IMP]; GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0005178 - integrin binding [Evidence IDA]; GO:0008191 - metalloendopeptidase inhibitor activity [Evidence TAS] [Evidence IMP] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0030814 - regulation of cAMP metabolism [Evidence IDA]; GO:0043408 - regulation of MAPKKK cascade [Evidence IDA]; GO:0045664 - regulation of neuron differentiation [Evidence IDA] [Evidence IMP] codon_start : 1 product : tissue inhibitor of metalloproteinase 2 protein_id : NP_035724.2

name	Ddc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946812 CCDS:CCDS25700.1 GeneID:58251 MGI:1929713
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : testis-specific protein DDC8 product : testis specific protein, Ddc8 protein_id : NP_067415.1

name	Lgals3bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755144 CCDS:CCDS25701.1 GeneID:19039 MGI:99554
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence ISS] [Evidence TAS] codon_start : 1 note : peptidylprolyl isomerase C-associated protein; mama product : lectin, galactoside-binding, soluble, 3 binding protein protein_id : NP_035280.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043972 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_001020788.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043964 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_001020789.1

name	Cant1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043951 CCDS:CCDS25702.1 GeneID:76025 MGI:1923275
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004382 - guanosine-diphosphatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA]; GO:0045134 - uridine-diphosphatase activity [Evidence ISS] GO_process : GO:0009191 - ribonucleoside diphosphate catabolism [Evidence IC] codon_start : 1 note : apyrase 1, homolog (C. lectularius) product : Ca2+-dependent endoplasmic reticulum nucleoside diphosphatase protein_id : NP_083778.2

name	C1qtnf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910610 CCDS:CCDS25703.1 GeneID:56745 MGI:1919254
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA]; GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 note : putative secreted protein ZSIG37; mouse ortholog product : C1q and tumor necrosis factor related protein 1 protein_id : NP_064343.1

name	D230014K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369816 CCDS:CCDS25704.1 GeneID:217364 MGI:2443788
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217364 protein_id : NP_766161.1

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677499 CCDS:CCDS25705.1 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 3 protein_id : NP_001020102.2

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677495 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 2 protein_id : NP_001034257.1

name	D11Bwg0517e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677497 CCDS:CCDS25706.1 GeneID:52897 MGI:106368
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed isoform 1 protein_id : NP_001034256.1

name	Enpp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892414 CCDS:CCDS25707.1 GeneID:238011 MGI:3027917
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008252 - nucleotidase activity [Evidence ISS]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence ISS] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006685 - sphingomyelin catabolism [Evidence ISS] codon_start : 1 product : ectonucleotide pyrophosphatase/phosphodiesterase 7 protein_id : NP_001025462.1

name	Cbx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542346 CCDS:CCDS25708.1 GeneID:12416 MGI:88289
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0031519 - PcG protein complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : M33 polycomb-like protein; hromobox homolog 2 product : chromobox homolog 2 protein_id : NP_031649.2

name	Cbx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304947 CCDS:CCDS25709.1 GeneID:30951 MGI:1353589
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006342 - chromatin silencing [Evidence ISS]; GO:0016574 - histone ubiquitination [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : polycomb 3 product : chromobox homolog 8 protein_id : NP_038954.1

name	Cbx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680862 CCDS:CCDS25710.1 GeneID:12418 MGI:1195985
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : homeobox gene repression note : polycomb 2 homolog product : chromobox homolog 4 protein_id : NP_031651.1

name	Tbc1d16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369589 CCDS:CCDS25711.1 GeneID:207592 MGI:2652878
definition	codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 16 protein_id : NP_766031.1

name	Ccdc40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425148 CCDS:CCDS25712.1 GeneID:207607 MGI:2443893
definition	codon_start : 1 product : coiled-coil domain containing 40 protein_id : NP_780639.1

name	Gaa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982355 CCDS:CCDS25713.1 GeneID:14387 MGI:95609
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IDA] [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005980 - glycogen catabolism [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acid alpha-glucosidase protein_id : NP_032090.2

name	Eif4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149756 CCDS:CCDS25714.1 GeneID:192170 MGI:1923731
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 48 protein_id : NP_619610.1

name	Card14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700028 CCDS:CCDS25715.1 GeneID:170720 MGI:2386258
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : caspase recruitment domain family, member 14 protein_id : NP_570956.1

name	Sgsh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543697 GeneID:27029 MGI:1350341
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016250 - N-sulfoglucosamine sulfohydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0030201 - heparan sulfate proteoglycan metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : sulphamidase product : N-sulfoglucosamine sulfohydrolase (sulfamidase) protein_id : NP_061292.2

name	Slc26a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85540463 CCDS:CCDS25717.1 GeneID:268512 MGI:2444589
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel sulfate transporter protein (Slc26a11) product : anion exchanger Slc26a11 protein_id : NP_848858.2

name	LOC672511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262526 GeneID:672511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477896.1

clone name	MSMg01-372O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-054C05.T7 (MSMg01no054_c05.b1)	MSMg01-054C05.TJ (MSMg01no054_c05.g1)
ACC	AG282156	AG282157
length	852	769
length of high quality (start - end)	39 (248 - 286)	128 (210 - 337)
definition	CHROMAT_FILE: MSMg01no054_c05.b1 PHD_FILE: MSMg01no054_c05.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 16:55:15 2005	CHROMAT_FILE: MSMg01no054_c05.g1 PHD_FILE: MSMg01no054_c05.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 16:55:15 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NGGGGGGGGGGNNNGNNNNNGNACGGGGCCTCCGTCCCATCCAGGGTGTT GTTGGTTTCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXCCGGAAANGA GNGNGGNATTNNNAATTTACTANGAGGAGAGGGNATNANTNAAGNANNAG TTGGGGGGATGGGGAATGAGGTATGCCCCCTTNATTTTANAGANGNAGGG AGAAGTTTATGTTNTTATNATGGNNTTGGGNATAATGTTAGATCTTATTT GGGTGTGAGGGGGTGTGGTGGTTGGGAGTGTGTAGTTTTGAGATGTTGGA TATGATGTTTTTTTGATGTGTGGGTTGAATGGGAATTGTGTTTATTTAGT AGAGGGAGGGGAAGGAGTGTTTTTTTTTTTTTTGNAGGGTGAGTGGGGTT TAGTTTTATTTTATTTTTGTGTGTTTATGTAGGGGGAGGGAAGGATTAGT TATATGGTTGCTTTGATAGTTTTTATTTTATATTATTTTTTGAGTTGTGT GTTTGTTAGATTTATTATGGAGTGTTGTGAGAAAAGATTTTGTTTTTGTT TGTTTTTATTGTGGAGGTGTTGTTTAGTAGATGTTGTTAGTTTTATATTT TTATTTTTAGTGATGGGTTAGATTTGTTTGTGGGTTGTTTGGTGTGTGTA TTGTATATGTTGTGTGTGTTGGTTTGTGGTTGNGTGTTGGTGGTGTGTTT TGTGATTATTTTAATTGTATTGATTTGGTTGATTTATTTTTTTTTTTTGT ATAAAGTTTTTGATAAATTGTGTATTAATATAGTTAAAGTATTTTTTTTA GATTGTTTTTAATGTGGTTTTGTAGTGGTTATTATTTTTGTGGTAGTAGT GT	NNNNNTTTTNNNNNTTTTNCCCCCCTCCTTCNGTGNGNTTTTGCTTTTTT TCTACGATGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXTTACCCGCGACAATCAAAAGTTTGCAAAGCCAGCC TTTGCCTGTGGGATAGCCGGGCTGACGAGCCCAGAATAGCCGGCTTGGCA GAATGTTAGGGCCCCAGTGGGAGAAGACATAGAGCTGCTAATGACATGCT GTGCTCACTGGGGACCCAGTGTCTCTCTACAGCAGCCCAGGTCTCACAGC CCTTTCCCCAAACCAGAGAACAGCAGCAGGAATGATGTCTCCAGCGCAGA AGGAAAGAATTGCCCAGTCAGCCGGGTCTGGGGAGATGCCTCAGCAGGGT GCAAGAGCACCTGCTGGATTAGCTTGCCGATGGAGATCTCAAAGGTAATC GGGTGAGGAGTGACCAACTCGCACACACGCGCGCACACACTCTTGCACAC ACACTCCACACACTCACACCCACACACATCAGTCCACTATACTTCAAACA GATACACTTCATACACACATATATATATAAAAGCTAATAAATATAGCATT ACCCTATGTCTTGCTCCCACCTTGCCCCTGTATTACGCTCGCTGTTAGGA ATGCTCCTCCGTTCTCTCGTGTTCTTCCCCCAGGATCTGCCCCGTCCTGA AAAGAGAGAGACTTTTGGTAATATGTGACGAACCCTTTGTTGTCTCGACC TATAAACCCTTGTACGTGA
quality values	Open. Hide. 0 3 7 7 9 9 9 9 7 7 3 0 0 0 3 0 0 0 0 0 3 0 3 10 13 13 10 10 10 11 11 15 8 8 7 6 8 8 8 8 8 8 8 8 9 8 6 6 6 6 6 8 8 9 9 8 8 7 8 15 8 9 11 12 12 13 23 25 33 32 17 15 12 17 18 20 30 22 20 15 16 11 11 16 17 19 9 9 9 6 6 6 6 6 6 7 3 0 3 6 3 0 3 0 3 3 0 3 8 3 0 0 0 3 9 9 7 7 7 7 11 3 0 3 9 9 9 11 12 11 9 9 3 0 3 3 0 3 0 3 0 3 23 3 0 3 0 0 3 7 7 9 9 19 44 47 25 28 28 28 31 31 53 35 36 35 30 36 31 30 24 21 21 22 19 19 10 13 9 8 8 3 0 3 17 10 8 8 3 0 3 8 3 0 3 0 3 23 21 30 30 33 21 23 11 9 8 6 6 6 6 6 3 0 3 6 8 3 0 3 7 7 3 0 0 3 27 25 23 3 0 3 9 9 9 15 19 18 19 19 9 9 9 27 27 9 9 9 27 27 47 41 41 41 43 59 48 47 47 43 43 48 48 48 48 57 48 48 30 28 12 11 11 25 20 36 36 37 33 31 30 28 28 23 17 12 12 10 14 9 9 9 9 9 11 11 13 18 15 9 9 9 10 10 10 11 11 10 10 10 15 12 12 12 12 11 10 13 13 18 10 13 12 12 12 13 18 18 23 24 24 18 10 10 9 18 15 8 8 8 8 8 8 11 8 8 8 8 8 8 8 8 8 8 8 13 15 23 22 23 9 9 9 10 10 16 14 19 13 9 9 9 10 12 8 10 9 16 16 11 9 8 9 3 0 3 9 9 11 11 10 8 8 8 8 10 8 13 8 10 8 8 8 8 12 13 9 8 8 13 13 9 9 9 18 14 16 12 8 6 7 7 7 7 9 10 10 12 13 12 11 11 11 11 9 9 9 9 12 14 14 11 9 9 11 14 11 12 9 9 9 9 9 9 9 8 8 8 8 8 9 10 8 8 8 6 6 8 8 8 8 8 11 11 10 10 10 9 10 10 11 8 8 8 8 8 8 13 12 9 8 8 8 8 8 6 6 8 8 8 8 8 8 8 6 8 8 8 8 10 10 14 14 12 9 8 8 6 7 10 11 10 11 6 6 6 6 8 8 8 8 8 9 10 11 11 11 11 12 10 10 8 8 8 7 10 6 6 8 10 13 19 20 20 18 15 10 10 9 8 8 8 8 6 6 8 8 8 8 8 8 6 8 13 8 8 8 8 8 8 8 8 6 6 8 8 9 9 9 9 10 10 11 10 10 10 10 12 12 15 8 6 6 6 13 7 13 10 8 8 6 6 8 8 10 10 15 12 12 11 11 10 8 8 10 8 8 10 10 10 9 8 8 8 10 8 8 11 12 15 10 11 11 8 8 8 6 7 6 6 8 6 7 6 8 8 10 10 10 10 10 8 8 8 8 7 7 12 12 13 10 10 10 10 8 8 8 8 8 8 8 3 0 3 9 8 8 8 12 12 13 7 8 10 9 9 9 9 12 12 14 14 10 9 9 8 8 10 8 8 8 9 9 8 8 8 8 6 7 6 8 6 6 8 8 8 8 8 8 8 8 6 6 10 6 8 8 10 12 11 11 11 13 14 15 9 12 7 7 8 8 8 8 6 6 6 6 8 8 10 6 6 6 6 8 8 6 6 6 6 8 6 6 8 8 8 8 8 10 8 8 6 6 6 8 8 10 9 6 8 6 6 8 7 10 14 10 10 8 8 8 6 6 7 7 10 10 13 13 8 8 8 8 8 8 8 8 9 13 10 6 6 8 8 6 7 8 8 9 9 8 8 6 6 6 8 13 13 8 6 6 10 8 9 8 8 8 9 8 8 8 7	Open. Hide. 0 0 0 0 0 3 7 7 3 0 0 0 0 0 3 7 7 3 0 3 7 7 9 9 7 7 6 8 8 17 3 0 3 8 3 0 3 0 3 9 9 9 11 11 11 11 12 12 9 8 8 7 6 6 6 8 8 8 8 8 8 7 8 8 8 9 9 15 28 28 28 28 37 29 20 20 20 20 21 33 39 39 19 19 10 9 9 9 11 9 11 10 11 10 10 10 18 17 26 23 28 34 33 33 33 33 33 41 34 34 30 16 12 9 11 11 11 11 11 12 15 15 8 8 6 6 6 8 8 15 12 28 37 37 39 39 43 43 43 43 43 43 43 39 39 39 39 39 39 46 48 48 57 48 48 43 43 43 43 43 24 24 24 24 24 24 43 47 39 23 18 10 10 10 15 10 12 12 12 22 28 39 40 33 33 33 33 32 32 35 39 39 43 39 30 28 14 14 14 15 19 19 19 19 18 18 23 20 20 23 28 23 25 34 33 30 23 23 23 22 22 22 23 23 23 28 31 28 24 21 20 20 25 36 36 48 48 48 42 42 30 30 42 42 42 47 42 42 32 33 27 33 27 33 33 37 37 37 43 33 41 32 32 19 30 25 32 32 37 37 40 43 46 47 48 57 57 57 44 32 24 17 17 19 22 24 30 42 32 39 39 43 39 42 32 37 28 44 23 23 27 41 36 46 43 41 37 32 32 33 37 46 57 57 43 47 43 32 29 28 28 30 28 28 25 25 25 28 29 36 28 28 28 28 28 32 19 16 14 14 14 14 23 8 8 6 6 10 8 12 15 14 14 15 23 32 39 39 37 37 37 43 39 34 24 16 12 12 12 12 12 15 15 15 12 9 9 9 18 18 20 24 31 37 31 31 28 28 25 25 18 19 13 15 18 24 24 19 19 19 19 21 14 14 12 19 12 12 13 22 25 21 20 16 16 8 8 8 8 8 8 10 15 19 19 17 11 9 9 11 17 13 16 20 20 24 32 34 32 23 23 23 28 32 28 28 28 28 25 19 18 18 21 28 39 32 39 32 31 23 20 18 29 25 25 16 16 10 10 10 19 10 16 16 21 18 21 22 22 28 25 24 19 22 12 11 11 10 9 9 9 9 10 10 23 16 16 11 11 11 12 11 11 11 14 15 12 12 10 16 10 10 10 12 12 13 12 12 12 12 11 11 11 11 8 10 10 9 8 8 9 9 10 10 13 10 11 11 11 11 11 11 11 10 10 10 8 8 8 15 15 15 11 11 11 9 9 8 8 10 12 12 14 19 19 15 15 10 10 11 12 12 14 13 8 8 8 8 8 10 10 19 17 17 13 8 8 8 8 8 8 10 10 10 10 10 10 12 11 11 11 11 12 12 12 12 15 20 14 8 8 6 6 8 6 8 8 8 8 10 10 10 11 10 10 9 9 10 12 13 8 8 8 8 8 11 11 8 8 8 8 10 8 6 7 8 8 10 9 8 8 8 8 8 10 10 10 11 8 13 6 6 8 10 19 26 21 9 9 10 16 16 22 33 26 19 10 10 10 13 13 12 12 12 11 12 12 16 13 10 9 8 8 8 11 11 12 12 10 8 8 8 8 8 8 10 10 10 11 11 11 10 9 9 9 9 9 10 12 11 11 11 8 8 6 6 10 10 15 14 13 11 11 13 18 13 17 12 12 12 16 12 10 12 8 8 8 8 8 8 9 8 8 8 8 8 8 10 10 13 10 8 8 8 6 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no054_c05.g1 MSMg01no054_c05.g1 CHROMAT_FILE:
MSMg01no054_c05.g1 PHD_FILE: MSMg01no054_c05.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 16:55:15 2005
         (128 letters)



>mm_chr11_118285123_118285650
          Length = 528

 Score =  232 bits (120), Expect = 5e-66
 Identities = 126/128 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   ggccccagtgggagaagacatagagctgctaatgacatgctgtgctcactggggacccag 60
           ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||
Sbjct: 201 ggccccagtgggagaagacatggggctgctaatgacatgctgtgctcactggggacccag 260

                                                                       
Query: 61  tgtctctctacagcagcccaggtctcacagccctttccccaaaccagagaacagcagcag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tgtctctctacagcagcccaggtctcacagccctttccccaaaccagagaacagcagcag 320

                   
Query: 121 gaatgatg 128
           ||||||||
Sbjct: 321 gaatgatg 328


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 128
Length of database: 528
Length adjustment: 8
Effective length of query: 120
Effective length of database: 520
Effective search space:    62400
Effective search space used:    62400
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information