MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-104M10
Chromosome	11 (Build37)
Map Location	72,752,861 - 72,753,055
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Aipl1, 6720460F02Rik, Pitpnm3, 4933427D14Rik, Txnl5, Med31, 4930563E22Rik, Slc13a5, Fbxo39, LOC628100, Tekt1, D130058I21Rik, Ggt6, Mybbp1a, 9830002I17Rik, LOC432577, Ube2g1, Ankfy1, Cyb5d2, Zzef1, LOC627119
Downstream gene	Atp2a3, P2rx1, LOC100043309, Camkk1, 1200014J11Rik, Itgae, Gsg2, P2rx5, Tmem93, Tax1bp3, Ctns, Carkl, Trpv1, Trpv3, Aspa, Spata22, Olfr20, Olfr376, Olfr377-ps1, Olfr1, Olfr75-ps1, Olfr378, Olfr379-ps1, Olfr380, Olfr381, Olfr382, Olfr383-ps1, Olfr385, Olfr386, Olfr387-ps1, 1700012C15Rik, Olfr388-ps1, Olfr389, Olfr390, Olfr391-ps1, Olfr392, Olfr393, Olfr394, Olfr395, Olfr396-ps1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aipl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114230 MGI:2148800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6720460F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109212 MGI:1924434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitpnm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327958 MGI:2685726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933427D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74477 MGI:1921727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52700 MGI:1289248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67279 MGI:1914529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930563E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75304 MGI:1922554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs

name	Slc13a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237831 MGI:3037150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327959 MGI:3505735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins

name	Tekt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21689 MGI:1333819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D130058I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276829 MGI:2442764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71522 MGI:1918772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybbp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18432 MGI:106181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830002I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77577 MGI:1924827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 607 ESTs, 13 Proteins pseudo : _no_value

name	Ube2g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67128 MGI:1914378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankfy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11736 MGI:1337008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192986 MGI:2684848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zzef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195018 MGI:2444286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 292 ESTs, 7 Proteins pseudo : _no_value

name	Atp2a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53313 MGI:1194503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18436 MGI:1098235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043309 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Camkk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55984 MGI:1891766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200014J11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66874 MGI:1914124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gsg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14841 MGI:1194498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94045 MGI:2137026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66048 MGI:1913298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tax1bp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76281 MGI:1923531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctns (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83429 MGI:1932872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Carkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74637 MGI:1921887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193034 MGI:1341787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246788 MGI:2181407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aspa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11484 MGI:87914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380709 MGI:2685728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258925 MGI:109315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258924 MGI:3030210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr377-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258226 MGI:3030211
definition	gene_synonym : MOR135-15 note : olfactory receptor 377, pseudogene 1 pseudo : _no_value

name	Olfr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258923 MGI:102698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr75-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258186 MGI:2153204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Olfr378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259026 MGI:3030212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr379-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257942 MGI:3030213
definition	gene_synonym : MOR135-25 note : olfactory receptor 379, pseudogene 1 pseudo : _no_value

name	Olfr380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259027 MGI:3030214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259024 MGI:3030215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258435 MGI:3030216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr383-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258211 MGI:3030217
definition	gene_synonym : MOR135-16P note : olfactory receptor 383, pseudogene 1 pseudo : _no_value

name	Olfr385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259025 MGI:3030219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193053 MGI:3030220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr387-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258210 MGI:3030221
definition	gene_synonym : MOR135-17 note : olfactory receptor 387, pseudogene 1 pseudo : _no_value

name	1700012C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76390 MGI:1923640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Olfr388-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258182 MGI:3030222
definition	gene_synonym : MOR135-22 note : olfactory receptor 388, pseudogene 1 pseudo : _no_value

name	Olfr389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259011 MGI:3030223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr390 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258344 MGI:3030224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr391-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258236 MGI:3030225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2296 Proteins pseudo : _no_value

name	Olfr392 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259008 MGI:3030226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr393 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259010 MGI:3030227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259009 MGI:3030228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259007 MGI:3030229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr396-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258208 MGI:3030230
definition	gene_synonym : MOR135-19 note : olfactory receptor 396, pseudogene 1 pseudo : _no_value

name	Aipl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426862 GeneID:114230 MGI:2148800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl hydrocarbon receptor-interacting protein-like 1 transcript_id : NM_053245.1

name	6720460F02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388016 GeneID:109212 MGI:1924434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720460F02 gene transcript_id : NM_144526.3

name	Pitpnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032318 GeneID:327958 MGI:2685726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PITPNM family member 3 transcript_id : NM_001081641.1

name	Pitpnm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032351 GeneID:327958 MGI:2685726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PITPNM family member 3 transcript_id : NM_001024927.2

name	4933427D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130566 GeneID:74477 MGI:1921727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933427D14 gene transcript_id : NM_028963.2

name	Txnl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801882 GeneID:52700 MGI:1289248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin-like 5 transcript_id : NM_026559.3

name	Med31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119161 GeneID:67279 MGI:1914529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 31 homolog (yeast) transcript_id : NM_026068.2

name	4930563E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390195 GeneID:75304 MGI:1922554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs product : RIKEN cDNA 4930563E22 gene, transcript variant 1 transcript_id : XM_618902.3

name	Slc13a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385951 GeneID:237831 MGI:3037150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 transcript_id : NM_001004148.3

name	Fbxo39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803481 GeneID:327959 MGI:3505735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 39 transcript_id : NM_001037713.2

name	LOC628100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261980 GeneID:628100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to novel F-box domain containing protein transcript_id : XM_892822.3

name	Tekt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956378 GeneID:21689 MGI:1333819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 1 transcript_id : NM_011569.2

name	D130058I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130489 GeneID:276829 MGI:2442764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130058I21 gene transcript_id : NM_177776.3

name	Ggt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647221 GeneID:71522 MGI:1918772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyltransferase 6 transcript_id : NM_027819.2

name	Mybbp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982723 GeneID:18432 MGI:106181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYB binding protein (P160) 1a transcript_id : NM_016776.2

name	9830002I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366352 GeneID:77577 MGI:1924827
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830002I17 gene transcript_id : NM_029932.2

name	Ube2g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292440 GeneID:67128 MGI:1914378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) transcript_id : NM_025985.4

name	Ankfy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130294 GeneID:11736 MGI:1337008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and FYVE domain containing 1 transcript_id : NM_009671.5

name	Cyb5d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972403 GeneID:192986 MGI:2684848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 domain containing 2 transcript_id : NM_001024926.1

name	Zzef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865904 GeneID:195018 MGI:2444286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, ZZ-type with EF hand domain 1 transcript_id : NM_001045536.1

name	Atp2a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542158 GeneID:53313 MGI:1194503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, ubiquitous transcript_id : NM_016745.2

name	P2rx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560658 GeneID:18436 MGI:1098235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 1 transcript_id : NM_008771.2

name	LOC100043309 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261984 GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043309 transcript_id : XM_001480517.1

name	Camkk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922602 GeneID:55984 MGI:1891766
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase kinase 1, alpha transcript_id : NM_018883.2

name	1200014J11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802919 GeneID:66874 MGI:1914124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200014J11 gene transcript_id : NM_025818.2

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680481 GeneID:16407 MGI:1298377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_008399.1

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227222 GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_172944.2

name	Gsg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106328 GeneID:14841 MGI:1194498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-specific gene 2 transcript_id : NM_010353.1

name	P2rx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349156 GeneID:94045 MGI:2137026
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 5 transcript_id : NM_033321.2

name	Tmem93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354019 GeneID:66048 MGI:1913298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 93 transcript_id : NM_025318.2

name	Tax1bp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803240 GeneID:76281 MGI:1923531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tax1 (human T-cell leukemia virus type I) binding protein 3 transcript_id : NM_029564.2

name	Ctns (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354408 GeneID:83429 MGI:1932872
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystinosis, nephropathic transcript_id : NM_031251.3

name	Carkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286807 GeneID:74637 MGI:1921887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate kinase-like transcript_id : NM_029031.3

name	Trpv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47825363 GeneID:193034 MGI:1341787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 1 transcript_id : NM_001001445.1

name	Trpv3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21492637 GeneID:246788 MGI:2181407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 3 transcript_id : NM_145099.1

name	Aspa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354273 GeneID:11484 MGI:87914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartoacylase (aminoacylase) 2 transcript_id : NM_023113.4

name	Spata22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865896 GeneID:380709 MGI:2685728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 22 transcript_id : NM_001045531.1

name	Olfr20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239301 GeneID:258925 MGI:109315
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 20 transcript_id : NM_146923.1

name	Olfr376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239303 GeneID:258924 MGI:3030210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 376 transcript_id : NM_146922.1

name	Olfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129048 GeneID:258923 MGI:102698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1 transcript_id : NM_146921.1

name	Olfr378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128892 GeneID:259026 MGI:3030212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 378 transcript_id : NM_147024.1

name	Olfr380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128894 GeneID:259027 MGI:3030214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 380 transcript_id : NM_147025.1

name	Olfr381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583634 GeneID:259024 MGI:3030215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 381 transcript_id : NM_147022.2

name	Olfr382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239297 GeneID:258435 MGI:3030216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 382 transcript_id : NM_146443.1

name	Olfr385 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239299 GeneID:259025 MGI:3030219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 385 transcript_id : NM_147023.1

name	Olfr386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402198 GeneID:193053 MGI:3030220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 386 transcript_id : NM_207224.1

name	1700012C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390200 GeneID:76390 MGI:1923640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 1700012C15 gene transcript_id : XM_111107.7

name	Olfr389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735421 GeneID:259011 MGI:3030223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 389 transcript_id : NM_147009.2

name	Olfr390 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129603 GeneID:258344 MGI:3030224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 390 transcript_id : NM_146347.1

name	Olfr392 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128926 GeneID:259008 MGI:3030226
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 392 transcript_id : NM_147006.1

name	Olfr393 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128920 GeneID:259010 MGI:3030227
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 393 transcript_id : NM_147008.1

name	Olfr394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128928 GeneID:259009 MGI:3030228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 394 transcript_id : NM_147007.1

name	Olfr395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128932 GeneID:259007 MGI:3030229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 395 transcript_id : NM_147005.1

name	Aipl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426863 CCDS:CCDS24976.1 GeneID:114230 MGI:2148800
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0001917 - photoreceptor inner segment [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0001918 - farnesylated protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0007603 - phototransduction, visible light [Evidence IMP]; GO:0018343 - protein farnesylation [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA]; GO:0030823 - regulation of cGMP metabolism [Evidence IMP]; GO:0001895 - retinal homeostasis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : aryl hydrocarbon receptor-interacting protein-like 1 protein_id : NP_444475.1

name	6720460F02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27735010 GeneID:109212 MGI:1924434
definition	codon_start : 1 product : hypothetical protein LOC109212 protein_id : NP_653109.2

name	Pitpnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032319 GeneID:327958 MGI:2685726
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Pitpnm family member 3 isoform 2 protein_id : NP_001075110.1

name	Pitpnm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972419 CCDS:CCDS24978.1 GeneID:327958 MGI:2685726
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Pitpnm family member 3 isoform 1 protein_id : NP_001020098.1

name	4933427D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859728 CCDS:CCDS24979.1 GeneID:74477 MGI:1921727
definition	codon_start : 1 product : hypothetical protein LOC74477 protein_id : NP_083239.1

name	Txnl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386060 CCDS:CCDS24980.1 GeneID:52700 MGI:1289248
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : putative 42-9-9 protein product : thioredoxin-like 5 protein_id : NP_080835.1

name	Med31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119162 CCDS:CCDS24981.1 GeneID:67279 MGI:1914529
definition	GO_component : GO:0000119 - mediator complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016455 - RNA polymerase II transcription mediator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 31 homolog protein_id : NP_080344.2

name	4930563E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63622315 GeneID:75304 MGI:1922554
definition	codon_start : 1 product : hypothetical protein LOC75304 isoform 1 protein_id : XP_618902.1

name	Slc13a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921291 CCDS:CCDS24983.1 GeneID:237831 MGI:3037150
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0015137 - citrate transporter activity [Evidence IDA]; GO:0015141 - succinate transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015142 - tricarboxylic acid transporter activity [Evidence IDA] GO_process : GO:0015746 - citrate transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0015744 - succinate transport [Evidence IDA]; GO:0006842 - tricarboxylic acid transport [Evidence IDA] codon_start : 1 note : sodium-coupled citrate transporter; novel solute carrier family 13 (sodium-dependent dicarboxylate transporter) (Slc13a2 or 3) member product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 protein_id : NP_001004148.1

name	Fbxo39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702282 CCDS:CCDS24984.1 GeneID:327959 MGI:3505735
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : F-box protein 38; novel TRAF-type zinc finger protein product : F-box protein 39 protein_id : NP_001032802.1

name	LOC628100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261981 GeneID:628100
definition	codon_start : 1 product : similar to novel F-box domain containing protein protein_id : XP_897915.3

name	Tekt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956379 GeneID:21689 MGI:1333819
definition	GO_component : GO:0005874 - microtubule [Evidence IDA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : tektin 1 protein_id : NP_035699.2

name	D130058I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244296 CCDS:CCDS24985.1 GeneID:276829 MGI:2442764
definition	codon_start : 1 product : hypothetical protein LOC276829 protein_id : NP_808444.1

name	Ggt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647222 GeneID:71522 MGI:1918772
definition	GO_function : GO:0003840 - gamma-glutamyltransferase activity [Evidence IEA] codon_start : 1 product : gamma-glutamyltransferase 6 protein_id : NP_082095.2

name	Mybbp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982724 CCDS:CCDS24986.1 GeneID:18432 MGI:106181
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0042564 - NLS-dependent protein nuclear import complex [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence TAS] GO_process : GO:0006118 - electron transport [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear protein P160; myb-binding protein 1a product : MYB binding protein (P160) 1a protein_id : NP_058056.2

name	9830002I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037493 CCDS:CCDS24987.1 GeneID:77577 MGI:1924827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77577 protein_id : NP_084208.1

name	Ube2g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754105 GeneID:67128 MGI:1914378
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2G 1 protein_id : NP_080261.2

name	Ankfy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702366 CCDS:CCDS24989.1 GeneID:11736 MGI:1337008
definition	GO_component : GO:0010008 - endosome membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence NAS] codon_start : 1 note : ankyrin repeat hooked to zinc finger motif; ankyrin repeat hooked to a zinc finger motif short form; Rabankyrin-5 product : ankyrin repeat and FYVE domain containing 1 protein_id : NP_033801.4

name	Cyb5d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972404 CCDS:CCDS24990.1 GeneID:192986 MGI:2684848
definition	codon_start : 1 exception : mismatches in translation product : cytochrome b5 domain containing 2 protein_id : NP_001020097.1

name	Zzef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865905 GeneID:195018 MGI:2444286
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA]; GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA] codon_start : 1 note : KIAA0399-like protein human product : zinc finger, ZZ-type with EF hand domain 1 protein_id : NP_001039001.1

name	Atp2a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542159 CCDS:CCDS24991.1 GeneID:53313 MGI:1194503
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sarcoendoplasmic reticulum Ca2+ ATPase; sarcoendoplasmic reticulum Ca2+ ATPase type 3 SERCA3 product : ATPase, Ca++ transporting, ubiquitous protein_id : NP_058025.2

name	P2rx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560659 CCDS:CCDS24992.1 GeneID:18436 MGI:1098235
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P2X1 receptor; programmed cell death 3 product : purinergic receptor P2X1 protein_id : NP_032797.2

name	LOC100043309 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261985 GeneID:100043309
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480567.1

name	Camkk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922603 CCDS:CCDS24993.1 GeneID:55984 MGI:1891766
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004683 - calmodulin regulated protein kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : calcium calmodulin dependent protein kinase kinase alpha product : calcium/calmodulin-dependent protein kinase kinase 1, alpha protein_id : NP_061371.2

name	1200014J11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229010 CCDS:CCDS24994.1 GeneID:66874 MGI:1914124
definition	codon_start : 1 exception : mismatches in translation product : ELG protein protein_id : NP_080094.2

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680482 CCDS:CCDS24995.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation function : adhesion receptor note : isoform 1 is encoded by transcript variant 1; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 1 protein_id : NP_032425.1

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370456 CCDS:CCDS24996.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 2 protein_id : NP_766532.1

name	Gsg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106329 CCDS:CCDS24997.1 GeneID:14841 MGI:1194498
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP] codon_start : 1 note : haploid germ cell-specific nuclear protein kinase product : germ cell-specific gene 2 protein_id : NP_034483.1

name	P2rx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15277325 CCDS:CCDS24998.1 GeneID:94045 MGI:2137026
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC] GO_function : GO:0004931 - ATP-gated cation channel activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : purinergic receptor P2X5 protein_id : NP_201578.1

name	Tmem93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384684 CCDS:CCDS24999.1 GeneID:66048 MGI:1913298
definition	codon_start : 1 product : hypothetical protein LOC66048 protein_id : NP_079594.1

name	Tax1bp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313140 CCDS:CCDS25000.1 GeneID:76281 MGI:1923531
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IMP] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : Tax1 (human T-cell leukemia virus type I) binding protein 3 protein_id : NP_083840.1

name	Ctns (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752577 CCDS:CCDS25001.1 GeneID:83429 MGI:1932872
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cystinosis, nephropathic protein_id : NP_112541.1

name	Carkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095001 CCDS:CCDS25002.1 GeneID:74637 MGI:1921887
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 product : carbohydrate kinase-like protein_id : NP_083307.1

name	Trpv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47825364 CCDS:CCDS25003.1 GeneID:193034 MGI:1341787
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IMP]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence ISS]; GO:0008324 - cation transporter activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0009408 - response to heat [Evidence IDA] [Evidence IMP]; GO:0009268 - response to pH [Evidence IMP] [Evidence IDA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0050955 - thermoception [Evidence IDA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vanilloid receptor subtype 1; capsaicin receptor; cation channel; transient receptor potential cation channel V1; novel protein, ortholog of human and rat transient receptor potential cation channel, subfamily V, member 1 TRPV1 product : transient receptor potential cation channel, subfamily V, member 1 protein_id : NP_001001445.1

name	Trpv3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21492638 CCDS:CCDS25004.1 GeneID:246788 MGI:2181407
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0009266 - response to temperature stimulus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRP ion channel TRPV3; non-hair product : transient receptor potential cation channel, subfamily V, member 3 protein_id : NP_659567.1

name	Aspa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560279 CCDS:CCDS25005.1 GeneID:11484 MGI:87914
definition	GO_function : GO:0004046 - aminoacylase activity [Evidence TAS] [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0006083 - acetate metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : aminoacylase 2; aspartoacylase product : aspartoacylase (aminoacylase) 2 protein_id : NP_075602.2

name	Spata22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865897 GeneID:380709 MGI:2685728
definition	codon_start : 1 product : testes development-related NYD-SP20 protein_id : NP_001038996.1

name	Olfr20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239302 CCDS:CCDS25006.1 GeneID:258925 MGI:109315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor 21; GA_x6K02T2P1NL-3514066-3515010 product : olfactory receptor 20 protein_id : NP_667134.1

name	Olfr376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239304 CCDS:CCDS25007.1 GeneID:258924 MGI:3030210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3535075-3536028; olfactory receptor MOR135-12 product : olfactory receptor 376 protein_id : NP_667133.1

name	Olfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129049 CCDS:CCDS25008.1 GeneID:258923 MGI:102698
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3556334-3555390; olfactory receptor MOR135-13 product : olfactory receptor 1 protein_id : NP_667132.1

name	Olfr378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128893 CCDS:CCDS25009.1 GeneID:259026 MGI:3030212
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3586282-3585338; olfactory receptor MOR135-2; odorant receptor product : olfactory receptor 378 protein_id : NP_667235.1

name	Olfr380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128895 CCDS:CCDS25010.1 GeneID:259027 MGI:3030214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3613021-3612086; olfactory receptor MOR135-1 product : olfactory receptor 380 protein_id : NP_667236.1

name	Olfr381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583635 CCDS:CCDS25011.1 GeneID:259024 MGI:3030215
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3646409-3645474; olfactory receptor MOR135-4 product : olfactory receptor 381 protein_id : NP_667233.2

name	Olfr382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239298 CCDS:CCDS25012.1 GeneID:258435 MGI:3030216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3676608-3675670; MOR135-31_p; olfactory receptor MOR135-14 product : olfactory receptor 382 protein_id : NP_666654.1

name	Olfr385 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239300 CCDS:CCDS25013.1 GeneID:259025 MGI:3030219
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3760313-3759375; olfactory receptor MOR135-3 product : olfactory receptor 385 protein_id : NP_667234.1

name	Olfr386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402199 CCDS:CCDS25014.1 GeneID:193053 MGI:3030220
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2P1NL-3773152-3774090; novel olfactory receptor family MOR135 member product : olfactory receptor 386 protein_id : NP_997107.1

name	1700012C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390201 GeneID:76390 MGI:1923640
definition	codon_start : 1 product : hypothetical protein LOC76390 protein_id : XP_111107.7

name	Olfr389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735422 CCDS:CCDS25015.1 GeneID:259011 MGI:3030223
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3932085-3931147; olfactory receptor MOR135-6 product : olfactory receptor 389 protein_id : NP_667220.2

name	Olfr390 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129604 CCDS:CCDS25016.1 GeneID:258344 MGI:3030224
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3938806-3939741; olfactory receptor MOR135-26 product : olfactory receptor 390 protein_id : NP_666459.1

name	Olfr392 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128927 CCDS:CCDS25017.1 GeneID:259008 MGI:3030226
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-3966976-3966038; olfactory receptor MOR135-9 product : olfactory receptor 392 protein_id : NP_667217.1

name	Olfr393 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128921 CCDS:CCDS25018.1 GeneID:259010 MGI:3030227
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4004140-4003208; olfactory receptor MOR135-7 product : olfactory receptor 393 protein_id : NP_667219.1

name	Olfr394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128929 CCDS:CCDS25019.1 GeneID:259009 MGI:3030228
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4043306-4042374; olfactory receptor MOR135-8 product : olfactory receptor 394 protein_id : NP_667218.1

name	Olfr395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128933 CCDS:CCDS25020.1 GeneID:259007 MGI:3030229
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4062605-4061667; olfactory receptor MOR135-10 product : olfactory receptor 395 protein_id : NP_667216.1

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 3 pseudo : _no_value

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 2 pseudo : _no_value

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 1 pseudo : _no_value

name	LOC432577 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261982 GeneID:432577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 607 ESTs, 13 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_034718.1

name	LOC627119 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261983 GeneID:627119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 292 ESTs, 7 Proteins product : similar to Signal recognition particle receptor (docking protein) pseudo : _no_value transcript_id : XR_034726.1

name	Olfr75-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872150 GeneID:258186 MGI:2153204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 75, pseudogene 1 pseudo : _no_value transcript_id : NR_002859.1

clone name	MSMg01-467K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-140I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-069P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-475F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-218A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-146N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H18
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-159C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-104M10.T7 (MSMg01no104_m10.b1)	MSMg01-104M10.TJ (MSMg01no104_m10.g1)
ACC	AG319303	AG319304
length	725	822
length of high quality (start - end)	195 (70 - 264)	42 (78 - 119)
definition	CHROMAT_FILE: MSMg01no104_m10.b1 PHD_FILE: MSMg01no104_m10.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:04:09 2005	CHROMAT_FILE: MSMg01no104_m10.g1 PHD_FILE: MSMg01no104_m10.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:04:09 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NTTATCTATXXXXXXXXXXXXXXXXXXXXXXXXXXCAAAGAGGATCCGCG GAATTCCTGTGTTCCCTCTCACCGACCTTGGTCTCAGGGTAGAGTTTTAT GAATTAGACCTAGTTTGCTGGCATTTTAGTAACCATATGAACAGAGATGT GGGCTACAGTTTTTTGTTTTTGTTTTACTTGTGGGGATTTCTGGCTTGGG TATCTAACATTGGCCTAAGAAGGCTAAGTGGGAAGTGCTGCTCTCCTGCT CTCCTGCTTTTGGAAGAGTCTGTGAAGCTGTGGTGTCAACTTTCTCCTAC TGGTCTGTTACAATCCCCCACTGCTGTTATGCGGCGCCGCTGCCATGCAT GAGGTCGTCTTTTTCTTATTTCCACTTTCTCCCTTTTTTCTCCTCCCTCC TTCCTCTCTCATCCCACTCCTCCTCCCACTTTTTTCCATCCCCTCCTCTT TTATTCTCCCCCCCCTACCCTTTCTTTTCCATTTCTTTCCCTCCCCCTCC CCTTTTTCTCCCCTTTCTTCTCCCTCTCTCTTCTTCTTCCTTCTCTCTTT TTCTCCTTCCCTCCTTTCACTCTTCCACCTCTCTTCTCTCTTTTTCTTTT TTTTTCTCCCCTTTTCCTCCCTCCTTCCTCTCCTTTTTTCCACCCTCCCC TCCCTCTCCCTTTCTACTTCCTCTTCCCTTTCCTTCTTTCTCCTCCTTCT CTCCTCCCTTTCCTTCCCACTCCTC	AGAGCGAATGAAGTGGAGAGGCCTGGAGGGCGCCTGTCAGAAGAAGGTAG GTGAACTATAGATTGACCCGAGGAATTCCTGGATGGATGGATGGATGGAT GGATGGATGAATGGATGAATGCCCGAATGAATACGATAATATATTAATAT TTAACCCTAACTACTTTTTTAGCCATTATATCCGCTCTTATAAAAACCTC ACTTCCGCTTATTACCCTTACCCTTCCTACCCTTTTTCTCGTTCCCTTTA CCGATTTGCTCCGGCAGATGACGGCCCAGTCCTAGATATGCGGCGACATA CTGACCACGCAAGAGATGTACGAGAACGGGACTTGGTTGTGGAGATGAGA TGATGTAGATAGAGCATGGCTCGGTCGTACGCTGGTATCGCTACCGATAT TTTATGTAAGCCCCCGCACGCTTTATTCCGTATTACACTCTATTTTACCC AATATTACCCTAAATTAACGCGGACCGTTCGGGAATGTATAACATTGTAA ATATGCTATTATACTCCCTATTCTCTCACTATAATTACATAGGTATCCAC GGACGCAAGAGTAAAAGCGTAATTTAACAGGAGATGTAAATATAGAAACA GCATTAGGCATAAATCTGGCACGGAAAATATGTATAGATTCCCGTACTAA ATGAAGCACGTTGCGAAGACGGCAGTGAGATAATTCAAAAGCACGGCGCG CGGCACAGAGCGCGGGTATATATTAAGCGCGGAATAGAGAAACTCGGAGA CGCAGACGATAATTAACGCATCGTATCCACTCCAGCAACGGCGTACGATG ACCCGCAAATTGCGCACGACCN
quality values	Open. Hide. 0 3 6 6 6 11 10 8 8 8 23 19 30 30 30 28 28 28 20 19 15 8 8 8 16 16 24 23 15 11 9 11 7 9 9 9 9 11 12 14 14 18 18 18 20 19 22 26 31 22 18 14 19 25 39 30 37 26 19 8 8 8 8 8 11 12 13 14 16 20 26 26 26 43 37 36 37 39 39 36 36 36 33 29 28 18 18 15 24 23 23 18 20 23 29 34 42 42 42 36 36 29 36 26 26 13 14 14 28 28 42 31 35 32 32 26 24 25 22 12 12 12 12 21 27 32 57 41 37 24 24 13 12 18 18 36 38 42 42 28 36 36 36 35 35 35 35 42 36 30 26 25 43 43 50 50 50 50 37 37 37 43 43 50 50 50 50 50 50 50 50 47 47 50 57 57 57 57 57 57 43 43 35 35 17 17 19 35 36 57 57 38 38 14 14 14 38 24 23 22 22 28 28 24 28 29 38 43 43 43 43 27 27 29 32 28 15 11 11 15 24 24 32 32 32 43 33 33 41 24 20 20 20 32 38 42 43 50 43 52 47 44 46 43 43 43 43 50 50 41 43 43 44 43 42 42 42 43 47 32 32 13 13 13 13 12 13 15 24 24 26 21 16 16 16 18 20 24 28 28 24 17 10 10 10 10 15 15 16 19 32 32 47 48 48 39 39 39 35 26 30 17 17 17 24 30 39 26 15 10 10 10 12 16 37 32 24 21 12 12 12 19 18 20 28 28 14 14 13 18 12 13 15 8 8 7 6 8 8 10 10 11 12 12 13 15 15 13 14 12 18 11 12 12 11 11 9 9 9 9 15 17 19 10 10 10 11 10 10 10 10 10 10 11 11 8 10 8 10 10 11 13 10 8 8 9 9 9 8 10 10 10 10 14 11 11 10 8 8 9 8 10 10 10 11 11 9 8 10 8 8 8 8 8 8 6 6 6 8 10 10 10 10 10 9 9 10 11 15 17 15 8 8 10 8 8 8 9 15 22 21 13 11 11 11 11 11 12 10 6 6 6 6 8 7 7 12 12 10 12 8 10 10 8 8 8 8 10 10 9 9 10 10 10 10 11 11 11 8 8 8 8 10 10 10 10 10 9 9 8 8 8 10 16 14 21 16 18 18 18 18 35 22 18 18 13 10 10 9 8 8 8 9 8 8 9 8 8 6 6 6 6 11 11 13 13 11 10 8 8 8 7 6 8 8 8 8 10 8 8 8 8 8 8 7 6 6 6 8 8 8 8 8 11 11 11 9 8 10 10 9 9 9 9 9 10 10 9 9 10 10 10 10 10 13 10 9 8 8 8 8 8 10 10 10 15 15 14 14 19 19 19 21 13 12 10 10 15 12 15 15 15 13 12 12 13 17 13 13 13 13 17 17 13 10 8 8 8 8 8 8 12 12 12 13 13 15 9 9 9 10 9 10 10 10 12 15 12 15 12 10 10 10 10 10 11 10 10 9 10 11 13 13 12 12 13 11 10 10 19 13 10 10 8 8 8 8 8 8 15 8 8 7 7 8 8 8 6 7 10 8 14 10 8 8 12 12 15 24 20 15 12 12 11 11 10 10 10 9 7 8 6 6 6 6 8 10 12 11 11 9 9 10 8 8 8 10 10 9 9 8 8 9 15 10	Open. Hide. 6 6 6 6 6 8 8 10 8 9 8 11 6 6 6 6 6 6 9 11 11 18 22 23 23 10 7 7 8 7 12 23 18 18 12 10 13 10 10 10 12 11 10 10 12 9 8 8 8 19 15 22 11 19 16 29 29 30 27 15 15 11 11 6 6 7 7 7 8 10 12 12 15 15 10 10 10 15 26 36 28 29 22 22 21 29 21 28 28 29 24 22 21 26 18 17 20 32 33 33 33 37 33 34 34 36 34 34 33 33 36 37 37 33 33 33 26 19 13 10 10 11 11 11 13 13 15 15 19 8 8 8 8 9 9 8 8 8 10 10 10 10 10 8 10 8 8 8 8 8 10 10 15 11 11 11 15 15 10 8 8 8 8 8 8 8 10 13 8 10 10 8 8 12 10 14 14 14 14 13 10 8 8 10 8 8 8 8 8 8 9 9 12 11 12 12 22 16 12 8 6 6 8 8 12 8 8 10 8 8 8 10 8 8 8 8 8 11 11 10 8 8 8 10 7 7 8 8 10 10 15 15 12 12 15 15 8 8 8 8 8 8 10 10 12 8 8 10 10 10 10 8 9 9 8 8 6 6 8 8 8 9 12 10 11 11 11 11 11 8 8 8 8 8 8 8 8 8 10 8 10 10 8 9 9 11 9 9 8 8 8 8 6 6 9 9 9 9 9 10 11 11 11 12 11 12 12 12 11 11 11 11 10 10 8 8 6 6 8 8 7 6 8 8 10 9 9 9 12 12 10 10 9 9 9 9 9 9 9 9 10 10 11 8 8 8 8 10 9 9 8 8 9 10 8 8 10 9 10 10 10 9 9 10 10 10 10 9 8 8 8 8 8 8 8 8 8 8 8 6 8 8 8 8 8 8 8 10 6 6 8 8 8 8 6 6 8 10 8 8 10 10 10 10 8 8 8 8 8 10 16 18 11 10 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 11 10 10 11 13 12 9 8 8 8 8 8 8 8 8 12 16 11 8 8 8 8 7 7 7 8 8 10 10 10 9 11 13 10 9 9 8 8 8 6 8 8 8 8 6 6 8 8 8 8 12 16 11 10 9 9 9 9 11 12 12 8 12 8 8 8 8 8 6 6 8 8 9 9 10 8 8 8 8 8 7 7 6 7 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 10 7 7 6 6 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 11 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 10 10 10 9 11 11 14 13 11 15 11 12 8 10 8 8 8 8 8 8 8 10 15 15 11 8 8 8 8 8 8 12 10 10 10 10 10 13 13 11 11 11 11 8 8 8 8 8 8 10 8 8 8 8 6 6 6 6 8 8 8 6 6 8 8 12 13 10 10 8 8 8 8 10 11 8 8 6 6 6 6 8 6 11 8 8 8 8 8 8 9 10 10 10 8 8 8 6 8 8 8 8 6 8 8 8 9 9 16 13 13 14 14 14 15 13 9 8 10 8 8 8 8 8 10 8 8 6 6 6 6 8 6 6 8 8 8 8 8 8 11 10 11 17 8 8 6 6 6 6 8 6 8 8 8 8 8 8 8 8 8 8 18 18 18 15 12 8 8 6 6 8 8 8 10 10 8 8 8 8 8 8 8 8 8 10 8 8 8 8 10 12 8 8 8 8 6 6 6 8 8 8 8 8 10 10 11 12 11 11 9 8 8 8 8 8 8 8 6 8 6 6 6 8 8 6 6 8 8 8 8 8 8 8 8 8 8 9 9 9 9 8 8 8 8 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no104_m10.b1 MSMg01no104_m10.b1 CHROMAT_FILE:
MSMg01no104_m10.b1 PHD_FILE: MSMg01no104_m10.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:04:09 2005
         (195 letters)



>mm_chr11_72752661_72753255
          Length = 595

 Score =  369 bits (191), Expect = e-107
 Identities = 194/195 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   caccgaccttggtctcagggtagagttttatgaattagacctagtttgctggcattttag 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 395 caccgaccttggtctcagggtagagttttatgaattagacctagtttgctgggattttag 336

                                                                       
Query: 61  taaccatatgaacagagatgtgggctacagttttttgtttttgttttacttgtggggatt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 taaccatatgaacagagatgtgggctacagttttttgtttttgttttacttgtggggatt 276

                                                                       
Query: 121 tctggcttgggtatctaacattggcctaagaaggctaagtgggaagtgctgctctcctgc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 tctggcttgggtatctaacattggcctaagaaggctaagtgggaagtgctgctctcctgc 216

                          
Query: 181 tctcctgcttttgga 195
           |||||||||||||||
Sbjct: 215 tctcctgcttttgga 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 195
Length of database: 595
Length adjustment: 8
Effective length of query: 187
Effective length of database: 587
Effective search space:   109769
Effective search space used:   109769
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information