MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-197A12
Chromosome	11 (Build37)
Map Location	78,675,846 - 78,676,162
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Myo18a, Pipox, Sez6, LOC100043518, Phf12, Dhrs13, Flot2, Eral1, BC017647, LOC100043525, Traf4, Nek8, Tlcd1, Rpl23a, Rab34, 4933404M19Rik, Supt6h, Sdf2, 2610507B11Rik, BC030499, LOC100043544, LOC100042648, Spag5, Aldoc, Pigs, Unc119, Foxn1, OTTMUSG00000000132, Slc13a2, Slc46a1, A830091I15Rik, Vtn, Og9x, AI316787, Poldip2, Tnfaip1, Ift20, Tmem97, Nlk, LOC100043570, LOC100042674, 1810009O10Rik, 1810012P15Rik
Downstream gene	Nos2, Lgals9, Ksr1, LOC100042697, Wsb1, Nf1, Omg, Evi2b, Evi2a, Rab11fip4, OTTMUSG00000000185
Link	Open Mouse BAC browser

Click to get alignment info.

name	Myo18a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360013 MGI:2667185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pipox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19193 MGI:1197006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sez6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20370 MGI:104745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs

name	Phf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268448 MGI:1924057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhrs13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70451 MGI:1917701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flot2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14252 MGI:103309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eral1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57837 MGI:1889295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC017647 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216971 MGI:2384939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins

name	Traf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22032 MGI:1202880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140859 MGI:1890646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68385 MGI:1915572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl23a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268449 MGI:3040672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19376 MGI:104606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933404M19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216974 MGI:1918274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt6h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20926 MGI:107726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20316 MGI:108019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610507B11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72503 MGI:1919753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC030499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216976 MGI:2652869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC100042648 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Spag5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54141 MGI:1927470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldoc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11676 MGI:101863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276846 MGI:2687325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22248 MGI:1328357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15218 MGI:102949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:790911 MGI:3649278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc13a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20500 MGI:1276558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc46a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52466 MGI:1098733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830091I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237868 MGI:2144643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vtn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22370 MGI:98940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Og9x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18292 MGI:108012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI316787 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195040 MGI:2144113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Poldip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67811 MGI:1915061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfaip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21927 MGI:104961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ift20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55978 MGI:1915585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69071 MGI:1916321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18099 MGI:1201387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 40 ESTs, 4 Proteins pseudo : _no_value

name	LOC100042674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1810009O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69109 MGI:1916359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810012P15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66274 MGI:1913524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nos2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18126 MGI:97361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16859 MGI:109496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ksr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16706 MGI:105051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Wsb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78889 MGI:1926139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18015 MGI:97306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Omg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18377 MGI:106586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evi2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216984 MGI:1890682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Evi2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14017 MGI:95458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rab11fip4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268451 MGI:2442920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:790912 MGI:3650027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo18a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130118 GeneID:360013 MGI:2667185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin XVIIIa transcript_id : NM_011586.2

name	Pipox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679506 GeneID:19193 MGI:1197006
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pipecolic acid oxidase transcript_id : NM_008952.1

name	Sez6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130194 GeneID:20370 MGI:104745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seizure related gene 6 transcript_id : NM_021286.3

name	LOC100043518 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261997 GeneID:100043518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : hypothetical protein LOC100043518 transcript_id : XM_001480841.1

name	Phf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842821 GeneID:268448 MGI:1924057
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 12 transcript_id : NM_174852.2

name	Dhrs13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647266 GeneID:70451 MGI:1917701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 13 transcript_id : NM_183286.2

name	Flot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94536789 GeneID:14252 MGI:103309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flotillin 2 transcript_id : NM_008028.2

name	Flot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94536790 GeneID:14252 MGI:103309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flotillin 2 transcript_id : NM_001040403.1

name	Eral1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612490 GeneID:57837 MGI:1889295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Era (G-protein)-like 1 (E. coli) transcript_id : NM_022313.1

name	BC017647 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703857 GeneID:216971 MGI:2384939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC017647 transcript_id : NM_145430.1

name	LOC100043525 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261999 GeneID:100043525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins product : similar to Lsm6 protein transcript_id : XM_001480855.1

name	Traf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803144 GeneID:22032 MGI:1202880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor associated factor 4 transcript_id : NM_009423.3

name	Nek8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32307137 GeneID:140859 MGI:1890646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 8 transcript_id : NM_080849.2

name	Tlcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539616 GeneID:68385 MGI:1915572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TLC domain containing 1 transcript_id : NM_026708.1

name	Rpl23a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430507 GeneID:268449 MGI:3040672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L23a transcript_id : NM_207523.1

name	Rab34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560773 GeneID:19376 MGI:104606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB34, member of RAS oncogene family transcript_id : NM_033475.2

name	4933404M19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139947886 GeneID:216974 MGI:1918274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933404M19 gene transcript_id : NM_001045516.2

name	Supt6h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678182 GeneID:20926 MGI:107726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 6 homolog (S. cerevisiae) transcript_id : NM_009297.1

name	Sdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254616 GeneID:20316 MGI:108019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal cell derived factor 2 transcript_id : NM_009143.2

name	2610507B11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50284698 GeneID:72503 MGI:1919753
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610507B11 gene transcript_id : NM_001002004.1

name	BC030499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865902 GeneID:216976 MGI:2652869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC030499 transcript_id : NM_001045522.1

name	LOC100043544 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262003 GeneID:100043544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100043544, transcript variant 2 transcript_id : XM_001480884.1

name	LOC100043544 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262001 GeneID:100043544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043544, transcript variant 1 transcript_id : XM_001480879.1

name	LOC100042648 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261950 GeneID:100042648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042648 transcript_id : XM_001478576.1

name	Spag5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859673 GeneID:54141 MGI:1927470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 5 transcript_id : NM_017407.1

name	Aldoc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60687505 GeneID:11676 MGI:101863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldolase 3, C isoform transcript_id : NM_009657.2

name	Pigs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41351528 GeneID:276846 MGI:2687325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class S transcript_id : NM_201406.1

name	Unc119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981438 GeneID:22248 MGI:1328357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-119 homolog (C. elegans) transcript_id : NM_011676.2

name	Foxn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680210 GeneID:15218 MGI:102949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box N1 transcript_id : NM_008238.1

name	Slc13a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352607 GeneID:20500 MGI:1276558
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 transcript_id : NM_022411.2

name	Slc46a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26892297 GeneID:52466 MGI:1098733
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 46, member 1 transcript_id : NM_026740.1

name	A830091I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254246 GeneID:237868 MGI:2144643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830091I15 gene transcript_id : NM_172795.2

name	Vtn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755986 GeneID:22370 MGI:98940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitronectin transcript_id : NM_011707.1

name	Og9x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778829 GeneID:18292 MGI:108012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OG9 homeobox gene transcript_id : NM_008759.2

name	AI316787 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384366 GeneID:195040 MGI:2144113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI316787 transcript_id : NM_199199.2

name	Poldip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129810 GeneID:67811 MGI:1915061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA-directed), delta interacting protein 2 transcript_id : NM_026389.3

name	Tnfaip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374284 GeneID:21927 MGI:104961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor, alpha-induced protein 1 (endothelial) transcript_id : NM_009395.3

name	Ift20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375735 GeneID:55978 MGI:1915585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 20 homolog (Chlamydomonas) transcript_id : NM_018854.4

name	Tmem97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130934 GeneID:69071 MGI:1916321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 97 transcript_id : NM_133706.2

name	Nlk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254627 GeneID:18099 MGI:1201387
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nemo like kinase transcript_id : NM_008702.2

name	1810009O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574067 GeneID:69109 MGI:1916359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009O10 gene transcript_id : NM_197989.1

name	1810012P15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116008180 GeneID:66274 MGI:1913524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810012P15 gene transcript_id : NM_001076681.1

name	Nos2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227226 GeneID:18126 MGI:97361
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitric oxide synthase 2, inducible, macrophage transcript_id : NM_010927.2

name	Lgals9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754535 GeneID:16859 MGI:109496
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 9 transcript_id : NM_010708.1

name	Ksr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344125 GeneID:16706 MGI:105051
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinase suppressor of ras 1 transcript_id : NM_013571.2

name	Wsb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816973 GeneID:78889 MGI:1926139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat and SOCS box-containing 1 transcript_id : NM_019653.3

name	Wsb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803466 GeneID:78889 MGI:1926139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat and SOCS box-containing 1 transcript_id : NM_001042565.2

name	Nf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130208 GeneID:18015 MGI:97306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurofibromatosis 1 transcript_id : NM_010897.2

name	Omg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506940 GeneID:18377 MGI:106586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligodendrocyte myelin glycoprotein transcript_id : NM_019409.1

name	Evi2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117320525 GeneID:216984 MGI:1890682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecotropic viral integration site 2b transcript_id : NM_146023.3

name	Evi2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117320521 GeneID:216984 MGI:1890682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecotropic viral integration site 2b transcript_id : NM_001077496.1

name	Evi2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253936 GeneID:14017 MGI:95458
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecotropic viral integration site 2a transcript_id : NM_010161.3

name	Evi2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253937 GeneID:14017 MGI:95458
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecotropic viral integration site 2a transcript_id : NM_001033711.1

name	Rab11fip4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363857 GeneID:268451 MGI:2442920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 4 (class II) transcript_id : NM_175543.3

name	Myo18a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094119 CCDS:CCDS25085.1 GeneID:360013 MGI:2667185
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IDA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : myosin containing PDZ domain; myosin XVIIIb product : myosin XVIIIa protein_id : NP_035716.1

name	Pipox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679507 CCDS:CCDS25086.1 GeneID:19193 MGI:1197006
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0050031 - L-pipecolate oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008115 - sarcosine oxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA]; GO:0046653 - tetrahydrofolate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation function : catalyses CH(3)NHCH(2)COOH + H(2)O + O(2) = NH(2)CH(2)COOH + CH(2)O + H(2)O(2) note : peroxisomal sarcosine oxidase product : pipecolic acid oxidase protein_id : NP_032978.1

name	Sez6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981500 CCDS:CCDS25087.1 GeneID:20370 MGI:104745
definition	codon_start : 1 product : seizure related gene 6 protein_id : NP_067261.2

name	LOC100043518 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261998 GeneID:100043518
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480891.1

name	Phf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424679 GeneID:268448 MGI:1924057
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0017053 - transcriptional repressor complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD zinc finger transcription factor protein_id : NP_777277.1

name	Dhrs13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647267 GeneID:70451 MGI:1917701
definition	codon_start : 1 product : dehydrogenase/reductase (SDR family) member 13 protein_id : NP_899109.2

name	Flot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94536791 GeneID:14252 MGI:103309
definition	GO_component : GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : flotillin 2 isoform 1 protein_id : NP_001035493.1

name	Flot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679811 CCDS:CCDS25088.1 GeneID:14252 MGI:103309
definition	GO_component : GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : flotillin 2 isoform 2 protein_id : NP_032054.1

name	Eral1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612491 GeneID:57837 MGI:1889295
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ERA-like GTPase; ERA-like protein 1 product : Era (G-protein)-like 1 protein_id : NP_071708.1

name	BC017647 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703858 CCDS:CCDS25089.1 GeneID:216971 MGI:2384939
definition	codon_start : 1 product : hypothetical protein LOC216971 protein_id : NP_663405.1

name	LOC100043525 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262000 GeneID:100043525
definition	codon_start : 1 product : similar to Lsm6 protein protein_id : XP_001480905.1

name	Traf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543889 CCDS:CCDS25090.1 GeneID:22032 MGI:1202880
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0030323 - respiratory tube development [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Tnf receptor associated factor 4 protein_id : NP_033449.2

name	Nek8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19263332 CCDS:CCDS25091.1 GeneID:140859 MGI:1890646
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : juvenile cystic kidney; NIMA-related expressed kinase 8 product : NIMA (never in mitosis gene a)-related expressed kinase 8 protein_id : NP_543125.1

name	Tlcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539617 CCDS:CCDS25092.1 GeneID:68385 MGI:1915572
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : TLC domain containing 1 protein_id : NP_080984.1

name	Rpl23a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430508 CCDS:CCDS25093.1 GeneID:268449 MGI:3040672
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : 60S ribosomal protein L23a; snoRNA MBII-287; snoRNA MBII-292 product : ribosomal protein L23a protein_id : NP_997406.1

name	Rab34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560774 CCDS:CCDS25094.1 GeneID:19376 MGI:104606
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IDA]; GO:0019001 - guanyl nucleotide binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB34, member of RAS oncogene family protein_id : NP_258436.2

name	4933404M19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139947887 GeneID:216974 MGI:1918274
definition	codon_start : 1 product : hypothetical protein LOC216974 protein_id : NP_001038981.2

name	Supt6h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678183 CCDS:CCDS25095.1 GeneID:20926 MGI:107726
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : suppressor of Ty 6 homolog protein_id : NP_033323.1

name	Sdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254617 CCDS:CCDS25096.1 GeneID:20316 MGI:108019
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : stromal cell derived factor 2 protein_id : NP_033169.2

name	2610507B11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50284699 CCDS:CCDS25097.1 GeneID:72503 MGI:1919753
definition	GO_function : GO:0008924 - malate dehydrogenase (acceptor) activity [Evidence IEA] GO_process : GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72503 protein_id : NP_001002004.1

name	BC030499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865903 GeneID:216976 MGI:2652869
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC216976 protein_id : NP_001038987.1

name	LOC100043544 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262002 GeneID:100043544
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480929.1

name	LOC100043544 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262004 GeneID:100043544
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480934.1

name	LOC100042648 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261951 GeneID:100042648
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478626.1

name	Spag5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859674 CCDS:CCDS25098.1 GeneID:54141 MGI:1927470
definition	GO_component : GO:0000776 - kinetochore [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005819 - spindle [Evidence ISS]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence ISS]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 note : astrin; microtubule-associated protein product : sperm associated antigen 5 protein_id : NP_059103.1

name	Aldoc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60687506 CCDS:CCDS25099.1 GeneID:11676 MGI:101863
definition	EC_number : 4.1.2.13 GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004332 - fructose-bisphosphate aldolase activity [Evidence NAS] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : aldolase C; scrapie-responsive protein 2; fructose-bisphosphate aldolase C; zebrin II; scrapie responsive gene 2 product : aldolase 3, C isoform protein_id : NP_033787.2

name	Pigs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41351529 CCDS:CCDS25100.1 GeneID:276846 MGI:2687325
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0042765 - GPI-anchor transamidase complex [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003923 - GPI-anchor transamidase activity [Evidence IMP] [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0016255 - attachment of GPI anchor to protein [Evidence ISS]; GO:0006506 - GPI anchor biosynthesis [Evidence IEA] codon_start : 1 note : phosphatidylinositol glycan, class S product : phosphatidylinositol glycan, class S homolog protein_id : NP_958808.1

name	Unc119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755939 CCDS:CCDS25101.1 GeneID:22248 MGI:1328357
definition	GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : UNC-119 homolog protein_id : NP_035806.1

name	Foxn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680211 CCDS:CCDS25102.1 GeneID:15218 MGI:102949
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050673 - epithelial cell proliferation [Evidence IDA]; GO:0030216 - keratinocyte differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : HNF-3/forkhead homolog 11 product : forkhead box N1 protein_id : NP_032264.1

name	Slc13a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967935 CCDS:CCDS25103.1 GeneID:20500 MGI:1276558
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium/dicarboxylate co-transporter product : solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 protein_id : NP_071856.1

name	Slc46a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26892298 CCDS:CCDS25104.1 GeneID:52466 MGI:1098733
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : heme carrier protein 1 protein_id : NP_081016.1

name	A830091I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254247 CCDS:CCDS25105.1 GeneID:237868 MGI:2144643
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 product : sterile alpha and TIR motif containing 1 protein_id : NP_766383.2

name	Vtn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755987 CCDS:CCDS25106.1 GeneID:22370 MGI:98940
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0008201 - heparin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IDA] codon_start : 1 product : vitronectin protein_id : NP_035837.1

name	Og9x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10198600 CCDS:CCDS25107.1 GeneID:18292 MGI:108012
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : OG9 homeobox protein_id : NP_032785.1

name	AI316787 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384367 CCDS:CCDS25108.1 GeneID:195040 MGI:2144113
definition	codon_start : 1 note : RE40914p product : hypothetical protein LOC195040 protein_id : NP_954669.2

name	Poldip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14780884 CCDS:CCDS25109.1 GeneID:67811 MGI:1915061
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030674 - protein binding, bridging [Evidence ISS] codon_start : 1 note : mitogenin 1 product : polymerase delta interacting protein 38 protein_id : NP_080665.1

name	Tnfaip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543878 CCDS:CCDS25110.1 GeneID:21927 MGI:104961
definition	GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS]; GO:0006260 - DNA replication [Evidence ISS]; GO:0009790 - embryonic development [Evidence IEP]; GO:0006955 - immune response [Evidence ISS]; GO:0051291 - protein heterooligomerization [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence ISS] codon_start : 1 exception : mismatches in translation note : tumor necrosis factor induced protein 1 product : tumor necrosis factor, alpha-induced protein 1 protein_id : NP_033421.2

name	Ift20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506865 CCDS:CCDS25111.1 GeneID:55978 MGI:1915585
definition	GO_component : GO:0005814 - centriole [Evidence IDA] codon_start : 1 note : uterine protein product : intraflagellar transport protein IFT20 protein_id : NP_061342.1

name	Tmem97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526880 CCDS:CCDS25112.1 GeneID:69071 MGI:1916321
definition	codon_start : 1 product : hypothetical protein LOC69071 protein_id : NP_598467.1

name	Nlk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254628 CCDS:CCDS25113.1 GeneID:18099 MGI:1201387
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence IDA]; GO:0004707 - MAP kinase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA] [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nemo like kinase protein_id : NP_032728.2

name	1810009O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574068 CCDS:CCDS25114.1 GeneID:69109 MGI:1916359
definition	GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : cyclin M product : hypothetical protein LOC69109 protein_id : NP_932106.1

name	1810012P15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116008181 GeneID:66274 MGI:1913524
definition	codon_start : 1 product : hypothetical protein LOC66274 protein_id : NP_001070149.1

name	Nos2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754872 CCDS:CCDS25115.1 GeneID:18126 MGI:97361
definition	GO_component : GO:0030863 - cortical cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence TAS]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence TAS] [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0020037 - heme binding [Evidence NAS] [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0050661 - NADP binding [Evidence IEA]; GO:0004517 - nitric-oxide synthase activity [Evidence IDA] [Evidence TAS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0006809 - nitric oxide biosynthesis [Evidence IDA]; GO:0001542 - ovulation (sensu Mammalia) [Evidence IMP]; GO:0001666 - response to hypoxia [Evidence IDA]; GO:0006801 - superoxide metabolism [Evidence IMP] codon_start : 1 note : inducible nitric oxide synthase product : nitric oxide synthase 2, inducible, macrophage protein_id : NP_035057.1

name	Lgals9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754536 CCDS:CCDS25116.1 GeneID:16859 MGI:109496
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lectin, galactose binding, soluble 9 protein_id : NP_034838.1

name	Ksr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305215 CCDS:CCDS25117.1 GeneID:16706 MGI:105051
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : kinase suppressor of ras protein_id : NP_038599.1

name	Wsb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816974 CCDS:CCDS25118.1 GeneID:78889 MGI:1926139
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; WSB-1; WD-40-repeat-containing protein with a SOCS box 1 product : WD repeat and SOCS box-containing 1 isoform 1 protein_id : NP_062627.3

name	Wsb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110349997 GeneID:78889 MGI:1926139
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; WSB-1; WD-40-repeat-containing protein with a SOCS box 1 product : WD repeat and SOCS box-containing 1 isoform 2 protein_id : NP_001036030.1

name	Nf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34878892 CCDS:CCDS25119.1 GeneID:18015 MGI:97306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0045685 - regulation of glial cell differentiation [Evidence IMP]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : neurofibromin protein_id : NP_035027.1

name	Omg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506941 CCDS:CCDS25120.1 GeneID:18377 MGI:106586
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : oligodendrocyte myelin glycoprotein protein_id : NP_062282.1

name	Evi2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117320522 GeneID:216984 MGI:1890682
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : ecotropic viral integration site 2b protein_id : NP_001070964.1

name	Evi2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122501 CCDS:CCDS25121.1 GeneID:216984 MGI:1890682
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : ecotropic viral integration site 2b protein_id : NP_666135.1

name	Evi2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253938 CCDS:CCDS25122.1 GeneID:14017 MGI:95458
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004888 - transmembrane receptor activity [Evidence ISS] codon_start : 1 product : ecotropic viral integration site 2A protein_id : NP_001028883.1

name	Evi2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753786 GeneID:14017 MGI:95458
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004888 - transmembrane receptor activity [Evidence ISS] codon_start : 1 product : ecotropic viral integration site 2A protein_id : NP_034291.1

name	Rab11fip4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202067 CCDS:CCDS25123.1 GeneID:268451 MGI:2442920
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : Rab11-FIP4-like protein_id : NP_780752.1

name	LOC100042674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042674
definition	number : 2 pseudo : _no_value

name	LOC100042674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042674
definition	number : 1 pseudo : _no_value

name	LOC100042697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042697
definition	number : 1 pseudo : _no_value

name	LOC100042697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042697
definition	number : 2 pseudo : _no_value

name	OTTMUSG00000000132 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:142352643 GeneID:790911 MGI:3649278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000132 transcript_id : NR_003282.2

name	LOC100043570 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262005 GeneID:100043570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 40 ESTs, 4 Proteins product : similar to protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) pseudo : _no_value transcript_id : XR_034902.1

name	OTTMUSG00000000185 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:124286850 GeneID:790912 MGI:3650027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000185 transcript_id : NR_003283.1

clone name	MSMg01-236E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478K09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-197A12.T7 (MSMg01no197_a12.b1)	MSMg01-197A12.TJ (MSMg01no197_a12.g1)
ACC	AG384920	AG384921
length	726	888
length of high quality (start - end)	321 (46 - 366)	---
definition	CHROMAT_FILE: MSMg01no197_a12.b1 PHD_FILE: MSMg01no197_a12.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:16:46 2005	CHROMAT_FILE: MSMg01no197_a12.g1 PHD_FILE: MSMg01no197_a12.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:16:46 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCAAACATCACACAATTGCAGAAACTCTCCGCAGCTGGCAAAATCA CTCCTCTTCTAAAGCACGAGGAGGCAAATCGTAGTCACCTGCTGTGAAGC AGCTGCTTATCCCCAAACCAAAATGTATTCTTATAATATATCTAATGTTT TTAGACACATAAGACAAATAAATATATAATTTATTTTAAGAAGCATTAAA AAAAATCCATGTCCTTAGCAAAGGCTCATGCATCTTCTTTTAGTCCCCAG AGATAGAGAAGGAACCTGGTCCCTCTCTGTGGGCTGTGAAAGAGGCTGAG GCAAGAGGGAGTCCATCTTACTGACACCACACCACATGTTGCCCAGGGAA AGGCATTTGTCTAGCATGTGCCACGCCTTAACCCTTGGTACCACAGAAAA AGATGGTAATTGGACAGAAAAAGATGGTAATTGGACACTCTTTTTTAGAA AGTCAAACCAGGGCCTGAAGAGGTGGCTCAGCTATTAAGAGCACTGACTG CTCTTCCAGCCAACCTGAGTTCAATTCCCAGCAAACATAAAGGTGGTTCA CAACCATCTGTAATGGAACCCAATGCCCTCTTCTGGTGCTGTCTAAAGAC AGCTATAGTGGAAAACAATACCAAACAACCACTAATACTTACAAACAAAC CAACAAAAAACCCTATTATCAGAAAA	GGGGGGAGGGNTCNTTGACGGGGCAACTTCTCGCGAGGGGAAGGGAAAAG AAGAAAGAGAACCGAGGGGGGCTTTGTGTTTCAAAAAAGGGGGGGGGGNN GGGGAGTTCACAAAGAGGGGGGGGNGAGAGGGAAGAAAGAAAAGAAAGGG GAAAAAGGGTTTTGCCCGGAAAAAGAGGGGGGGGGGAAGAGGAAAAAGAG GGGGGGGGGGGGGGGGGGGGAGGAAGGGGAGAGGGGGGAGGGGGGGGGAG AGAGGGGGGGGGGGGAGAGGAAGAGAGAGGAAGAGGAAGGGGGGGGGGGG GGAAAAGAAAGAAAAAAAGGGGAAGAGGAGAGGGGGGGGAGGAGGAAGAG GGGGAGGGGAGGGGAGGAAGGGGAAATTAGAGGGGGAGGGGGGGGGGAGG GAAGGGGGAGGGAGAGGGGTTGGGTTTGGAAAAAAGGGAACACAGAGGGA GGAAAGGAGGAAAGGGGGGAGGGGGGGGGGGGGTCCACCCCAGGGAGGTG AGGGGAAAAAGGGGGTGGGGGGGGGGGGGGGGAGGGGGGAGAGAGGGAGA GGGGGAGGAGAAAAGGGAGGGGGAGAGGGGGGAGAGAGGAAAAAGGGGGG GAGGAGAGAGGGGGAGAGGGAAGGGAGAGAGGGGGGGGAGGAGAAGAGAG GGGGGAAGGGGGGGGGGGAGGGGGAAGGAGGAGAAGGGGAGGGGGGCGGG GGAGAGAGGGGGAGGGGGAGAAGAAGGGGGAGAAGGAAGGAAAAAGGAAA GGAAGAGGAAGGGGAGGGGAAAGAGGAGGGGAAGGAGAGAGGGGGGCGGA GGTAAGGAAGGGGGAAAAGGGGGATGAAAAGGTAGACGGGGAAAGGGAGG AAGGGGAGAAGGGAAGGAGAGGGGGAAGAGGAGGAGAG
quality values	Open. Hide. 8 10 8 8 8 8 11 17 27 27 33 32 32 28 28 37 37 37 37 37 37 37 37 37 43 30 28 30 32 32 36 47 47 47 43 43 39 39 43 43 24 29 15 24 24 42 34 54 54 40 40 40 40 50 50 50 50 50 50 50 50 50 50 50 50 68 68 57 57 48 48 42 44 44 68 68 68 68 68 68 68 68 68 68 68 68 57 57 40 43 39 48 48 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 54 57 57 57 57 57 68 68 68 68 68 68 38 50 43 57 52 43 43 52 57 44 57 57 68 68 59 59 35 43 43 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 52 52 45 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 43 43 39 62 62 62 62 62 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 52 52 43 52 59 59 59 59 59 68 68 68 68 68 68 68 68 59 59 52 52 47 59 59 59 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 57 57 57 68 68 68 57 57 59 59 59 59 59 68 68 44 57 42 42 35 59 59 68 57 57 57 57 57 46 46 36 32 30 32 32 35 47 44 57 68 68 68 68 68 68 59 59 43 43 47 59 59 59 59 59 59 59 59 57 57 57 34 34 16 15 15 15 12 13 12 21 12 14 15 25 23 10 10 10 10 8 8 8 8 8 8 10 10 17 24 34 41 59 59 59 59 59 47 50 44 44 39 42 48 57 47 43 43 47 48 48 59 59 59 59 37 37 31 28 19 10 8 8 6 6 6 8 8 20 30 36 36 28 28 28 33 28 28 13 22 28 37 47 47 47 50 50 50 50 50 48 57 39 42 42 39 39 39 43 48 43 43 43 40 40 43 48 48 54 54 57 57 54 54 54 47 48 42 48 57 57 48 48 48 48 48 48 48 54 57 59 59 59 59 59 50 43 43 47 39 39 43 47 48 48 48 48 59 59 48 48 48 46 46 39 37 30 43 39 31 31 39 44 41 41 32 25 25 30 32 33 39 46 46 43 43 43 41 37 36 43 43 47 47 47 46 41 48 48 48 48 48 48 59 48 48 37 37 37 37 37 32 35 43 35 31 31 39 39 39 41 41 41 37 33 33 36 36 38 44 43 36 36 36 43 39 48 48 48 41 41 43 41 37 32 26 16 14 14 14 23 23 30 28 24 22 29 32 37 37 39 35 35 37 37 32 26 19 15 19 15 17 19 30 34 30 24 20 20 30 30 37 37 32 24 19 20 17 30 34 34 28 28 28 37 32 29 29 32 33 22 22 22 22 28 33 37 39 36 33 33 27 24 25 18 18 13 9 8 8 8 8 8 8 9 9 11 18 14 9 10 9 8 8 10 8 8 9 10 10 10 10 10 11 11 11 13 10 12 12 19 14 16 15 16 12 12 12 12 12 12 12 12 10 10 10 16 13 18 25 21 19 11 18 14 19 15 15	Open. Hide. 12 17 10 10 10 8 8 8 8 3 0 3 3 0 3 9 10 9 9 9 15 10 8 8 8 8 10 10 7 7 6 8 6 6 6 6 6 10 8 8 8 8 8 18 12 12 25 20 12 10 11 10 10 10 14 13 10 10 12 15 8 8 6 6 8 8 9 15 19 19 9 18 10 13 6 6 6 6 8 8 8 8 8 8 8 9 9 12 9 8 7 11 7 9 9 7 6 3 0 0 3 9 11 8 8 8 8 6 6 6 6 6 7 9 10 10 10 10 10 9 8 8 17 3 0 3 15 8 9 11 13 9 9 9 9 8 8 8 10 12 21 19 8 8 8 8 6 7 10 11 9 9 10 10 10 12 9 9 9 10 8 6 6 8 6 7 8 10 10 10 13 12 12 12 10 10 9 23 18 24 22 15 10 8 12 10 10 8 8 6 6 8 6 8 8 8 10 16 19 9 9 9 9 10 10 10 19 12 13 19 18 13 11 10 10 9 11 15 15 8 8 8 8 8 6 6 8 10 9 8 8 6 6 8 6 8 10 9 9 9 12 11 11 11 11 13 12 12 11 9 8 6 6 6 8 10 10 10 11 10 9 9 9 15 12 8 6 6 8 13 22 10 10 10 10 8 8 8 10 10 8 10 10 10 10 10 8 8 8 8 10 15 12 12 14 26 22 17 10 10 9 9 9 11 9 11 8 8 8 8 8 10 19 16 19 21 10 8 8 8 8 8 8 8 10 10 8 8 10 10 9 9 9 9 12 16 21 19 8 6 6 7 7 8 6 8 8 8 8 16 13 13 7 7 8 10 15 15 8 8 8 12 8 9 9 10 10 10 11 11 10 10 8 10 9 9 10 11 10 10 10 11 11 10 11 8 6 6 10 11 12 11 9 10 13 16 8 8 8 10 8 8 6 6 10 19 15 6 6 8 8 10 8 10 7 6 8 8 8 8 9 8 8 6 6 6 6 11 11 9 11 11 16 10 10 8 8 8 8 10 10 10 9 9 9 10 13 13 8 7 8 6 6 8 8 6 6 6 11 12 12 8 9 8 8 8 8 11 10 9 9 13 9 9 9 9 15 25 15 9 7 7 6 8 11 7 8 8 8 8 13 8 8 8 8 6 6 3 3 3 8 8 12 11 10 11 12 10 10 10 13 11 12 15 9 9 9 17 19 32 37 36 39 31 23 27 28 18 15 12 12 10 14 19 17 14 14 10 8 6 6 8 7 7 15 13 14 19 19 8 8 15 21 10 10 8 8 8 10 8 8 10 15 10 8 8 8 8 8 11 10 9 10 8 10 10 10 15 13 11 9 9 10 9 9 10 10 8 8 9 10 10 11 11 10 8 9 10 10 10 9 9 10 9 9 8 12 8 8 8 8 15 15 8 8 8 8 8 8 8 10 10 13 19 12 8 8 7 6 8 8 11 11 11 22 8 10 8 8 11 8 8 8 8 10 8 6 7 6 8 6 10 10 15 12 11 12 9 9 13 16 17 16 11 11 12 15 7 6 8 8 8 8 6 8 6 6 8 8 11 8 8 6 6 8 8 16 15 28 37 23 23 11 8 8 6 6 8 8 8 8 6 6 6 6 13 6 6 8 10 10 13 13 15 13 15 11 11 10 10 10 10 11 11 13 13 22 19 15 6 7 8 11 8 12 11 11 13 15 17 14 15 19 15 15 12 10 8 8 8 8 13 8 15 10 8 8 6 6 8 8 11 11 8 8 9 10 10 9 9 8 8 9 8 12 10 10 14 14 21 12 11 12 19 13 13 11 8 8 8 19 15 22 12 12 10 8 8 13 15 15 11 9 9 9 10 10 10 10 11 12 12 15 15 11 8 8 8 8 10 17 18 21 8 8 8 8 8 8 11 10 6 6 8 6 8 8 8 10 13 10 10 11 11 8 9 10 8 9 10 11 8 8 7 10 6 6 8 8 6 9 15 6 9 9 9 9 9 9 8 8 8 9 13 13 12 12 7 8 8 6 6 8 8 10 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no197_a12.b1 MSMg01no197_a12.b1 CHROMAT_FILE:
MSMg01no197_a12.b1 PHD_FILE: MSMg01no197_a12.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:16:46 2005
         (321 letters)



>mm_chr11_78675452_78676172
          Length = 721

 Score =  613 bits (317), Expect = e-180
 Identities = 317/317 (100%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattccaaacatcacacaattgcagaaactctccgcagctggcaaaatcactcctcttc 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 711 gaattccaaacatcacacaattgcagaaactctccgcagctggcaaaatcactcctcttc 652

                                                                       
Query: 65  taaagcacgaggaggcaaatcgtagtcacctgctgtgaagcagctgcttatccccaaacc 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651 taaagcacgaggaggcaaatcgtagtcacctgctgtgaagcagctgcttatccccaaacc 592

                                                                       
Query: 125 aaaatgtattcttataatatatctaatgtttttagacacataagacaaataaatatataa 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 aaaatgtattcttataatatatctaatgtttttagacacataagacaaataaatatataa 532

                                                                       
Query: 185 tttattttaagaagcattaaaaaaaatccatgtccttagcaaaggctcatgcatcttctt 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 531 tttattttaagaagcattaaaaaaaatccatgtccttagcaaaggctcatgcatcttctt 472

                                                                       
Query: 245 ttagtccccagagatagagaaggaacctggtccctctctgtgggctgtgaaagaggctga 304
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 ttagtccccagagatagagaaggaacctggtccctctctgtgggctgtgaaagaggctga 412

                            
Query: 305 ggcaagagggagtccat 321
           |||||||||||||||||
Sbjct: 411 ggcaagagggagtccat 395


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 18
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 321
Length of database: 721
Length adjustment: 9
Effective length of query: 312
Effective length of database: 712
Effective search space:   222144
Effective search space used:   222144
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information