MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-186M15
Chromosome	12 (Build37)
Map Location	85,696,808 - 85,834,134
singlet/doublet	doublet
Overlap gene	9830169C18Rik, Coq6, Entpd5, 2900006K08Rik, Rnf113a2, Aldh6a1, Lin52
Upstream gene	Dpf3, Wdr21, Zfyve1, LOC626950, Rbm25, Psen1, Papln, Numb, LOC100042325, 2410016O06Rik, Acot2, Acot1, Acot4, Acot3, Acot5, LOC666963, Acot6, Dnalc1, Pnma1, C130039O16Rik, EG432676, Zadh1, Zfp410
Downstream gene	Chx10, Abcd4, 7420416P09Rik, Tmem90a, Npc2, Isca2, Ltbp2, 1110018G07Rik, Fcf1, Ylpm1, Prox2, Dlst, Rps6kl1, LOC100042021, Pgf, Eif2b2, Mlh3, Acyp1, 2810002I04Rik, Nek9, Tmed10, LOC100042549, LOC667119, Fos
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dpf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70127 MGI:1917377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73828 MGI:1921078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfyve1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217695 MGI:3026685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 563 ESTs, 42 Proteins pseudo : _no_value

name	Rbm25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67039 MGI:1914289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Psen1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19164 MGI:1202717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Papln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170721 MGI:2386139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Numb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18222 MGI:107423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	2410016O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71952 MGI:1919202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171210 MGI:2159605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26897 MGI:1349396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171282 MGI:2159621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171281 MGI:2159619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217698 MGI:2384969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666963 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Acot6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217700 MGI:1921287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnalc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105000 MGI:1921462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnma1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70481 MGI:2180564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C130039O16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238317 MGI:2685106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 2 Proteins

name	EG432676 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432676 MGI:3643291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 367 ESTs, 7 Proteins

name	Zadh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77219 MGI:1916372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp410 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52708 MGI:1289280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830169C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217705 MGI:2443027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217707 MGI:1924408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12499 MGI:1321385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2900006K08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72873 MGI:1920123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf113a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66381 MGI:1913631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104776 MGI:1915077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lin52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217708 MGI:3045391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chx10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12677 MGI:88401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19300 MGI:1349217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	7420416P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432677 MGI:3588197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem90a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627191 MGI:2685107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67963 MGI:1915213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isca2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74316 MGI:1921566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 3 Proteins

name	Ltbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16997 MGI:99502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110018G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68497 MGI:1915747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73736 MGI:1920986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ylpm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56531 MGI:1926195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73422 MGI:1920672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlst (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78920 MGI:1926170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6kl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238323 MGI:2443413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Pgf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18654 MGI:105095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217715 MGI:2145118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217716 MGI:1353455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acyp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66204 MGI:1913454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810002I04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72350 MGI:1919600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217718 MGI:2387995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68581 MGI:1915831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 ESTs, 6 Proteins pseudo : _no_value

name	LOC667119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 3 Proteins pseudo : _no_value

name	Fos (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14281 MGI:95574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313611 GeneID:73828 MGI:1921078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 21 transcript_id : NM_030246.1

name	Zfyve1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348122 GeneID:217695 MGI:3026685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 1 transcript_id : NM_183154.3

name	Rbm25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430761 GeneID:67039 MGI:1914289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : RNA binding motif protein 25 transcript_id : NM_025930.3

name	Psen1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130584 GeneID:19164 MGI:1202717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : presenilin 1 transcript_id : NM_008943.2

name	Papln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18700029 GeneID:170721 MGI:2386139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : papilin, proteoglycan-like sulfated glycoprotein transcript_id : NM_130887.1

name	Numb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754911 GeneID:18222 MGI:107423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : numb gene homolog (Drosophila) transcript_id : NM_010949.1

name	2410016O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369353 GeneID:71952 MGI:1919202
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410016O06 gene transcript_id : NM_023633.2

name	Acot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538845 GeneID:171210 MGI:2159605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 2 transcript_id : NM_134188.2

name	Acot1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129966 GeneID:26897 MGI:1349396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 1 transcript_id : NM_012006.2

name	Acot4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543518 GeneID:171282 MGI:2159621
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 4 transcript_id : NM_134247.2

name	Acot3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129952 GeneID:171281 MGI:2159619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 3 transcript_id : NM_134246.3

name	Acot5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195804 GeneID:217698 MGI:2384969
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 5 transcript_id : NM_145444.2

name	Acot6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626166 GeneID:217700 MGI:1921287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 6 transcript_id : NM_172580.1

name	Dnalc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371894 GeneID:105000 MGI:1921462
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, light chain 1 transcript_id : NM_028821.2

name	Pnma1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349591 GeneID:70481 MGI:2180564
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paraneoplastic antigen MA1 transcript_id : NM_027438.2

name	C130039O16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263333 GeneID:238317 MGI:2685106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 2 Proteins product : RIKEN cDNA C130039O16 gene transcript_id : XM_001477247.1

name	EG432676 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393004 GeneID:432676 MGI:3643291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 367 ESTs, 7 Proteins product : predicted gene, EG432676 transcript_id : XM_484160.4

name	Zadh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719319 GeneID:77219 MGI:1916372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc binding alcohol dehydrogenase, domain containing 1 transcript_id : NM_029880.2

name	Zfp410 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362668 GeneID:52708 MGI:1289280
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 410 transcript_id : NM_144833.2

name	9830169C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802653 GeneID:217705 MGI:2443027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830169C18 gene transcript_id : NM_172581.2

name	Coq6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347915 GeneID:217707 MGI:1924408
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q6 homolog (yeast) transcript_id : NM_172582.2

name	Entpd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061459 GeneID:12499 MGI:1321385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 5 transcript_id : NM_007647.2

name	Entpd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061461 GeneID:12499 MGI:1321385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 5 transcript_id : NM_001026214.1

name	2900006K08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377432 GeneID:72873 MGI:1920123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900006K08 gene transcript_id : NM_028377.2

name	Rnf113a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759340 GeneID:66381 MGI:1913631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 113A2 transcript_id : NM_025525.2

name	Aldh6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892341 GeneID:104776 MGI:1915077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase family 6, subfamily A1 transcript_id : NM_134042.2

name	Lin52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348653 GeneID:217708 MGI:3045391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lin-52 homolog (C. elegans) transcript_id : NM_173756.3

name	Chx10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982857 GeneID:12677 MGI:88401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C. elegans ceh-10 homeo domain containing homolog transcript_id : NM_007701.2

name	Abcd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680613 GeneID:19300 MGI:1349217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family D (ALD), member 4 transcript_id : NM_008992.1

name	7420416P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253889 GeneID:432677 MGI:3588197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 7420416P09 gene transcript_id : NM_001033776.1

name	Tmem90a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892742 GeneID:627191 MGI:2685107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 90a transcript_id : NM_001033334.2

name	Npc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198336 GeneID:67963 MGI:1915213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Niemann Pick type C2 transcript_id : NM_023409.4

name	Isca2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392962 GeneID:74316 MGI:1921566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 46 ESTs, 3 Proteins product : iron-sulfur cluster assembly 2 homolog (S. cerevisiae), transcript variant 1 transcript_id : XM_203592.4

name	Ltbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487412 GeneID:16997 MGI:99502
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latent transforming growth factor beta binding protein 2 transcript_id : NM_013589.2

name	1110018G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538837 GeneID:68497 MGI:1915747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110018G07 gene transcript_id : NM_178065.3

name	Fcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930450 GeneID:73736 MGI:1920986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCF1 small subunit (SSU) processome component homolog (S. cerevisiae) transcript_id : NM_028632.1

name	Ylpm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044494 GeneID:56531 MGI:1926195
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YLP motif containing 1 transcript_id : NM_178363.2

name	Prox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368078 GeneID:73422 MGI:1920672
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prospero homeobox 2 transcript_id : NM_175198.3

name	Dlst (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30841024 GeneID:78920 MGI:1926170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) transcript_id : NM_030225.3

name	Rps6kl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130187 GeneID:238323 MGI:2443413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase-like 1 transcript_id : NM_146244.3

name	LOC100042021 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263337 GeneID:100042021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042021 transcript_id : XM_001477408.1

name	Pgf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982831 GeneID:18654 MGI:105095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placental growth factor transcript_id : NM_008827.2

name	Eif2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802053 GeneID:217715 MGI:2145118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2B, subunit 2 beta transcript_id : NM_145445.3

name	Mlh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249061 GeneID:217716 MGI:1353455
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mutL homolog 3 (E coli) transcript_id : NM_175337.1

name	Acyp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384809 GeneID:66204 MGI:1913454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acylphosphatase 1, erythrocyte (common) type transcript_id : NM_025421.1

name	2810002I04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387509 GeneID:72350 MGI:1919600
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002I04 gene transcript_id : NM_172414.2

name	Nek9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553094 GeneID:217718 MGI:2387995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 9 transcript_id : NM_145138.1

name	Tmed10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311554 GeneID:68581 MGI:1915831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24-like trafficking protein 10 (yeast) transcript_id : NM_026775.4

name	Fos (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560587 GeneID:14281 MGI:95574
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FBJ osteosarcoma oncogene transcript_id : NM_010234.2

name	Wdr21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313612 CCDS:CCDS26027.1 GeneID:73828 MGI:1921078
definition	codon_start : 1 product : WD repeat domain 21 protein_id : NP_084522.1

name	Zfyve1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625853 CCDS:CCDS26028.1 GeneID:217695 MGI:3026685
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005795 - Golgi stack [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005545 - phosphatidylinositol binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence ISS] codon_start : 1 product : zinc finger, FYVE domain containing 1 protein_id : NP_898977.2

name	Rbm25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430762 GeneID:67039 MGI:1914289
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 product : RNA binding motif protein 25 protein_id : NP_080206.3

name	Psen1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679493 CCDS:CCDS26030.1 GeneID:19164 MGI:1202717
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0035253 - ciliary rootlet [Evidence IDA]; GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence ISS] [Evidence IDA]; GO:0005639 - integral to nuclear inner membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005622 - intracellular [Evidence IDA]; GO:0000776 - kinetochore [Evidence ISS]; GO:0016020 - membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence ISS] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004175 - endopeptidase activity [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence IMP] [Evidence ISS]; GO:0042640 - anagen [Evidence IGI]; GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0006915 - apoptosis [Evidence IDA]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0001708 - cell fate specification [Evidence IGI]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence ISS]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007507 - heart development [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0007613 - memory [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0007220 - Notch receptor processing [Evidence IMP] [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IGI]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS]; GO:0045860 - positive regulation of protein kinase activity [Evidence IDA]; GO:0051604 - protein maturation [Evidence IGI]; GO:0016485 - protein processing [Evidence ISS]; GO:0051605 - proteolysis during protein maturation [Evidence IMP]; GO:0051563 - smooth endoplasmic reticulum calcium ion homeostasis [Evidence IGI] codon_start : 1 note : presenilin-1 product : presenilin 1 protein_id : NP_032969.1

name	Papln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700030 CCDS:CCDS26031.1 GeneID:170721 MGI:2386139
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : papilin protein_id : NP_570957.1

name	Numb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754912 CCDS:CCDS26032.1 GeneID:18222 MGI:107423
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005769 - early endosome [Evidence IDA]; GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007409 - axonogenesis [Evidence IDA] [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007405 - neuroblast proliferation [Evidence IGI] codon_start : 1 product : numb gene homolog protein_id : NP_035079.1

name	2410016O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963763 CCDS:CCDS26033.1 GeneID:71952 MGI:1919202
definition	GO_component : GO:0030685 - nucleolar preribosome [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA] GO_function : GO:0003723 - RNA binding [Evidence ISS] GO_process : GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0042254 - ribosome biogenesis and assembly [Evidence TAS] codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2410016O06 protein_id : NP_076122.1

name	Acot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538846 CCDS:CCDS26034.1 GeneID:171210 MGI:2159605
definition	GO_component : GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial acyl-CoA thioesterase 1 protein_id : NP_598949.2

name	Acot1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753550 GeneID:26897 MGI:1349396
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence TAS]; GO:0016292 - acyl-CoA thioesterase I activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence IDA] codon_start : 1 note : acyl-CoA thioesterase 1, cytosolic product : cytosolic acyl-CoA thioesterase 1 protein_id : NP_036136.1

name	Acot4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543519 CCDS:CCDS26035.1 GeneID:171282 MGI:2159621
definition	GO_component : GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peroxisomal acyl-CoA thioesterase 2B protein_id : NP_599008.2

name	Acot3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527406 CCDS:CCDS26036.1 GeneID:171281 MGI:2159619
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] [Evidence IDA] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence IDA] [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : peroxisomal acyl-CoA thioesterase 2A protein_id : NP_599007.1

name	Acot5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195805 CCDS:CCDS26037.1 GeneID:217698 MGI:2384969
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005777 - peroxisome [Evidence IDA] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence IDA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acyl-CoA thioesterase 5 protein_id : NP_663419.2

name	Acot6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626167 CCDS:CCDS26038.1 GeneID:217700 MGI:1921287
definition	EC_number : 3.1.2.2 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA] codon_start : 1 product : acyl-CoA thioesterase 6 protein_id : NP_766168.1

name	Dnalc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742877 CCDS:CCDS26039.1 GeneID:105000 MGI:1921462
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : axonemal dynein light chain 1 protein_id : NP_083097.1

name	Pnma1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037211 CCDS:CCDS26040.1 GeneID:70481 MGI:2180564
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : paraneoplastic antigen MA1 protein_id : NP_081714.1

name	C130039O16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263334 GeneID:238317 MGI:2685106
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477297.1

name	EG432676 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51766932 GeneID:432676 MGI:3643291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484160.1

name	Zadh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719320 GeneID:77219 MGI:1916372
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc binding alcohol dehydrogenase, domain containing 1 protein_id : NP_084156.2

name	Zfp410 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450221 CCDS:CCDS26042.1 GeneID:52708 MGI:1289280
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : another partner for ARF 1 protein_id : NP_659082.1

name	9830169C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369822 CCDS:CCDS26043.1 GeneID:217705 MGI:2443027
definition	codon_start : 1 product : hypothetical protein LOC217705 protein_id : NP_766169.1

name	Coq6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369832 CCDS:CCDS26044.1 GeneID:217707 MGI:1924408
definition	GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015997 - ubiquinone biosynthesis monooxygenase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006744 - ubiquinone biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : coenzyme Q6 homolog protein_id : NP_766170.1

name	Entpd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061460 GeneID:12499 MGI:1321385
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CD39 antigen-like 4 product : ectonucleoside triphosphate diphosphohydrolase 5 isoform a protein_id : NP_031673.2

name	Entpd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061462 CCDS:CCDS26045.1 GeneID:12499 MGI:1321385
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CD39 antigen-like 4 product : ectonucleoside triphosphate diphosphohydrolase 5 isoform b protein_id : NP_001021385.1

name	2900006K08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315973 GeneID:72873 MGI:1920123
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72873 protein_id : NP_082653.1

name	Rnf113a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759341 GeneID:66381 MGI:1913631
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 113A2 protein_id : NP_079801.2

name	Aldh6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527258 CCDS:CCDS26046.1 GeneID:104776 MGI:1915077
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006573 - valine metabolism [Evidence IEA] codon_start : 1 product : aldehyde dehydrogenase family 6, subfamily A1 protein_id : NP_598803.1

name	Lin52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424607 GeneID:217708 MGI:3045391
definition	codon_start : 1 product : lin-52 homolog protein_id : NP_776117.1

name	Chx10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671750 GeneID:12677 MGI:88401
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ocular retardation product : C. elegans ceh-10 homeo domain containing homolog protein_id : NP_031727.1

name	Abcd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680614 CCDS:CCDS26047.1 GeneID:19300 MGI:1349217
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : peroxisomal membrane protein, 70 kDa-related; peroxisomal membrane protein 1-like product : ATP-binding cassette, sub-family D, member 4 protein_id : NP_033018.1

name	7420416P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253890 CCDS:CCDS26048.1 GeneID:432677 MGI:3588197
definition	codon_start : 1 product : hypothetical protein LOC432677 protein_id : NP_001028948.1

name	Tmem90a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362733 CCDS:CCDS26049.1 GeneID:627191 MGI:2685107
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA] codon_start : 1 product : capucin protein_id : NP_001028506.1

name	Npc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963667 CCDS:CCDS26050.1 GeneID:67963 MGI:1915213
definition	codon_start : 1 product : epididymal secretory protein E1 protein_id : NP_075898.1

name	Isca2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25023734 GeneID:74316 MGI:1921566
definition	codon_start : 1 product : HESB like domain containing 1 isoform 1 protein_id : XP_203592.1

name	Ltbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487413 GeneID:16997 MGI:99502
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019838 - growth factor binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : latent transforming growth factor beta binding protein 2 protein_id : NP_038617.2

name	1110018G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538838 CCDS:CCDS26051.1 GeneID:68497 MGI:1915747
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68497 protein_id : NP_835166.2

name	Fcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930451 GeneID:73736 MGI:1920986
definition	codon_start : 1 exception : unclassified translation discrepancy product : FCF1 small subunit protein_id : NP_082908.1

name	Ylpm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044495 GeneID:56531 MGI:1926195
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : nuclear protein ZAP product : YLP motif containing 1 protein_id : NP_848140.2

name	Prox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424822 GeneID:73422 MGI:1920672
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : prospero homeobox 2 protein_id : NP_780407.1

name	Dlst (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313536 CCDS:CCDS26052.1 GeneID:78920 MGI:1926170
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0045252 - oxoglutarate dehydrogenase complex [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004149 - dihydrolipoyllysine-residue succinyltransferase activity [Evidence IEA]; GO:0031405 - lipoic acid binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 product : dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) protein_id : NP_084501.1

name	Rps6kl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981933 GeneID:238323 MGI:2443413
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : ribosomal protein S6 kinase-like 1 protein_id : NP_666356.2

name	LOC100042021 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263338 GeneID:100042021
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477458.1

name	Pgf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679289 GeneID:18654 MGI:105095
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0001658 - ureteric bud branching [Evidence IDA] codon_start : 1 product : placental growth factor protein_id : NP_032853.1

name	Eif2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703888 CCDS:CCDS26053.1 GeneID:217715 MGI:2145118
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005851 - eukaryotic translation initiation factor 2B complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence ISS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0044249 - cellular biosynthesis [Evidence IEA]; GO:0007417 - central nervous system development [Evidence ISS]; GO:0042552 - myelination [Evidence ISS]; GO:0001541 - ovarian follicle development [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence ISS] codon_start : 1 product : eukaryotic translation initiation factor 2B, subunit 2 beta protein_id : NP_663420.1

name	Mlh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249062 GeneID:217716 MGI:1353455
definition	GO_component : GO:0005712 - chiasma [Evidence IDA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0019237 - centromeric DNA binding [Evidence IDA]; GO:0003682 - chromatin binding [Evidence IDA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0007144 - female meiosis I [Evidence IMP]; GO:0007140 - male meiosis [Evidence IMP]; GO:0006298 - mismatch repair [Evidence IEA]; GO:0008104 - protein localization [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0007130 - synaptonemal complex formation [Evidence IMP] codon_start : 1 note : mutL 3 product : mutL homolog 3 protein_id : NP_780546.1

name	Acyp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384810 CCDS:CCDS26055.1 GeneID:66204 MGI:1913454
definition	codon_start : 1 product : acylphosphatase 1, erythrocyte (common) type protein_id : NP_079697.1

name	2810002I04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369541 CCDS:CCDS26056.1 GeneID:72350 MGI:1919600
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72350 protein_id : NP_766002.1

name	Nek9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553095 CCDS:CCDS26057.1 GeneID:217718 MGI:2387995
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : NIMA-related expressed kinase 9 protein_id : NP_660120.1

name	Tmed10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312062 GeneID:68581 MGI:1915831
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence ISS]; GO:0042589 - zymogen granule membrane [Evidence ISS] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006903 - vesicle targeting [Evidence ISS] codon_start : 1 note : transmembrane trafficking protein product : transmembrane emp24 domain-containing protein 10 protein_id : NP_081051.1

name	Fos (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753894 CCDS:CCDS26059.1 GeneID:14281 MGI:95574
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IC]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007399 - nervous system development [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence IMP] codon_start : 1 product : FBJ osteosarcoma oncogene protein_id : NP_034364.1

name	LOC100042325 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042325
definition	number : 1 pseudo : _no_value

name	LOC666963 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666963
definition	number : 3 pseudo : _no_value

name	LOC666963 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666963
definition	number : 2 pseudo : _no_value

name	LOC666963 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666963
definition	number : 1 pseudo : _no_value

name	LOC626950 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263348 GeneID:626950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 563 ESTs, 42 Proteins product : similar to histone H2A.F pseudo : _no_value transcript_id : XR_033615.1

name	LOC100042549 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263349 GeneID:100042549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 ESTs, 6 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_033996.1

name	LOC667119 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263339 GeneID:667119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 3 Proteins product : hypothetical LOC667119 pseudo : _no_value transcript_id : XR_033241.1

clone name	MSMg01-545B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458G06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-435O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450G22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-442E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035L02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-186M15.b	B6Ng01-186M15.g
ACC	GA011541	GA011542
length	1,118	1,090
definition	B6Ng01-186M15.b	B6Ng01-186M15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(85,833,011 - 85,834,134)	(85,696,808 - 85,697,896)
sequence	gaattcttccagagatgcttatgtacttaacacccaaggtctagcacact gcttttcaaagcagcccataataaatgtcctacttattatctttattata atatacacatcttaagaaatagatgttaacccttggtaggatctcagtta ctaaaatatgagggaaaatcagaagataatttaagtccattttgaaaaat agggaaaggagaagtgaaaaagacctcataacttgacgaataataaaatc agtatactttaagagaaacatgcttataagtctctgtcacaacccttcac gactcttggacaaggtttttctccccctcccccatacagcttaaaaattg agacattactcacatattgtaaaaacaggacctctctttttttttttttt ttttaaagatttatttatttattatatgtaagtacactgtagctgtcttc agacactccagaagagggagtcagatcttgttacggatggttgtgagcca ccatgtggttgctgggatttgaactcctgacctttggaagagcagtcggg tgctcttacccactgagccatctcaccagccccaggacctctctttttaa agttatagtgaactacacacaaaactcaccattgtgcactttaaaatgca aaattcatctgttatcattaggatcaattagtgtcaaacaaaactttttc accctctgcaactgaaaccattaaaaatcattaagcaacaactgtttttt ctcctcccagctggcacccaccgggttgcttttgtgtctatgggtctgat ctttttgtttgtttggtttggttgtttttttttttaagacagggtttctc tgtgtagccctggctgtcctggaactcaggctgggcttgaagtcagaaat ccgcctgcttctgcctcctgagtgctgggattaaagtgcgccaccactgc ctggctaccagcttcattcttgataaaattggaagacagacagacacaga cacacacacacacacagctaattaagtggctcagttggtaaaagcactgc tgtgtcaagcctgatgactaagtcgatcctgacgccacacgaatgccaag aactagctctaaatgtct	gaattcctgcagcacctctgggaacaccagcccacaggtagccagagatg ccaaggttatccttaccctggagtttgtcgccaagggctggttctagaat ggacttggggatcttcctagaagtggccttctttggggagaccttggtct gagccacagcagccgagtctctctgtggagcgtcttccttttgctgttct ttcttctcaaggaagctgaagggcttcaaggaggagagaaggagttcctt tctcttccgaatcccagcgcgcctccttgcctctctgcgctccatgatct cctgatagaggggcaggtagacgtgtgccggcacaggctgggcccggaac tgccgatggcactccgcctcttcctcgccctgcttctgggcctgtagcct ttcctgctcaaaagaggcaggtgaggccagccactgggccttcttccggg cctcacgcagtgtcatgcggaatggctgagggacggtgatggaagatgcc caagagcaaacacttctgtgctgggagggaggcccagagtctgaggttgg caggatccgagccttgggaatgtcagagggaaggctagtcatggagctgc agcgcctcatggagccatgcctggggagagagtggttctgtgtggaccca gcaaacaggaggtgaggttcctcccagagaccctcctccatttcctccct gcccagcagatcgtaaccaagagacttcttagtcttgatcccaaagcccc aaaggcctctaagtttttaaccctatcagctaggtttcccttcttgctac aacacaggcactcctagcagcccaacaggaactatctaagaattcataca ggaattgccacttgcattctgataactgcattacagtgtagtcggctagc acagggccaccgagtcagaagaatccaattggaacgtcaggtttttggat ttcccatgtagagttggcagagatcttactcacttataaggtccactggg aagggagtaccattacatttggtaaggcagtgtgtgtcatgacagccttg aagcctttggagagctgtaactggaagtcaagagtttggg
quality values	Open. Hide. 58 31 33 29 58 62 62 62 62 31 23 62 62 62 38 23 54 62 62 62 62 47 62 62 62 62 62 54 62 62 59 59 62 62 44 43 36 32 49 28 34 56 51 43 62 62 62 62 62 62 59 62 54 62 62 62 59 51 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 54 54 46 54 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 42 51 50 38 56 44 50 56 56 62 62 62 56 56 62 56 56 56 56 56 56 56 56 62 56 56 62 56 56 56 62 56 56 56 62 43 50 38 38 56 56 36 50 50 56 56 38 31 62 56 51 56 56 56 47 42 33 62 46 27 62 51 32 32 56 56 56 56 56 27 54 43 38 46 46 62 56 56 56 56 47 56 47 43 56 43 39 56 62 56 56 56 43 43 47 46 54 62 48 52 62 43 62 62 52 54 62 52 52 62 62 47 41 38 52 47 43 62 62 49 52 52 52 52 52 47 42 62 54 54 58 58 54 58 58 46 58 46 50 50 42 52 54 52 46 43 46 54 52 52 52 52 54 52 38 54 54 52 58 58 58 45 52 54 54 42 44 52 52 52 41 41 54 41 52 54 58 54 54 52 47 52 36 24 44 52 52 49 52 52 52 58 58 54 39 58 58 54 54 54 42 54 42 51 41 41 49 45 34 51 49 51 46 53 53 49 40 48 47 54 40 58 52 40 41 44 47 41 50 52 40 50 47 50 52 58 58 51 50 47 43 46 47 51 42 48 44 48 44 37 52 50 52 52 50 54 58 33 50 32 43 47 47 50 51 52 39 51 43 39 32 32 40 49 53 40 41 52 54 32 41 29 58 37 30 42 58 58 51 40 49 58 58 58 54 39 30 35 41 38 40 37 41 42 39 29 53 40 51 52 52 44 17 24 37 18 49 47 35 54 54 54 46 32 42 32 32 42 37 54 37 52 35 41 42 37 47 47 37 51 39 54 54 54 54 33 34 32 39 41 35 23 44 26 26 29 37 52 52 51 22 25 25 44 34 27 41 51 37 51 52 33 48 37 30 35 54 54 54 40 26 45 32 37 36 37 38 26 49 33 24 34 32 32 52 25 36 29 42 49 49 31 31 11 49 30 35 15 51 32 42 51 21 47 21 32 31 6 20 40 29 51 51 51 47 46 51 51 51 51 31 33 36 17 43 15 19 25 51 22 31 51 30 31 35 35 39 31 30 31 35 39 24 31 40 32 35 34 31 24 34 38 29 31 28 29 31 25 25 31 23 31 29 31 35 43 19 19 11 41 7 24 18 46 30 20 31 20 31 30 35 20 44 48 18 22 18 25 27 29 25 33 36 30 37 32 32 31 31 22 21 28 22 27 28 28 32 14 30 22 21 33 31 47 8 31 9 18 36 48 31 24 27 25 13 24 37 32 16 31 33 24 25 30 33 19 26 33 25 30 18 34 21 29 26 23 28 28 29 22 31 22 37 14 34 14 26 22 27 22 28 43 43 22 10 22 14 24 18 14 14 32 9 7 14 34 18 6 25 32 22 9 30 6 22 32 11 6 24 6 8 6 23 14 37 12 31 10 21 6 22 4 9 6 20 13 19 12 21 17 23 7 6 10 27 14 15 20 10 5 4 7 19 11 6 25 33 38 27 10 6 8 6 18 9 12 19 10 5 6 6 10 13 19 13 11 20 10 27 17 13 24 28 13 27 11 15 8 24 11 8 20 11 11 16 10 6 4 6 5 8 8 8 11 4 4 4 22 10 8 7 15 4 3 3 3 3 5 7 4 17 18 5 12 5 4 8 15 7 7 4 2 2 5	Open. Hide. 46 49 54 47 62 62 62 36 44 62 56 56 62 22 35 37 34 32 28 43 38 32 44 56 56 59 59 59 59 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 59 59 54 38 43 54 54 62 62 62 62 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 49 58 58 58 58 58 49 30 58 58 54 39 58 58 54 58 38 54 58 58 58 58 54 54 41 58 44 52 45 48 52 54 58 54 58 46 41 44 52 47 39 52 54 58 58 58 54 58 58 58 58 58 58 45 42 58 58 58 39 43 40 54 52 52 52 58 50 58 52 58 58 46 35 49 41 58 58 58 52 53 51 58 38 38 51 58 51 58 50 49 58 53 53 51 58 58 49 49 48 58 52 49 51 53 58 26 58 38 58 49 31 51 37 58 58 51 58 58 49 58 58 58 58 46 51 58 53 51 34 50 43 42 48 48 49 50 39 41 51 50 41 37 49 58 33 46 49 33 43 46 49 58 58 58 46 53 58 41 58 50 52 58 47 34 50 42 51 54 50 54 47 58 54 37 40 44 49 40 50 41 32 51 49 44 40 41 54 32 15 54 34 49 53 32 49 32 45 31 51 50 34 44 49 39 53 53 39 46 44 44 49 53 32 44 41 24 39 33 53 54 54 35 38 33 32 54 47 37 53 32 44 30 32 37 47 40 33 42 32 40 40 37 40 42 28 32 25 51 35 51 33 30 22 33 31 42 34 40 42 35 53 53 37 28 27 31 41 29 46 28 24 51 52 27 20 40 41 41 23 42 40 32 53 35 47 52 42 53 35 52 32 53 53 52 53 21 18 51 31 53 46 38 32 42 30 31 33 43 31 31 34 44 29 51 38 33 51 31 35 31 31 41 22 38 32 36 31 43 26 27 33 25 36 30 32 46 42 29 33 39 43 31 31 31 19 30 34 33 31 40 9 8 7 24 19 21 27 28 32 31 31 26 42 26 27 33 32 23 42 32 32 42 24 29 42 23 27 28 31 31 33 24 11 13 31 19 39 24 26 31 29 31 32 25 42 33 37 31 31 31 19 31 31 31 31 36 31 20 13 10 17 18 31 38 32 41 24 36 22 33 22 13 17 18 31 34 30 29 18 27 20 24 44 13 5 7 8 19 14 21 31 18 16 21 27 13 19 4 23 8 15 18 22 27 15 20 21 31 13 21 5 6 21 33 18 21 30 29 26 37 32 36 24 24 12 13 24 18 36 25 13 21 24 19 22 22 8 20 10 8 13 8 11 31 11 12 19 9 10 5 6 20 23 32 32 17 28 10 15 11 31 33 32 25 32 6 17 15 13 18 24 6 5 21 7 13 21 26 8 18 9 34 21 8 10 9 6 6 16 9 15 14 13 22 6 20 40 27 7 16 5 14 23 6 15 16 20 14 10 12 12 22 5 11 4 11 17 16 11 13 15 6 6 3 9 13 13 10 22 13 6 10 16 9 28 23 7 5 18 8 20 5 22 7 12 12 11 9 21 14 22 13 3 11 4 12 5 3 1 2 5 1 3 28 14 3 13 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_85833011_85834134
seq2: B6Ng01-186M15.b_48_1165 (reverse)

seq1  AGACAATTTAGAGCTTGTGCTGTGCA-TCGTGTGGCGTCCAGGGATCGAA  49
      |||| |||||||||| || ||  ||| ||||||||||||   |||||| |
seq2  AGAC-ATTTAGAGCTAGTTCTTGGCATTCGTGTGGCGTC--AGGATCG-A  46

seq1  CTTAAGTCATCAGGCTTGACACAGCAAGTGCTTTTACCCACTGAGCCACT  99
      ||| ||||||||||||||||||||| |||||||||||| |||||||||||
seq2  CTT-AGTCATCAGGCTTGACACAGC-AGTGCTTTTACCAACTGAGCCACT  94

seq1  TAATTAGCCTGTGTGTGTGTGTGTGTCTGTGTCTGTCTGTCTTCCAATTT  149
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTAG-CTGTGTGTGTGTGTGTGTCTGTGTCTGTCTGTCTTCCAATTT  143

seq1  TATCAAGAATGAAGCTGGTAGCCAGGCAGTGGTGGCGCACTTTAATCCCA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAAGAATGAAGCTGGTAGCCAGGCAGTGGTGGCGCACTTTAATCCCA  193

seq1  GCACTCAGGAGGCAGAAGCAGGCGGATTTCTGACTTCAAGGCCAGCCTGA  249
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GCACTCAGGAGGCAGAAGCAGGCGGATTTCTGACTTCAAGCCCAGCCTGA  243

seq1  GTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTAAAAAAAAAA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTTAAAAAAAAAA  293

seq1  ACAACCAAACCAAACAAACAAAAAGATCAGACCCATAGACACAAAAGCAA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACCAAACCAAACAAACAAAAAGATCAGACCCATAGACACAAAAGCAA  343

seq1  CCCGGTGGGTGCCAGCTGGGAGGAGAAAAAACAGTTGTTGCTTAATGATT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGGTGGGTGCCAGCTGGGAGGAGAAAAAACAGTTGTTGCTTAATGATT  393

seq1  TTTAATGGTTTCAGTTGCAGAGGGTGAAAAAGTTTTGTTTGACACTAATT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATGGTTTCAGTTGCAGAGGGTGAAAAAGTTTTGTTTGACACTAATT  443

seq1  GATCCTAATGATAACAGATGAATTTTGCATTTTAAAGTGCACAATGGTGA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCTAATGATAACAGATGAATTTTGCATTTTAAAGTGCACAATGGTGA  493

seq1  GTTTTGTGTGTAGTTCACTATAACTTTAAAAAGAGAGGTCCTGGGGCTGG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTGTGTGTAGTTCACTATAACTTTAAAAAGAGAGGTCCTGGGGCTGG  543

seq1  TGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCAGG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCAGG  593

seq1  AGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGA  643

seq1  TCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACAT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACAT  693

seq1  ATAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAGAGAGGTCCTG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAGAGAGGTCCTG  743

seq1  TTTTTACAATATGTGAGTAATGTCTCAATTTTTAAGCTGTATGGGGGAGG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTACAATATGTGAGTAATGTCTCAATTTTTAAGCTGTATGGGGGAGG  793

seq1  GGGAGAAAAACCTTGTCCAAGAGTCGTGAAGGGTTGTGACAGAGACTTAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGAAAAACCTTGTCCAAGAGTCGTGAAGGGTTGTGACAGAGACTTAT  843

seq1  AAGCATGTTTCTCTTAAAGTATACTGATTTTATTATTCGTCAAGTTATGA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCATGTTTCTCTTAAAGTATACTGATTTTATTATTCGTCAAGTTATGA  893

seq1  GGTCTTTTTCACTTCTCCTTTCCCTATTTTTCAAAATGGACTTAAATTAT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTTTTCACTTCTCCTTTCCCTATTTTTCAAAATGGACTTAAATTAT  943

seq1  CTTCTGATTTTCCCTCATATTTTAGTAACTGAGATCCTACCAAGGGTTAA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGATTTTCCCTCATATTTTAGTAACTGAGATCCTACCAAGGGTTAA  993

seq1  CATCTATTTCTTAAGATGTGTATATTATAATAAAGATAATAAGTAGGACA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTATTTCTTAAGATGTGTATATTATAATAAAGATAATAAGTAGGACA  1043

seq1  TTTATTATGGGCTGCTTTGAAAAGCAGTGTGCTAGACCTTGGGTGTTAAG  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTATGGGCTGCTTTGAAAAGCAGTGTGCTAGACCTTGGGTGTTAAG  1093

seq1  TACATAAGCATCTCTGGAAGAATTC  1124
      |||||||||||||||||||||||||
seq2  TACATAAGCATCTCTGGAAGAATTC  1118

seq1: chr12_85696808_85697896
seq2: B6Ng01-186M15.g_65_1154

seq1  GAATTCCTGCAGCACCTCTGGGAACACCAGCCCACAGGTAGCCAGAGATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGCAGCACCTCTGGGAACACCAGCCCACAGGTAGCCAGAGATG  50

seq1  CCAAGGTTATCCTTACCCTGGAGTTTGTCGCCAAGGGCTGGTTCTAGAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGGTTATCCTTACCCTGGAGTTTGTCGCCAAGGGCTGGTTCTAGAAT  100

seq1  GGACTTGGGGATCTTCCTAGAAGTGGCCTTCTTTGGGGAGACCTTGGTCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTGGGGATCTTCCTAGAAGTGGCCTTCTTTGGGGAGACCTTGGTCT  150

seq1  GAGCCACAGCAGCCGAGTCTCTCTGTGGAGCGTCTTCCTTTTGCTGTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCACAGCAGCCGAGTCTCTCTGTGGAGCGTCTTCCTTTTGCTGTTCT  200

seq1  TTCTTCTCAAGGAAGCTGAAGGGCTTCAAGGAGGAGAGAAGGAGTTCCTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCTCAAGGAAGCTGAAGGGCTTCAAGGAGGAGAGAAGGAGTTCCTT  250

seq1  TCTCTTCCGAATCCCAGCGCGCCTCCTTGCCTCTCTGCGCTCCATGATCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTCCGAATCCCAGCGCGCCTCCTTGCCTCTCTGCGCTCCATGATCT  300

seq1  CCTGATAGAGGGGCAGGTAGACGTGTGCCGGCACAGGCTGGGCCCGGAAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGATAGAGGGGCAGGTAGACGTGTGCCGGCACAGGCTGGGCCCGGAAC  350

seq1  TGCCGATGGCACTCCGCCTCTTCCTCGCCCTGCTTCTGGGCCTGTAGCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCGATGGCACTCCGCCTCTTCCTCGCCCTGCTTCTGGGCCTGTAGCCT  400

seq1  TTCCTGCTCAAAAGAGGCAGGTGAGGCCAGCCACTGGGCCTTCTTCCGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGCTCAAAAGAGGCAGGTGAGGCCAGCCACTGGGCCTTCTTCCGGG  450

seq1  CCTCACGCAGTGTCATGCGGAATGGCTGAGGGACGGTGATGGAAGATGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACGCAGTGTCATGCGGAATGGCTGAGGGACGGTGATGGAAGATGCC  500

seq1  CAAGAGCAAACACTTCTGTGCTGGGAGGGAGGCCCAGAGTCTGAGGTTGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAGCAAACACTTCTGTGCTGGGAGGGAGGCCCAGAGTCTGAGGTTGG  550

seq1  CAGGATCCGAGCCTTGGGAATGTCAGAGGGAAGGCTAGTCATGGAGCTGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGATCCGAGCCTTGGGAATGTCAGAGGGAAGGCTAGTCATGGAGCTGC  600

seq1  AGCGCCTCATGGAGCCATGCCTGGGGAGAGAGTGGTTCTGTGTGGACCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGCCTCATGGAGCCATGCCTGGGGAGAGAGTGGTTCTGTGTGGACCCA  650

seq1  GCAAACAGGAGGTGAGGTTCCTCCCAGAGACCCTCCTCCATTTCCTCCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACAGGAGGTGAGGTTCCTCCCAGAGACCCTCCTCCATTTCCTCCCT  700

seq1  GCCCAGCAGATCGTAACCAAGAGACTTCTTAGTCTTGATCCCAAAGCCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGCAGATCGTAACCAAGAGACTTCTTAGTCTTGATCCCAAAGCCCC  750

seq1  AAAGGCCTCTAAGTTTTTAACCCTATCAGCTAGGTTTCCCTTCTTGCTAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCCTCTAAGTTTTTAACCCTATCAGCTAGGTTTCCCTTCTTGCTAC  800

seq1  AACACAGGCACTCCTAGCAGCCCAACAGGAACTATCTAAGAATTCATACA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACAGGCACTCCTAGCAGCCCAACAGGAACTATCTAAGAATTCATACA  850

seq1  GGAATTGCCACTTGCATTCTGATAACTGCA-TACAGTGTAGTCGGCTAGC  899
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  GGAATTGCCACTTGCATTCTGATAACTGCATTACAGTGTAGTCGGCTAGC  900

seq1  ACAGGGCCACCGAGTCAGAAGGATCCAATTGGAACGTCAGGTTTTTGGAT  949
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  ACAGGGCCACCGAGTCAGAAGAATCCAATTGGAACGTCAGGTTTTTGGAT  950

seq1  TTCCCATGTAGAG-TGGCAGAGATCTTACCCACTTATAAGGT-CACTGGG  997
      ||||||||||||| ||||||||||||||| |||||||||||| |||||||
seq2  TTCCCATGTAGAGTTGGCAGAGATCTTACTCACTTATAAGGTCCACTGGG  1000

seq1  AAGGGAGTA-CATTACATTTGGTAAAGGCAGTGTGGTGGCATGACAGGCC  1046
      ||||||||| ||||||||||||| |||||||||| ||| |||||||| | 
seq2  AAGGGAGTACCATTACATTTGGT-AAGGCAGTGT-GTGTCATGACAGCCT  1048

seq1  TGAAGCCTTT-GAGAGCTGTAACTGGGAAGTTCAAGAGTTTGGG  1089
      |||||||||| ||||||||||||| ||||| |||||||||||||
seq2  TGAAGCCTTTGGAGAGCTGTAACT-GGAAG-TCAAGAGTTTGGG  1090

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information