MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-206G01
Chromosome	12 (Build37)
Map Location	19,181,991 - 19,183,008
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668539, LOC100043324, LOC636282, EG632781, LOC668541, LOC673160, 5730507C01Rik, EG668553, LOC668558, LOC100042641, LOC668568, LOC668570, EG668413
Downstream gene	LOC671401, EG546524, EG668584, EG544848, EG627871, LOC100042698, LOC629055, EG668588, LOC100042706, EG668594, EG668600, LOC100042727, LOC673301, EG668605
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins pseudo : _no_value

name	LOC100043324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 230 ESTs, 7 Proteins

name	LOC636282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG632781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632781 MGI:3648655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC668541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 146 ESTs, 6 Proteins pseudo : _no_value

name	LOC673160 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	5730507C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236366 MGI:1917882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668553 MGI:3645302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 23 Proteins pseudo : _no_value

name	LOC668558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins pseudo : _no_value

name	LOC100042641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC668568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC668570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG668413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668413 MGI:3643721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC671401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	EG546524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG668584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668584 MGI:3648979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	EG544848 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG627871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC629055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	EG668588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG668594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668594 MGI:3645724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG668600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668600 MGI:3643303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	LOC100042727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC673301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	EG668605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC100043324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262876 GeneID:100043324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 230 ESTs, 7 Proteins product : similar to BNIP3L protein transcript_id : XM_001480439.1

name	LOC673160 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262795 GeneID:673160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001478468.1

name	5730507C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367376 GeneID:236366 MGI:1917882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730507C01 gene transcript_id : NM_001033157.2

name	LOC100042641 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262799 GeneID:100042641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478565.1

name	EG546524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262879 GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG546524 transcript_id : XM_001480466.1

name	EG544848 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392392 GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG544848, transcript variant 1 transcript_id : XM_001004780.1

name	EG668588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392464 GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668588 transcript_id : XM_001002492.1

name	LOC100042727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262801 GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Predicted gene, EG245297 transcript_id : XM_001478694.1

name	LOC100043324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262877 GeneID:100043324
definition	codon_start : 1 product : similar to BNIP3L protein protein_id : XP_001480489.1

name	LOC673160 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262796 GeneID:673160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478518.1

name	5730507C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701598 GeneID:236366 MGI:1917882
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC236366 protein_id : NP_001028329.1

name	LOC100042641 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262800 GeneID:100042641
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478615.1

name	EG546524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262880 GeneID:546524 MGI:3647171
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480516.1

name	EG544848 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392393 GeneID:544848 MGI:3647969
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2, isoform 1 protein_id : XP_001004780.1

name	EG668588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392465 GeneID:668588 MGI:3648973
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2 protein_id : XP_001002492.1

name	LOC100042727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262802 GeneID:100042727
definition	codon_start : 1 product : similar to Predicted gene, EG245297 protein_id : XP_001478744.1

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 1 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 2 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 3 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 4 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 1 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 2 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 3 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 1 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 2 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 3 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 1 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 2 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 3 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 1 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 2 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 3 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 1 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 2 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 1 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 2 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 4 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 1 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 2 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 3 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 4 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 1 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 2 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 2 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 2 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 3 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 4 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 1 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 2 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 3 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 4 pseudo : _no_value

name	LOC668539 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262875 GeneID:668539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034692.1

name	LOC668541 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262878 GeneID:668541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 146 ESTs, 6 Proteins product : similar to protein phosphatase 1cgamma pseudo : _no_value transcript_id : XR_034696.1

name	EG668553 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262797 GeneID:668553 MGI:3645302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 23 Proteins product : predicted gene, EG668553 pseudo : _no_value transcript_id : XR_033730.1

name	LOC668558 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262798 GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_033734.1

name	EG627871 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94392463 GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627871 transcript_id : XR_002310.1

name	LOC629055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262881 GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034711.1

name	EG668605 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262882 GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : predicted gene, EG668605 pseudo : _no_value transcript_id : XR_002219.2

clone name	MSMg01-486A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495C15
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-116L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-206G01.b	B6Ng01-206G01.g
ACC	GA025809	GA025810
length	953	1,023
definition	B6Ng01-206G01.b	B6Ng01-206G01.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcctgatctttccaaaacttttatcatgaatgggtgttggatcttg tcaaatgctttttctgcatctaacgagatgatcatgtggtttttgtcttt gagtttgtttatataatggattacattgatggattttcgtatattaaacc atccctgcatccctggaataaaacctacttggtcaggatggatgattgct ttaatgtgttcttggatgcggttagcgagaattttattaaggatttttgc atcgatgttcataagagaaattggtctgaagttctctatctttgttggat ctttctgtggtttaggtatcagagtaatagtggcttcataaaatgagttg ggtagaataccttctacttctatcttgtgaaaaagtttgtgcagaactgg agttagatcttctttgaaggtctgatagaactctgcactaaacccgtctg gtcctgggctttttttggctgggagactattaataactgcttctatttct ttaggggatatgggactgtttagaaggtcaacttgatcctgattcaactt tggtacctggtatctgtccagaaatttgtccatttcgtccaggttttcca gttttgttgagtatagccttttgtagaaggatctgatggtgttttggatt tcttcaggatctgttgttatgtctcccttttcatttctgattttgttaat taggattttgtccctgtgccctttagtgagtctagctaagggtttatcta tcttgttgattttctcaaagaaccaactcctcgtttggttaattctttga atagttcttcttgtttccacttggttgatttcaacccctgagtttgatta tttcctgccgtctactcctcttgggtgaatttgccttcttttttctagag cttttagatgtgtgtcaagcctgctagtatggtgctctctccgatttttt ctt	tggcagagacccatgaggactacaaggcgcccacggcctctagcttcacc acgggcacggcccagtgccggaacaccgtggcggccatctagcttagccc gcgccgggagggaggctagggcctcggggatcgcgctgagccctggggcc cggctaggcttccgcgcctggtgcccgatatccagtgccctccgcctgcg cccacacccgggaaaagtttctggtaccccaaagccttacgcagccgggc cagcagtgcccgacacagaagccctttgttccctgctctagggagaggct gcttggccaccttggggcttttttgggaacgctcctgtctgttcccattt ccctcgcagggtttcaggtcctttgttcccatcctcggagaggtcaactt cggctgcagaatccctggcggctgcgagccggggacccctgcgagctctg cggtccctgagtgatggctctccctgcgtggacctctccaacttgttcca gaagtggcccggcgggggcagctgtggcttctgagccaacatgtagagca gatccaggggaccacaagctgcttaggcaggggtgcccatcccatcttgg gaggcctggcagtgcccactatttgccacagacagagcagcactgtagag ggatgtggagaaccagcgctttgaggtccaaaaggtctttggtggccact tctgggctacctgtgtggtgcctgctgacagtatagtcagctcctttgcc cttaacctggaaaagggcctgcatagtcattgtattgagtgggctaagca gcgagctctccagaccctgggggagagggactgcgagaaggaagcagttt gggttgaaaattgaagcaagcttggaagaggctggtgtgaagtccagaga caatggcttgtccatagcttggggaagcctcacttacatcatttttcttt acctccccacagaatttagagtttctgtttttcgctctgtaggcattgtg cgtccagactgggactcacagta
quality values	Open. Hide. 44 36 24 32 58 58 62 47 49 38 31 49 62 62 62 62 31 13 62 62 62 62 54 62 62 49 62 49 47 59 59 59 51 45 44 49 38 24 44 33 29 50 62 62 59 59 62 62 62 59 62 59 62 62 62 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 56 54 54 62 62 62 62 54 62 62 62 62 62 56 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 47 44 47 54 62 62 62 54 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 54 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 62 62 56 47 62 62 62 62 62 48 46 62 62 62 54 62 62 62 42 42 62 62 62 62 62 62 52 62 43 62 62 62 62 62 62 41 58 54 58 54 54 54 52 52 52 58 58 54 58 58 58 54 52 41 32 58 52 52 58 46 41 52 58 48 58 50 58 54 54 58 54 58 58 58 58 40 50 49 54 42 41 54 54 52 37 25 58 42 35 54 54 45 28 54 58 52 52 52 54 51 53 51 51 58 58 45 35 58 58 54 50 37 43 48 50 47 48 50 51 26 54 58 58 58 40 51 50 52 45 46 51 37 58 41 42 58 58 54 52 50 50 50 50 50 53 42 49 49 50 30 29 58 34 50 29 39 58 54 50 35 33 47 37 39 52 36 13 16 5 41 20 50 38 10 13 31 41 39 52 42 42 39 31 33 20 26 31 41 39 58 54 39 39 34 32 41 32 50 39 52 41 39 40 22 20 35 53 32 51 49 52 28 33 51 33 51 9 5 29 33 45 29 50 52 31 51 44 40 50 25 32 30 29 37 40 53 25 30 29 30 19 26 25 41 26 31 24 23 32 33 28 18 13 40 30 35 43 34 37 33 25 6 6 16 46 32 19 12 16 32 20 35 53 32 40 27 17 28 31 53 32 35 53 45 40 40 23 18 13 10 29 35 30 34 32 31 18 26 34 41 11 27 45 33 12 12 33 51 31 41 20 9 12 7 27 22 7 6 19 22 23 37 23 30 26 41 22 35 18 17 37 30 30 7 14 8 30 19 18 11 20 16 12 13 26 25 15 21 8 13 6 7 14 10 21 15 27 9 7 23 15 9 12 17 12 14 9 11 27 26 28 21 6 29 38 32 31 38 13 24 18 37	Open. Hide. 54 62 56 42 32 27 38 23 25 29 38 44 44 62 59 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 59 62 59 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 59 62 62 62 62 62 59 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 33 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 54 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 44 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 39 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 56 62 47 35 62 62 62 62 62 62 62 62 62 62 62 62 46 62 43 62 62 43 62 62 62 62 47 42 62 52 62 43 62 62 62 62 62 48 58 54 52 47 58 52 49 44 49 58 54 54 58 52 58 58 52 58 54 58 44 40 54 52 58 54 48 58 54 47 29 58 20 58 54 58 54 52 42 53 54 47 41 58 47 37 44 58 50 47 54 58 53 52 54 50 54 54 42 54 52 36 42 58 31 47 49 40 54 46 45 54 54 50 49 35 45 36 58 49 38 24 50 46 54 58 49 39 36 23 19 34 18 40 52 50 48 48 49 38 36 30 23 58 41 51 46 32 58 58 49 16 58 34 39 49 38 37 50 51 32 58 53 29 53 39 39 25 46 37 40 49 58 27 50 53 39 41 37 41 50 29 35 39 39 54 29 52 25 41 37 42 50 52 49 35 25 28 42 52 42 41 40 34 29 39 35 40 40 52 26 33 32 47 40 42 34 51 41 38 51 32 52 42 52 42 28 28 46 54 54 49 32 54 41 20 53 34 52 35 27 42 29 40 34 40 31 41 33 46 15 28 42 25 37 42 32 20 13 54 21 28 42 22 44 15 39 29 34 45 32 40 31 29 39 23 15 14 36 17 32 53 31 47 21 31 41 31 47 47 9 49 17 47 25 47 27 11 14 31 31 35 22 45 14 31 42 10 33 26 51 21 27 18 31 45 45 25 46 31 31 18 29 16 30 29 32 32 14 26 15 14 31 13 30 23 8 41 20 31 42 31 11 31 30 12 40 18 21 15 26 8 21 11 29 9 7 14 22 6 28 29 27 32 25 37 6 14 31 6 9 20 25 22 10 19 10 32 31 26 20 30 18 18 36 27 39 12 19 31 31 28 16 29 9 20 19 30 24 24 5 22 22 13 26 26 31 11 11 23 38 38 32 6 9 28 31 12 9 9 9 9 29 20 21 14 31 10 12 18 21 22 10 35 25 8 5 18 10 22 24 20 22 6 7 5 30 30 31 14 17 17 5 4 5 6 6 5 22 17 21 34 10 16 7 11 10 9 10 8 10 18 23 7 12 11 19 10 22 34 9 17 5 5 11 7 7 6 13 8 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_19181991_19183008
seq2: B6Ng01-206G01.g_70_1092

seq1  TGGCAGAGACCCATGAGGACTACAAGGCGCCCACGGCCTCTAGCTTCACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAGAGACCCATGAGGACTACAAGGCGCCCACGGCCTCTAGCTTCACC  50

seq1  ACGGGCACGGCCCAGTGCCGGAACACCGTGGCGGCCATCTAGCTTAGCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGGCACGGCCCAGTGCCGGAACACCGTGGCGGCCATCTAGCTTAGCCC  100

seq1  GCGCCGGGAGGGAGGCTAGGGCCTCGGGGATCGCGCTGAGCCCTGGGGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCCGGGAGGGAGGCTAGGGCCTCGGGGATCGCGCTGAGCCCTGGGGCC  150

seq1  CGGCTAGGCTTCCGCGCCTGGTGCCCGATATCCAGTGCCCTCCGCCTGCG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCTAGGCTTCCGCGCCTGGTGCCCGATATCCAGTGCCCTCCGCCTGCG  200

seq1  CCCACACCCGGGAAAAGTTTCTGGTACCCCAAAGCCTTACGCAGCCGGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACACCCGGGAAAAGTTTCTGGTACCCCAAAGCCTTACGCAGCCGGGC  250

seq1  CAGCAGTGCCCGACACAGAAGCCCTTTGTTCCCTGCTCTAGGGAGAGGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGTGCCCGACACAGAAGCCCTTTGTTCCCTGCTCTAGGGAGAGGCT  300

seq1  GCTTGGCCACCTTGGGGCTTTTTTGGGAACGCTCCTGTCTGTTCCCATTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGGCCACCTTGGGGCTTTTTTGGGAACGCTCCTGTCTGTTCCCATTT  350

seq1  CCCTCGCAGGGTTTCAGGTCCTTTGTTCCCATCCTCGGAGAGGTCAACTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCGCAGGGTTTCAGGTCCTTTGTTCCCATCCTCGGAGAGGTCAACTT  400

seq1  CGGCTGCAGAATCCCTGGCGGCTGCGAGCCGGGGACCCCTGCGAGCTCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCTGCAGAATCCCTGGCGGCTGCGAGCCGGGGACCCCTGCGAGCTCTG  450

seq1  CGGTCCCTGAGTGATGGCTCTCCCTGCGTGGACCTCTCCAACTTGTTCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGTCCCTGAGTGATGGCTCTCCCTGCGTGGACCTCTCCAACTTGTTCCA  500

seq1  GAAGTGGCCCGGCGGGGGCAGCTGTGGCTTCTGAGCCAACATGTAGAGCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTGGCCCGGCGGGGGCAGCTGTGGCTTCTGAGCCAACATGTAGAGCA  550

seq1  GATCCAGGGGACCACAAGCTGCTTAGGCAGGGGTGCCCATCCCATCTTGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCAGGGGACCACAAGCTGCTTAGGCAGGGGTGCCCATCCCATCTTGG  600

seq1  GAGGCCTGGCAGTGCCCACTATTTGCCACAGACAGAGCAGCACTGTAGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCCTGGCAGTGCCCACTATTTGCCACAGACAGAGCAGCACTGTAGAG  650

seq1  GGATGTGGAGAACCAGCGCTTTGAGGTCCAAAAGGTCTTTGGTGGCCACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGTGGAGAACCAGCGCTTTGAGGTCCAAAAGGTCTTTGGTGGCCACT  700

seq1  TCTGGGCTACCTGTGTGGTGCCTGCTGACAGTATAGTCAGCTCCTTTGCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGCTACCTGTGTGGTGCCTGCTGACAGTATAGTCAGCTCCTTTGCC  750

seq1  CTTAACCTGGAAAAGGGCCTGCATAGTCATTGTATTGAGT-GGCTAAGCA  799
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  CTTAACCTGGAAAAGGGCCTGCATAGTCATTGTATTGAGTGGGCTAAGCA  800

seq1  GCGAGCTCTCCAGACCCTGGGGAAGAGGGACTGCGAGAAGGAAGCAGTTT  849
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GCGAGCTCTCCAGACCCTGGGGGAGAGGGACTGCGAGAAGGAAGCAGTTT  850

seq1  GGGTTGAAAATTGAAGCAGGCTTGGAAGAGGCT-GTGTG-AGTCCAGAGA  897
      |||||||||||||||||| |||||||||||||| ||||| ||||||||||
seq2  GGGTTGAAAATTGAAGCAAGCTTGGAAGAGGCTGGTGTGAAGTCCAGAGA  900

seq1  CCATGGC-TGTCCATAGCTTGGGGAAGCCTCACTTACATCA-TTTTCTTT  945
      | ||||| ||||||||||||||||||||||||||||||||| ||||||||
seq2  CAATGGCTTGTCCATAGCTTGGGGAAGCCTCACTTACATCATTTTTCTTT  950

seq1  ACCTCCCCAACAGAATTTAGAGTTTCGTGTTTTCGGCTCTGTAGGCATTG  995
      |||||||| ||||||||||||||||| ||||||  |||||||||||||||
seq2  ACCTCCCC-ACAGAATTTAGAGTTTC-TGTTTTTCGCTCTGTAGGCATTG  998

seq1  TGCGTCCAG-CT-GGACTCACAGTA  1018
      ||||||||| || ||||||||||||
seq2  TGCGTCCAGACTGGGACTCACAGTA  1023

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information