MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-252C21
Chromosome	12 (Build37)
Map Location	19,708,565 - 19,709,493
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668558, LOC100042641, LOC668568, LOC668570, EG668413, LOC671401, EG546524, EG668584, EG544848, EG627871, LOC100042698, LOC629055, EG668588
Downstream gene	LOC100042706, EG668594, EG668600, LOC100042727, LOC673301, EG668605, LOC668614, LOC100042751, LOC100043371, EG668455, LOC100042755, LOC100043377
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins pseudo : _no_value

name	LOC100042641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC668568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC668570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG668413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668413 MGI:3643721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC671401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	EG546524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG668584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668584 MGI:3648979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	EG544848 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG627871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC629055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	EG668588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG668594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668594 MGI:3645724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG668600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668600 MGI:3643303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	LOC100042727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC673301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	EG668605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC668614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100042751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	EG668455 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668455 MGI:3644169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 139 ESTs, 7 Proteins

name	LOC100042755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC100043377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042641 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262799 GeneID:100042641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478565.1

name	EG546524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262879 GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG546524 transcript_id : XM_001480466.1

name	EG544848 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392392 GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG544848, transcript variant 1 transcript_id : XM_001004780.1

name	EG668588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392464 GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668588 transcript_id : XM_001002492.1

name	LOC100042727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262801 GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Predicted gene, EG245297 transcript_id : XM_001478694.1

name	LOC100043371 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262883 GeneID:100043371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480491.1

name	EG668455 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392403 GeneID:668455 MGI:3644169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 139 ESTs, 7 Proteins product : predicted gene, EG668455 transcript_id : XM_001004798.1

name	LOC100043377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262885 GeneID:100043377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480493.1

name	LOC100042641 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262800 GeneID:100042641
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478615.1

name	EG546524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262880 GeneID:546524 MGI:3647171
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480516.1

name	EG544848 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392393 GeneID:544848 MGI:3647969
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2, isoform 1 protein_id : XP_001004780.1

name	EG668588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392465 GeneID:668588 MGI:3648973
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2 protein_id : XP_001002492.1

name	LOC100042727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262802 GeneID:100042727
definition	codon_start : 1 product : similar to Predicted gene, EG245297 protein_id : XP_001478744.1

name	LOC100043371 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262884 GeneID:100043371
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480541.1

name	EG668455 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392404 GeneID:668455 MGI:3644169
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004798.1

name	LOC100043377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262886 GeneID:100043377
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480543.1

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 1 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 2 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 3 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 1 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 2 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 3 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 1 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 2 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 3 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 1 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 2 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 1 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 2 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 4 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 1 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 2 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 3 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 4 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 1 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 2 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 2 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 2 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 3 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 4 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 1 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 2 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 3 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 4 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 1 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 2 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 3 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 1 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 2 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 3 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 4 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 5 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 6 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 1 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 2 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 3 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 4 pseudo : _no_value

name	LOC668558 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262798 GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_033734.1

name	EG627871 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94392463 GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627871 transcript_id : XR_002310.1

name	LOC629055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262881 GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034711.1

name	EG668605 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262882 GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : predicted gene, EG668605 pseudo : _no_value transcript_id : XR_002219.2

clone name	MSMg01-495C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061A04
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-078E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-252C21.b	B6Ng01-252C21.g
ACC	GA059247	GA059248
length	1,233	945
definition	B6Ng01-252C21.b	B6Ng01-252C21.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcactcagacaacccgattcttctacagcaaaactttattgcttca tctgaaggaagaccccgaacaaggaaaatggtgctgcttatatacccctg agtgtgacgtgtcagctcctgattagctgctcactcatcaccccactact acaccccggggtgggcagtgacttggcaccaatttactcttgcacctgtg cacattacttgtttaccaattaggcacagcggaggccagcgccatcttgt aatggcgattgctcatggctctccacatctcctcctttttattttattaa aacgcaagtcactctttaatggatgaggatagaggtcgaattactagtgt gcagaaataggggccatgtacaggattgactcttaagctcacaggctttt accccgagcaaccctgacctgctcccatgccgtttttcctgggggaggga cacttggatactcaaccctcatgtaaatcgacttgtcttctaggagtgcc caaacctctgagcgtctcctatgcggtgcttagcccaacaatccataaga gtcaacgacctactcactcgtccttgtgcaatgagtctagcctctagggg tgcaagagctgagtatggcctagggtgagctttaattgttgagtctctct cattttccgcagaaccgaggtgtgcaagagcagagaactcagatgccaat taagacttacgcatggatagccaaatttcaggggaggtcccttgttcaat ggctgcaagtgcttgagcaataacgacattgtcacgattttgttgggttc tgagcttgcagaccaaccagagcatgaacacaagcccacagcagatggca gcagcaaacaaaactacccccacccacttcttaaaataagaaaatgcaga tgaaatccaggaagagaggccctctgtcaatgacaggtctactcgcgtcg agttgatccttagaacggccactctcagggcctcaagtgtctcatcgatc cttcagaccaatttcctgcagatacaaggagagctgttctagacagatag ctgcatggagtaaattttttcatatgaacacttggtaatgcacagagcac tctattttcttcacaggccactgggccaacttgtatagaacctattcatt tctcaccagattgaggcctgatccaaatcataagccctccctcacatggc acctagcgcaggttgcagattatgtagaactgc	gaattccccaccagaacctcaggaaagggccagtgggacagtgtgggtag ctcgcccccaacaagacagtgaaatcctccagggcactttagcgggacaa gatgtagggacagttggggatgcaatgatagggaccatgttctgtgtgtg agctttctcacagccttaagaaggcaggggtaaaggcaggtattttgcat agggagttgaccatggtacaagccgaatgggaattcaaacccatgacctt cgacttggaagaatactccaacccctagtaagcatcgtgttccctaagct tatacaattagggacactcccagttacttgaagacagttttagggtgcta ggccagacatcaccctgagaagatcatagaatgcacttatgtgctgtgag aagtgggggatacccaagagaaccagaggtagagcatgggggtggggggt attgtacctgatggttctcagagagtactccaacccacacctgactgatc acagacacaactgggccaataaatcatctgaattatgacattttcgtcta tagctcatttagaaattctcagctgtatttaaaaaacccagaggttctga agacactagtcaaaaatcacaccctctaactccctgaggcaagaggcatg gtttactgctgctgccaacattacagcctagagaaaacttttacaaaaac ctttttgtgggtctgaaaaggagggaatgtgagggacattgtaaacccca acatggggaataaaaagtggtctcctgctgccataggacagtagaccact caatcctttttaagggttcccatgttacaaatctgctgtatggaggtagc agctgaaggtcagacattctgtatggcttctggtaatttttaccagccac tgcctgtgaataagttcagctttctaaaaatagcttgtgccaggg
quality values	Open. Hide. 46 28 19 31 62 37 23 54 62 41 17 62 49 43 31 62 62 62 62 62 44 59 62 62 62 62 62 59 59 59 43 23 25 18 18 25 23 29 28 27 31 32 43 34 54 59 62 62 59 43 62 62 62 62 59 62 62 62 62 62 62 59 49 62 62 62 59 59 62 62 62 62 62 62 59 56 51 56 46 54 54 48 54 54 49 54 54 54 59 62 62 54 62 62 54 54 62 62 62 59 54 59 62 62 62 62 59 59 62 62 62 62 62 59 56 62 59 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 49 49 62 62 62 62 62 49 47 62 62 47 62 62 62 62 62 62 11 11 8 8 8 14 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 43 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 20 43 62 62 49 52 54 54 45 52 54 58 58 54 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 54 34 58 58 58 52 52 54 54 54 54 58 58 58 45 42 54 49 58 54 58 58 52 58 54 52 48 47 54 54 54 58 54 58 58 58 54 58 54 42 54 58 58 40 58 58 58 49 27 54 50 49 58 58 46 58 50 54 51 58 51 50 58 58 50 58 50 58 48 51 51 47 42 51 50 58 51 58 50 54 51 53 53 58 50 54 52 46 49 58 58 53 52 58 42 50 39 25 49 42 32 54 46 46 30 54 53 58 54 58 51 40 44 44 58 50 54 50 48 58 30 46 51 30 51 51 52 33 41 50 49 58 40 25 51 52 50 42 54 41 58 25 51 50 38 42 42 53 37 34 51 58 32 45 50 38 49 51 35 58 39 51 58 49 42 31 16 54 38 39 49 20 54 39 52 42 34 44 22 32 32 41 30 25 36 34 38 54 37 49 52 45 41 49 34 35 52 42 49 24 41 53 21 53 37 35 37 41 40 44 29 45 42 26 54 26 41 26 37 29 33 32 49 25 54 54 32 41 22 45 47 54 33 14 34 33 36 34 37 13 32 33 35 52 33 23 25 31 14 35 21 36 33 23 26 34 53 32 45 30 32 35 32 42 32 24 40 29 34 31 31 35 31 31 30 22 31 45 31 17 45 29 32 36 28 35 26 31 34 26 43 30 37 31 30 21 46 46 31 30 36 31 30 32 32 37 31 27 31 41 26 21 32 32 46 27 28 23 15 46 46 32 28 9 27 18 37 46 46 28 21 31 28 22 11 38 31 25 31 47 23 30 26 26 27 19 25 39 29 20 41 16 39 27 31 9 37 19 22 31 34 41 27 31 23 22 29 30 31 26 25 31 21 11 28 32 25 20 32 31 17 18 21 21 28 10 18 16 19 25 32 32 31 16 30 13 21 31 18 33 24 22 19 14 17 6 17 21 27 22 22 17 9 19 47 11 33 28 34 32 21 27 15 15 23 12 21 32 27 23 31 27 5 25 4 13 25 10 26 7 7 5 31 9 15 13 12 23 43 25 10 17 32 34 12 28 15 32 10 6 6 7 12 21 8 15 6 9 5 11 11 16 8 8 13 18 25 15 9 6 5 7 21 30 12 10 27 10 10 9 6 11 24 8 18 12 17 16 34 12 21 38 34 38 29 11 17 9 13 6 5 6 13 14 9 7 8 10 13 28 21 10 10 13 15 17 11 5 7 6 4 6 5 14 12 18 6 11 1 3 2 17 28 14 15 11 17 11 7 8 6 7 5 7 2 3 5 7 23 20 17 3 5 14 4 7 5 8 2 1 2 5 4 7 18 3 3 11 13 5 10 10 6 4 6 16 7 8 6 4 5 5 22 8 7 18 8 19 10 7 13 4 3 8 9 5 11 8 4 5 12 22 6 5 6 4 9 4 14 4 4 25 14 7 5 3 1 3 4 2 1 3 6 15 24 4 5 15 8 6 5 1 2 2 1 5 4 1 2 2 5 4 7 7 5 7 5 5 3 4 6 4 4 5 16 6 6 21 4	Open. Hide. 62 35 40 47 62 62 62 62 47 47 32 33 15 11 22 22 28 31 28 24 44 45 62 46 62 62 62 62 62 62 59 59 62 59 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 46 56 54 56 59 56 59 59 56 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 42 62 62 62 54 49 54 59 62 62 62 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 43 32 42 33 54 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 50 50 46 59 51 59 59 19 19 24 23 24 18 31 62 12 30 23 23 23 28 30 30 38 30 34 37 41 40 28 39 34 38 36 46 56 59 51 51 59 46 56 46 39 51 43 59 59 59 51 59 49 59 56 59 62 29 23 13 19 18 30 62 59 59 59 62 62 59 62 62 59 59 62 43 59 59 56 59 59 62 59 43 62 62 62 62 62 51 59 59 59 59 59 62 59 62 62 43 56 13 13 5 8 8 13 62 62 62 59 56 50 59 51 56 59 62 59 62 50 44 59 62 44 62 62 62 11 19 9 15 14 10 31 44 37 44 35 38 29 39 35 62 44 35 62 42 26 56 62 56 44 41 62 51 62 62 62 26 44 56 44 56 56 56 56 37 32 41 32 26 56 51 56 56 39 39 56 39 47 42 47 20 56 62 50 62 62 38 51 56 54 62 31 12 62 51 56 39 56 56 39 38 56 51 62 62 39 37 38 62 46 56 46 42 39 43 38 22 56 40 38 47 30 62 38 47 62 56 9 24 39 62 43 43 32 56 25 56 56 56 56 62 46 42 56 42 47 27 52 42 41 38 13 23 52 45 52 52 52 52 46 28 27 31 12 28 21 41 39 46 52 30 43 52 22 31 24 33 34 27 38 38 30 22 19 38 40 10 52 28 39 18 23 37 20 35 30 29 27 9 40 40 15 15 54 36 38 28 26 29 37 39 21 34 34 42 13 20 42 23 50 22 15 28 15 35 27 39 35 52 24 32 21 25 34 15 21 10 19 25 22 19 25 13 41 30 13 18 26 34 33 35 38 8 38 8 33 31 17 25 19 27 26 38 31 35 9 26 10 10 19 47 8 23 11 10 21 22 18 22 17 16 9 11 9 19 17 19 6 12 16 46 46 8 47 29 24 19 20 12 21 21 18 17 12 18 19 27 8 43 9 4 14 6 10 34 23 19 7 21 19 19 9 14 13 12 14 17 18 40 46 37 9 28 28 34 29 18 14 12 19 17 31 39 25 25 26 31 33 25 49 15 19 16 31 17 18 36 9 11 9 40 14 29 28 19 8 18 9 16 9 13 35 12 5 9 10 14 16 9 9 11 9 16 9 9 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_19708565_19709493
seq2: B6Ng01-252C21.g_70_1014 (reverse)

seq1  CACTGGCAC-AGCTATTTTT-GAAGGCTGAACTTATTCACAGGCAGT-GC  47
      | ||||||| |||||||||| ||| |||||||||||||||||||||| ||
seq2  CCCTGGCACAAGCTATTTTTAGAAAGCTGAACTTATTCACAGGCAGTGGC  50

seq1  TGGTAAAA--TACCAGAAGCCATACAGAATGTCTGACC-TCAGCTGCTAC  94
      ||||||||  |||||||||||||||||||||||||||| |||||||||||
seq2  TGGTAAAAATTACCAGAAGCCATACAGAATGTCTGACCTTCAGCTGCTAC  100

seq1  CT-CATACAGCAGATTTGT-ACATGGG-AGCCTTAAAAA-GATTGAGTGG  140
      || |||||||||||||||| ||||||| | ||||||||| ||||||||||
seq2  CTCCATACAGCAGATTTGTAACATGGGAACCCTTAAAAAGGATTGAGTGG  150

seq1  TCTACTGTCCTATGGCAGCAGGAGACCAC-TTTTATTTCCCATGTT-GGG  188
      ||||||||||||||||||||||||||||| ||||||| |||||||| |||
seq2  TCTACTGTCCTATGGCAGCAGGAGACCACTTTTTATTCCCCATGTTGGGG  200

seq1  TTTACAATGTCCCTCACATTCCCTCCTTTTCAGACCCAC-AAAAGGTTTT  237
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  TTTACAATGTCCCTCACATTCCCTCCTTTTCAGACCCACAAAAAGGTTTT  250

seq1  TGTAAA--GTTTCTCTAGGCTGTAATGTTGGCAGCAGCAGT-AACCATGC  284
      ||||||   |||||||||||||||||||||||||||||||| ||||||||
seq2  TGTAAAAGTTTTCTCTAGGCTGTAATGTTGGCAGCAGCAGTAAACCATGC  300

seq1  CTCTTGCCTCAGGGAGTTAGAGGGTGTGATTTTTGACTAGTGTCTTCAGA  334
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGCCTCAGGGAGTTAGAGGGTGTGATTTTTGACTAGTGTCTTCAGA  350

seq1  ACCTCTGGGTTTTTTAAATACAGCTGAGAATTTCTGAATGAGCTATAGAC  384
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  ACCTCTGGGTTTTTTAAATACAGCTGAGAATTTCTAAATGAGCTATAGAC  400

seq1  GAAAATGTCATAATTCAGATGATTTATTGGCCCAGTTGTGTCTGTGATCA  434
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATGTCATAATTCAGATGATTTATTGGCCCAGTTGTGTCTGTGATCA  450

seq1  GTCAGGTGTGGGTTGGAGTACTCTCTGAGAACCATCAGGTACAATACCCC  484
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGGTGTGGGTTGGAGTACTCTCTGAGAACCATCAGGTACAATACCCC  500

seq1  CCACCCCCATGCTCTACCTCTGGTTCTCTTGGGTATCCCCCACTTCTCAC  534
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCCCCATGCTCTACCTCTGGTTCTCTTGGGTATCCCCCACTTCTCAC  550

seq1  AGCACATAAGTGCATTCTATGATCTTCTCAGGGTGATGTCTGGCCTAGCA  584
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACATAAGTGCATTCTATGATCTTCTCAGGGTGATGTCTGGCCTAGCA  600

seq1  CCCTAAAACTGTCTTCAAGTAACTGGGAGTGTCCCTAATTGTATAAGCTT  634
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAAAACTGTCTTCAAGTAACTGGGAGTGTCCCTAATTGTATAAGCTT  650

seq1  AGGGAACACGATGCTTACTAGGGGTTGGAGTATTCTTCCAAGTCGAAGGT  684
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAACACGATGCTTACTAGGGGTTGGAGTATTCTTCCAAGTCGAAGGT  700

seq1  CATGGGTTTGAATTCCCATTCGGCTTGTACCATGGTCAACTCCCTATGCA  734
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGTTTGAATTCCCATTCGGCTTGTACCATGGTCAACTCCCTATGCA  750

seq1  AAATACCTGCCTTTACCCCTGCCTTCTTAAGGCTGTGAGAAAGCTCACAC  784
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACCTGCCTTTACCCCTGCCTTCTTAAGGCTGTGAGAAAGCTCACAC  800

seq1  ACAGAACATGGTCCCTATCATTGCATCCCCAACTGTCCCTACATCTTGTC  834
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAACATGGTCCCTATCATTGCATCCCCAACTGTCCCTACATCTTGTC  850

seq1  CCGCTAAAGTGCCCTGGAGGATTTCACTGTCTTGTTGGGGGCGAGCTACC  884
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCTAAAGTGCCCTGGAGGATTTCACTGTCTTGTTGGGGGCGAGCTACC  900

seq1  CACACTGTCCCACTGGCCCTTTCCTGAGGTTCTGGTGGGGAATTC  929
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACTGTCCCACTGGCCCTTTCCTGAGGTTCTGGTGGGGAATTC  945

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information