MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-339G18
Chromosome	12 (Build37)
Map Location	111,771,190 - 111,772,303
singlet/doublet	singlet
Overlap gene	Ppp2r5c
Upstream gene	Gtl2, Rtl1, 6430411K18Rik, B830012L14Rik, LOC100040715, LOC100040724, LOC675987, LOC100041509, LOC100040746, 3110009F21Rik, Dio3as, Dio3, EG629595, EG668245, LOC100040799
Downstream gene	9430024F10Rik, Dync1h1, 1700001K19Rik, Hsp90aa1, Wdr20a, Rage, 2810455K09Rik, LOC100041649, 2810452K22Rik, 4930573I19Rik, Ankrd9, 6030440G07Rik, Rcor1, 4930595D18Rik, Traf3, Amn, Cdc42bpb, A230065H16Rik, 1200009I06Rik, Tnfaip2, Gm266
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gtl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17263 MGI:1202886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs

name	Rtl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353326 MGI:2656842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430411K18Rik (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:76880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B830012L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320085 MGI:2443332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC675987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 467 ESTs, 10 Proteins pseudo : _no_value

name	LOC100040746 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040746
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	3110009F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67280 MGI:1914530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST

name	Dio3as (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353504 MGI:2664395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dio3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107585 MGI:1306782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629595 MGI:3647486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 799 ESTs, 5 Proteins

name	EG668245 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668245 MGI:3647644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 4 Proteins pseudo : _no_value

name	LOC100040799 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs

name	Ppp2r5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26931 MGI:1349475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	9430024F10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77271 MGI:1924521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Dync1h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13424 MGI:103147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700001K19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66323 MGI:1913573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 14 ESTs, 1 Protein

name	Hsp90aa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15519 MGI:96250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69641 MGI:1916891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rage (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26448 MGI:1347040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810455K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72805 MGI:1920055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein

name	LOC100041649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 367 ESTs, 3 Proteins

name	2810452K22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67236 MGI:1914486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930573I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104859 MGI:2144865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74251 MGI:1921501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030440G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77878 MGI:1925128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rcor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217864 MGI:106340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930595D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78062 MGI:1925312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Traf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22031 MGI:108041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Amn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93835 MGI:1934943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42bpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217866 MGI:2136459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230065H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380787 MGI:2685744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	1200009I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74190 MGI:1921363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfaip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21928 MGI:104960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm266 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212539 MGI:2685112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309584 GeneID:353326 MGI:2656842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retrotransposon-like 1 transcript_id : NM_184109.1

name	B830012L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263544 GeneID:320085 MGI:2443332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA B830012L14 gene transcript_id : XM_001476751.1

name	LOC100040715 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263518 GeneID:100040715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040715 transcript_id : XM_001475122.1

name	LOC100040724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263520 GeneID:100040724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100040724 transcript_id : XM_001475138.1

name	3110009F21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263547 GeneID:67280 MGI:1914530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST product : RIKEN cDNA 3110009F21 gene transcript_id : XM_001476790.1

name	Dio3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494233 GeneID:107585 MGI:1306782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deiodinase, iodothyronine type III transcript_id : NM_172119.2

name	EG629595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393139 GeneID:629595 MGI:3647486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 795 ESTs, 5 Proteins product : predicted gene, EG629595 transcript_id : XM_894495.2

name	LOC100040799 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263525 GeneID:100040799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs product : hypothetical protein LOC100040799 transcript_id : XM_001475293.1

name	Ppp2r5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346019 GeneID:26931 MGI:1349475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), gamma isoform transcript_id : NM_012023.2

name	Ppp2r5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346005 GeneID:26931 MGI:1349475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), gamma isoform transcript_id : NM_001081457.1

name	Ppp2r5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346153 GeneID:26931 MGI:1349475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), gamma isoform transcript_id : NM_001081458.1

name	9430024F10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263527 GeneID:77271 MGI:1924521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 9430024F10 gene transcript_id : XM_001475368.1

name	Dync1h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288916 GeneID:13424 MGI:103147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein cytoplasmic 1 heavy chain 1 transcript_id : NM_030238.2

name	1700001K19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393092 GeneID:66323 MGI:1913573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 14 ESTs, 1 Protein product : RIKEN cDNA 1700001K19 gene, transcript variant 1 transcript_id : XM_286464.5

name	Hsp90aa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802299 GeneID:15519 MGI:96250
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 90kDa alpha (cytosolic), class A member 1 transcript_id : NM_010480.4

name	Wdr20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742803 GeneID:69641 MGI:1916891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 20a transcript_id : NM_027149.2

name	Rage (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129968 GeneID:26448 MGI:1347040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : renal tumor antigen transcript_id : NM_011973.2

name	2810455K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263529 GeneID:72805 MGI:1920055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein product : RIKEN cDNA 2810455K09 gene transcript_id : XM_138271.7

name	LOC100041649 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263551 GeneID:100041649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 251 ESTs, 3 Proteins product : similar to brain protein 44-like protein, transcript variant 2 transcript_id : XM_001477002.1

name	LOC100041649 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263549 GeneID:100041649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 366 ESTs, 3 Proteins product : similar to brain protein 44-like protein, transcript variant 1 transcript_id : XM_001476987.1

name	2810452K22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344970 GeneID:67236 MGI:1914486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810452K22 gene transcript_id : NM_026048.3

name	4930573I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486689 GeneID:104859 MGI:2144865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930573I19 gene transcript_id : NM_001081057.1

name	Ankrd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802286 GeneID:74251 MGI:1921501
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 9 transcript_id : NM_175207.4

name	6030440G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393143 GeneID:77878 MGI:1925128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 6030440G07 gene transcript_id : XM_901637.2

name	Rcor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130783 GeneID:217864 MGI:106340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REST corepressor 1 transcript_id : NM_198023.2

name	4930595D18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263553 GeneID:78062 MGI:1925312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930595D18 gene transcript_id : XM_001477231.1

name	Traf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842404 GeneID:22031 MGI:108041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 3 transcript_id : NM_011632.2

name	Traf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842402 GeneID:22031 MGI:108041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 3 transcript_id : NM_001048206.1

name	Amn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077082 GeneID:93835 MGI:1934943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amnionless transcript_id : NM_033603.2

name	Cdc42bpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942080 GeneID:217866 MGI:2136459
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc42 binding protein kinase beta transcript_id : NM_183016.1

name	A230065H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393146 GeneID:380787 MGI:2685744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA A230065H16 gene transcript_id : XM_354697.3

name	1200009I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054027 GeneID:74190 MGI:1921363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200009I06 gene transcript_id : NM_028807.2

name	Tnfaip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678374 GeneID:21928 MGI:104960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor, alpha-induced protein 2 transcript_id : NM_009396.1

name	Gm266 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801866 GeneID:212539 MGI:2685112
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 266, (NCBI) transcript_id : NM_001033248.2

name	Rtl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309585 CCDS:CCDS26170.1 GeneID:353326 MGI:2656842
definition	codon_start : 1 product : retrotransposon-like 1 protein_id : NP_908998.1

name	B830012L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263545 GeneID:320085 MGI:2443332
definition	codon_start : 1 product : hypothetical protein LOC320085 protein_id : XP_001476801.1

name	LOC100040715 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263519 GeneID:100040715
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475172.1

name	LOC100040724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263521 GeneID:100040724
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475188.1

name	3110009F21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263548 GeneID:67280 MGI:1914530
definition	codon_start : 1 product : hypothetical protein LOC67280 protein_id : XP_001476840.1

name	Dio3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006467 CCDS:CCDS26171.1 GeneID:107585 MGI:1306782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004800 - thyroxine 5'-deiodinase activity [Evidence IMP] GO_process : GO:0042446 - hormone biosynthesis [Evidence IEA]; GO:0040018 - positive regulation of body size [Evidence IMP]; GO:0042404 - thyroid hormone catabolism [Evidence IMP] codon_start : 1 product : deiodinase, iodothyronine type III protein_id : NP_742117.1 transl_except : (pos:111517949..111517951,aa:Sec)

name	EG629595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943174 GeneID:629595 MGI:3647486
definition	codon_start : 1 product : similar to hCG1640785 protein_id : XP_899588.1

name	LOC100040799 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263526 GeneID:100040799
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475343.1

name	Ppp2r5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346020 GeneID:26931 MGI:1349475
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Band 8A product : gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform a protein_id : NP_036153.2

name	Ppp2r5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346006 GeneID:26931 MGI:1349475
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Band 8A product : gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform b protein_id : NP_001074926.1

name	Ppp2r5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346154 GeneID:26931 MGI:1349475
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; Band 8A product : gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform c protein_id : NP_001074927.1

name	9430024F10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263528 GeneID:77271 MGI:1924521
definition	codon_start : 1 product : hypothetical protein LOC77271 protein_id : XP_001475418.1

name	Dync1h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288917 GeneID:13424 MGI:103147
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 note : dynein heavy chain, retrograde transport; legs at odd angle; cytoplasmic dynein heavy chain; region surrounding P-loop 1 product : dynein, cytoplasmic, heavy chain 1 protein_id : NP_084514.2

name	1700001K19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28522500 GeneID:66323 MGI:1913573
definition	codon_start : 1 product : hypothetical protein LOC66323 isoform 1 protein_id : XP_286464.1

name	Hsp90aa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754254 CCDS:CCDS26172.1 GeneID:15519 MGI:96250
definition	GO_component : GO:0005829 - cytosol [Evidence TAS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0030235 - nitric-oxide synthase regulator activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0030911 - TPR domain binding [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence TAS] [Evidence IEA] GO_process : GO:0006809 - nitric oxide biosynthesis [Evidence TAS]; GO:0045585 - positive regulation of cytotoxic T cell differentiation [Evidence TAS]; GO:0045429 - positive regulation of nitric oxide biosynthesis [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0042026 - protein refolding [Evidence TAS]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence TAS] [Evidence IEA] codon_start : 1 note : heat shock protein, 86 kDa 1; heat shock protein, 89 kDa; heat shock protein, 1 product : heat shock protein 1, alpha protein_id : NP_034610.1

name	Wdr20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742804 CCDS:CCDS26173.1 GeneID:69641 MGI:1916891
definition	codon_start : 1 product : WD repeat domain 20 protein_id : NP_081425.2

name	Rage (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106391 GeneID:26448 MGI:1347040
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : MOK protein kinase; MAPK/MAK/MRK/ overlapping kinase product : MAPK/MAK/MRK overlapping kinase protein_id : NP_036103.1

name	2810455K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263530 GeneID:72805 MGI:1920055
definition	codon_start : 1 product : hypothetical protein LOC72805 protein_id : XP_138271.6

name	LOC100041649 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263550 GeneID:100041649
definition	codon_start : 1 product : similar to brain protein 44-like protein isoform 1 protein_id : XP_001477037.1

name	LOC100041649 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263552 GeneID:100041649
definition	codon_start : 1 product : similar to brain protein 44-like protein isoform 2 protein_id : XP_001477052.1

name	2810452K22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361248 GeneID:67236 MGI:1914486
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 2-interacting protein protein_id : NP_080324.1

name	4930573I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486690 GeneID:104859 MGI:2144865
definition	codon_start : 1 product : hypothetical protein LOC104859 protein_id : NP_001074526.1

name	Ankrd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75991698 CCDS:CCDS26174.1 GeneID:74251 MGI:1921501
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : ankyrin repeat domain 9 protein_id : NP_780416.2

name	6030440G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943186 GeneID:77878 MGI:1925128
definition	codon_start : 1 product : hypothetical protein LOC77878 protein_id : XP_906730.1

name	Rcor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930559 GeneID:217864 MGI:106340
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : REST corepressor 1 protein_id : NP_932140.1

name	4930595D18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263554 GeneID:78062 MGI:1925312
definition	codon_start : 1 product : hypothetical protein LOC78062 protein_id : XP_001477281.1

name	Traf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842405 CCDS:CCDS26175.1 GeneID:22031 MGI:108041
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : Tnf receptor-associated factor 3 isoform a protein_id : NP_035762.2

name	Traf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842403 GeneID:22031 MGI:108041
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : Tnf receptor-associated factor 3 isoform b protein_id : NP_001041671.1

name	Amn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077083 GeneID:93835 MGI:1934943
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007588 - excretion [Evidence IMP]; GO:0008104 - protein localization [Evidence IMP] codon_start : 1 note : type I transmembrane protein product : amnionless protein_id : NP_291081.2

name	Cdc42bpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942081 CCDS:CCDS26176.1 GeneID:217866 MGI:2136459
definition	GO_component : GO:0005911 - intercellular junction [Evidence ISS]; GO:0031252 - leading edge [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031532 - actin cytoskeleton reorganization [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Cdc42 binding protein kinase beta protein_id : NP_898837.1

name	A230065H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38073748 GeneID:380787 MGI:2685744
definition	codon_start : 1 product : hypothetical protein protein_id : XP_354697.1

name	1200009I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054028 CCDS:CCDS26177.1 GeneID:74190 MGI:1921363
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74190 protein_id : NP_083083.2

name	Tnfaip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678375 CCDS:CCDS26178.1 GeneID:21928 MGI:104960
definition	GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : tumor necrosis factor induced protein 2 product : tumor necrosis factor, alpha-induced protein 2 protein_id : NP_033422.1

name	Gm266 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677504 CCDS:CCDS26179.1 GeneID:212539 MGI:2685112
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC212539 protein_id : NP_001028420.1

name	LOC675987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675987
definition	number : 1 pseudo : _no_value

name	LOC675987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675987
definition	number : 2 pseudo : _no_value

name	LOC675987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675987
definition	number : 3 pseudo : _no_value

name	LOC100040746 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040746
definition	number : 1 pseudo : _no_value

name	LOC100040746 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040746
definition	number : 2 pseudo : _no_value

name	LOC100040746 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040746
definition	number : 3 pseudo : _no_value

name	Gtl2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263543 GeneID:17263 MGI:1202886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs product : GTL2, imprinted maternally expressed untranslated mRNA transcript_id : XR_035483.1

name	6430411K18Rik (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:84872140 GeneID:76880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430411K18 gene transcript_id : NR_002848.1

name	LOC100041509 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263546 GeneID:100041509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 467 ESTs, 10 Proteins product : similar to QM protein pseudo : _no_value transcript_id : XR_032910.1

name	Dio3as (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872161 GeneID:353504 MGI:2664395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deiodinase, iodothyronine type III, antisense transcript_id : NR_002866.1

name	EG668245 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263523 GeneID:668245 MGI:3647644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 4 Proteins product : predicted gene, EG668245 pseudo : _no_value transcript_id : XR_002158.2

clone name	MSMg01-321C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-104F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-308I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-434P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-339G18.b	B6Ng01-339G18.g
ACC	GA123422	GA123423
length	751	1,119
definition	B6Ng01-339G18.b	B6Ng01-339G18.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaaatgaggaaactcaaatggccgagaaccacctaaagaaatg ttcaacatccttagtcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacacccgtcagaatggctaagatcaaaaattcaggtgacagc agatgctggtgaggatgtggagaaagaggaacactcctccattgctggtg ggattgcaagctggtacaaccactctggaaatcagtctggcggttcctca aaaaattggacatagtactacctgaagactaagctataccactcctgggc atatatccagtactaccggaggatccagcaatacctctcctgggcatata tccagaagatgctccaacatgtagtaaggacacaggctccactatgttca tagcagccatatttataatagccaaaagctggaaacagcccagatgtccc tcaacagaggaatggatacagaaaatgtggtacatttacacaatggagta ctcagctattaagaataatggcttcatgaaatttgcaggcaagtggatgg atctagaaaatatccatcctgagtgagataactcagtaacaaaagaacac acagggtatgtactcactgataagtggatattaggcagagtgtggaatac ccacgatacaactcacggaccacatgaagctcaagaggaaggaagaccaa agagtggatgcttcagtcttactgaagggaagggaagggaagggaaggga a	gaattcccaaggtcacactatgcaaaggcaggtatagctaaccgctgggc ctgtcttcctctaggtttatttttagagcctacttaaataagtaaccaac aactcagcctctgttagatgagtgacacttcactgtgtttcatgactcac tttctgtctgctattttgattttattcttacgaatttacttctatgccac agatagaaaacagcacttcataccgtgtgtttttaatatcccagtcacct aatctaaccaactctccatgaaataagtcttgcagtttaatgtcctactg caaaaagcaacactcacattaaaccaagtcacaaaaaacacctgagttca aggtatcaaagactgggaatgaaaattagaaacaaggagtttgagggttg gctcagtggttaagagcacttgttcttacaaaggacccaggttcaactcc cagcacccacatggaagctcaagagaataaagagtgtctaagagaatagc ttcatactgagcatgggatatggggcagagagaaagctgtccctgagagt ctgtggatcaagtctgggctatcctcggatgtccaacactctcctttgag cacacagtacaatagtgactggggcatctgcacctagaactggacagtag cctctctctctgcacatctcaaatcaaatcaaaccacatcttgttcctac cctaacaccacccacacctgcccatttctctcagctgtcccagctaagta gcttactccactacctatctgtcatgctggggcatgtctgtcagccagcc tgtcccacggcaacccccacccaccatggcaaagctcttcctacatgttc tcagcaggcagccagagtgaaggggcagtgtgcactctctcacaaccatt aggtttccagggtcaggactctagccacactccacccaaacctaagtctt tttgctcctggggtccttgggagcacggccctgccgggcaccacctgccc ccactctctgacttctgggcgatcagctcatcctcctagaacaagtaaca gtgtcagctggcctgtgccagcttctcagctctgactgctgctactaact gtctgcccttgtcttcaga
quality values	Open. Hide. 58 22 33 39 58 54 58 41 31 58 62 62 62 62 62 62 47 62 56 47 62 47 56 62 62 62 62 62 62 62 62 54 39 47 51 44 62 47 62 62 59 62 62 62 62 59 62 59 59 62 62 62 59 59 62 62 62 62 62 62 49 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 54 62 62 62 59 59 59 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 54 49 49 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 59 62 47 62 62 62 62 56 62 62 56 62 56 62 62 62 62 62 56 49 56 62 62 62 62 62 62 62 62 56 62 62 62 51 56 62 62 62 47 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 62 56 56 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 46 34 46 56 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 54 62 62 56 56 56 56 56 56 56 56 62 56 56 54 33 62 62 62 62 62 62 54 62 52 62 52 52 62 62 62 62 62 62 62 62 62 52 62 62 54 62 62 62 62 62 52 62 52 54 62 62 62 62 49 52 48 45 54 54 52 42 54 54 54 58 58 58 58 54 58 54 58 58 49 43 47 43 52 54 54 54 54 58 58 58 58 58 54 58 58 58 54 52 52 58 58 52 58 54 58 58 58 58 49 58 58 54 58 52 58 54 58 58 41 36 39 49 51 54 51 44 50 52 50 50 50 51 58 50 58 58 58 49 45 40 52 53 51 52 50 48 50 50 51 50 51 50 52 58 58 42 51 50 50 52 52 50 43 43 41 58 58 51 51 51 52 50 43 50 53 52 50 50 53 51 58 51 58 51 52 58 58 58 51 50 42 51 49 50 51 58 51 51 50 58 39 58 58 58 58 58 58 50 49 40 44 44 46 50 53 41 38 41 33 42 31 35 50 47 45 44 44 47 50 44 39 42 41 52 42 52 54 51 51 40 52 53 40 52 46 50 51 14 47 53 53 29 32 35 52 40 46 21 44 36 36 54 40 42 36 40 44 39 27 33 39 25 29 40 32 42 32 41 41 46 53 38 33 44 41 40 53 32 54 25 33 28 25 49 47 33 33 32 49 32 32 40 15 49 19 40 28 13 33 24 17 9	Open. Hide. 62 47 42 41 62 56 56 44 47 62 62 62 44 59 56 59 59 44 44 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 59 62 62 62 62 62 62 59 59 49 54 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 59 59 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 54 42 62 59 54 54 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 59 59 59 62 62 54 43 54 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 50 56 56 56 56 56 62 62 62 56 56 62 56 56 47 56 62 62 62 54 62 62 62 54 52 62 62 62 49 43 47 31 52 52 46 43 54 46 48 52 52 62 44 52 54 62 62 62 62 62 62 62 58 58 58 58 58 43 49 44 58 44 54 58 58 58 58 58 58 58 58 52 52 45 49 52 41 54 42 58 58 54 54 42 52 54 54 58 50 52 52 44 52 54 58 52 54 52 54 58 58 58 37 42 54 54 58 58 58 58 58 58 49 58 39 58 53 58 54 52 52 43 47 48 50 50 47 50 51 49 45 23 58 49 50 50 58 58 54 58 58 49 53 52 50 54 54 58 47 49 58 58 49 51 49 50 51 48 48 50 52 51 58 58 46 58 49 37 41 41 50 50 50 50 50 46 52 52 52 52 52 58 49 51 40 49 38 37 52 51 46 46 46 49 52 53 52 53 54 50 49 58 44 30 43 58 40 35 42 40 52 50 50 53 46 49 29 24 43 38 43 35 54 58 32 49 58 43 41 35 51 51 41 52 25 50 50 49 40 39 39 48 39 54 52 50 50 50 35 41 41 51 49 54 42 49 51 53 39 35 26 54 44 52 35 27 27 46 37 50 49 41 40 53 45 53 38 54 54 32 42 47 40 37 44 44 47 47 46 42 34 25 28 34 34 39 33 44 47 53 52 51 46 37 51 46 46 44 32 51 54 46 40 46 32 53 32 32 31 34 45 47 41 35 52 33 32 31 40 21 24 52 33 52 41 29 37 46 31 40 30 37 31 32 29 32 34 32 35 41 33 38 43 31 43 46 30 31 33 31 36 31 43 31 51 51 45 28 31 31 31 31 31 31 42 31 35 42 31 46 30 33 31 31 45 31 35 26 31 46 29 31 30 11 46 25 18 21 21 31 30 32 29 22 18 29 31 29 18 22 25 31 42 37 18 29 46 26 19 28 31 23 32 31 31 37 34 25 19 17 30 27 14 18 26 23 23 32 30 29 14 6 18 20 31 19 7 26 20 31 35 16 26 26 31 21 27 39 36 27 26 32 33 24 31 20 18 16 24 28 27 31 31 19 29 27 11 8 18 13 5 8 13 16 25 30 21 31 29 48 33 14 30 26 31 41 28 16 29 21 11 12 10 10 21 19 32 23 16 29 19 8 14 19 32 29 19 27 8 12 31 23 10 32 16 10 8 23 27 34 15 21 6 12 43 48 39 27 15 16 9 7 33 21 22 39 31 31 6 7 9 14 22 6 28 8 18 5 13 20 10 6 13 3 14 11 6 11 10 14 10 30 15 12 16 16 7 7 6 12 6 11 8 13 23 27 6 6 12 17 11 9 9 9 8 12 9 11 6 5 15 15 15 5 11 7 3 8 20 9 4 9 22 17 20 17 15 8 13 10 10 6 14 7 10 4 4 7 5 5 12 22 9 10 12 15 8 3 2 3 6 3 2 4 7 6 16 11 10 8 5 14 5 7 17 9 16 6 6 4 6 4 20 8 11 6 4 18 12 13 7 10 17 14 6 15 21 4 8 16 12 6 11 15 8 10 4 2 2 3 1 1 1 4 7 6 2 4 1 3 5 7 4 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_111771190_111772303
seq2: B6Ng01-339G18.g_68_1186 (reverse)

seq1  TCTGAGGGACAAGACCAGACAG-TAGTAGCAGCAGTCAGAGCTGAG-AGC  48
      |||||  ||||||  ||||||| ||||||||||||||||||||||| |||
seq2  TCTGA-AGACAAGGGCAGACAGTTAGTAGCAGCAGTCAGAGCTGAGAAGC  49

seq1  T-GCACAGGCAGCCTGACCACTGTTACT--GTCTA-GAGGATGAGCTGAT  94
      | ||||||||   |||| ||||||||||   |||| ||||||||||||||
seq2  TGGCACAGGCCAGCTGA-CACTGTTACTTGTTCTAGGAGGATGAGCTGAT  98

seq1  CCGCCCAG-AGTCAGAGAGTGGGGCAGGGTGGTGCCCGGCAGGGGCCGTG  143
       ||||||| |||||||||||||||   |||||||||||||| ||||||||
seq2  -CGCCCAGAAGTCAGAGAGTGGGGGCAGGTGGTGCCCGGCA-GGGCCGTG  146

seq1  CT-CCAAGGACCCCAGGAGCAAAAAGACTTAGG-TTGGGTGGAGTGTGGC  191
      || |||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CTCCCAAGGACCCCAGGAGCAAAAAGACTTAGGTTTGGGTGGAGTGTGGC  196

seq1  TAGAGTCCTGACCCTGGAAACCTAATGGTTGTGAGAGAGTGCACACTGCC  241
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTCCTGACCCTGGAAACCTAATGGTTGTGAGAGAGTGCACACTGCC  246

seq1  CCTTCACTCTGGCTGCCTGCTGAGAACATGTAGGAAGAGCTTTGCCATGG  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCACTCTGGCTGCCTGCTGAGAACATGTAGGAAGAGCTTTGCCATGG  296

seq1  TGGGTGGGGGTTGCCGTGGGACAGGCTGGCTGACAGACATGCCCCAGCAT  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTGGGGGTTGCCGTGGGACAGGCTGGCTGACAGACATGCCCCAGCAT  346

seq1  GACAGATAGGTAGTGGAGTAAGCTACTTAGCTGGGACAGCTGAGAGAAAT  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGATAGGTAGTGGAGTAAGCTACTTAGCTGGGACAGCTGAGAGAAAT  396

seq1  GGGCAGGTGTGGGTGGTGTTAGGGTAGGAACAAGATGTGGTTTGATTTGA  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGGTGTGGGTGGTGTTAGGGTAGGAACAAGATGTGGTTTGATTTGA  446

seq1  TTTGAGATGTGCAGAGAGAGAGGCTACTGTCCAGTTCTAGGTGCAGATGC  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAGATGTGCAGAGAGAGAGGCTACTGTCCAGTTCTAGGTGCAGATGC  496

seq1  CCCAGTCACTATTGTACTGTGTGCTCAAAGGAGAGTGTTGGACATCCGAG  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGTCACTATTGTACTGTGTGCTCAAAGGAGAGTGTTGGACATCCGAG  546

seq1  GATAGCCCAGACTTGATCCACAGACTCTCAGGGACAGCTTTCTCTCTGCC  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGCCCAGACTTGATCCACAGACTCTCAGGGACAGCTTTCTCTCTGCC  596

seq1  CCATATCCCATGCTCAGTATGAAGCTATTCTCTTAGACACTCTTTATTCT  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATATCCCATGCTCAGTATGAAGCTATTCTCTTAGACACTCTTTATTCT  646

seq1  CTTGAGCTTCCATGTGGGTGCTGGGAGTTGAACCTGGGTCCTTTGTAAGA  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAGCTTCCATGTGGGTGCTGGGAGTTGAACCTGGGTCCTTTGTAAGA  696

seq1  ACAAGTGCTCTTAACCACTGAGCCAACCCTCAAACTCCTTGTTTCTAATT  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTGCTCTTAACCACTGAGCCAACCCTCAAACTCCTTGTTTCTAATT  746

seq1  TTCATTCCCAGTCTTTGATACCTTGAACTCAGGTGTTTTTTGTGACTTGG  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATTCCCAGTCTTTGATACCTTGAACTCAGGTGTTTTTTGTGACTTGG  796

seq1  TTTAATGTGAGTGTTGCTTTTTGCAGTAGGACATTAAACTGCAAGACTTA  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATGTGAGTGTTGCTTTTTGCAGTAGGACATTAAACTGCAAGACTTA  846

seq1  TTTCATGGAGAGTTGGTTAGATTAGGTGACTGGGATATTAAAAACACACG  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATGGAGAGTTGGTTAGATTAGGTGACTGGGATATTAAAAACACACG  896

seq1  GTATGAAGTGCTGTTTTCTATCTGTGGCATAGAAGTAAATTCGTAAGAAT  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGAAGTGCTGTTTTCTATCTGTGGCATAGAAGTAAATTCGTAAGAAT  946

seq1  AAAATCAAAATAGCAGACAGAAAGTGAGTCATGAAACACAGTGAAGTGTC  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCAAAATAGCAGACAGAAAGTGAGTCATGAAACACAGTGAAGTGTC  996

seq1  ACTCATCTAACAGAGGCTGAGTTGTTGGTTACTTATTTAAGTAGGCTCTA  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATCTAACAGAGGCTGAGTTGTTGGTTACTTATTTAAGTAGGCTCTA  1046

seq1  AAAATAAACCTAGAGGAAGACAGGCCCAGCGGTTAGCTATACCTGCCTTT  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAAACCTAGAGGAAGACAGGCCCAGCGGTTAGCTATACCTGCCTTT  1096

seq1  GCATAGTGTGACCTTGGGAATTC  1114
      |||||||||||||||||||||||
seq2  GCATAGTGTGACCTTGGGAATTC  1119

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information