MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-073M19
Chromosome	12 (Build37)
Map Location	115,536,383 - 115,536,672
singlet/doublet	singlet
Overlap gene	Igh
Upstream gene	Igh-3, Ighg1, AI324046, LOC668370, LOC668375, EG382645, Igh-5, Igh-6, Ighj4, Ighj3, Ighj2, Ighj1, Ighd4-1, Ighd3-2, Ighd5-6, Ighd2-8, Ighd5-5, Ighd2-7, Ighd5-8, Ighd5-4, Ighd2-6, Ighd5-7, Ighd5-3, Ighd2-5, Ighd5-2, Ighd2-4, Ighd6-2, Ighd2-3, Ighd6-1, Ighd1-1, 4930523C11Rik, Ighd3-1, Ighd5-1, Adam6, Ighv5-1, Ighv2-1, Ighv5-2, Ighv2-2, Ighv5-3, Ighv5-4, Ighv6-1, Ighv2-3, Ighv5-5, Ighv5-6, Ankrd12-like, Ighv5-7, EG668389, Ighv5-8, Ighv5-9, Ighv5-10, Ighv2-5, Ighv5-11, Ighv5-12, Ighv2-6, Ighv5-9-1, EG628098, Ighv2-9-1, Ighv5-13, Ighv2-6-8, EG629785, Ighv2-7, LOC668405, Ighv5-15, Ighv5-16, Ighv5-17, Ighv5-18, Ighv2-8, Ighv2-9, Ighv5-19, Ighv7-1, Ighv7-2, Ighv14-1, Ighv4-1, Ighv3-1, Ighv11-1, Ighv14-2, Ighv4-2, Ighv3-2, Ighv11-2, Ighv14-3, EG629812, Ighv6-2, Ighv9-1, Ighv12-1, EG629818, Ighv12-2, Ighv9-3, Ighv7-3, Ighv15-1, Ighv14-4, EG668438, Ighv7-4, EG629833, EG633457, Ighv13-1, Ighv3-6
Downstream gene	EG636260, Ighv3-7, Ighv5-21, Ighv3-8, Ighv8-1, Ighv1-1, Ighv13-2, EG435321, Ighv6-3, EG628398, EG639510, Ighv6-6, EG432701, EG629849, Ighv1-2, Ighv10-1, Ighv1-3, Ighv1-4, Ighv10-2, EG668469, EG380809, Ighv1-6, EG668474, Ighv10-4, Ighv1-8, Ighv15-2, Ighv1-9, Ighv1-10, Ighv1-11, EG629860, Ighv1-13, Ighv1-14, Ighv1-15, EG629866, Ighv1-17-1, Ighv1-17, Ighv1-18, EG668493, Ighv1-19, EG668497, Ighv1-21-1, Ighv1-21, Ighv1-22, Ighv1-23, Ighv1-24, Ighv1-25, Ighv1-26, Ighv1-27, Ighv1-28, Ighv1-29, Ighv1-30, Ighv1-31, Ighv1-32, Ighv1-33, Ighv1-34, EG668515, Ighv1-36, Ighv1-37, Ighv1-38, Ighv1-39, Ighv1-40, Ighv1-41, EG629906, EG629908, Ighv1-44, Ighv1-45, Ighv1-46, Ighv1-47, Ighv8-3, EG629919, Ighv1-48, Ighv1-49, EG640506, Ighv1-50, Ighv1-51, Ighv1-52, Ighv1-53, EG629930, EG668534, EG211331, Ighv1-55, EG634662, Ighv1-56, EG629936, Ighv8-7, Ighv1-57, Ighv8-8
Link	Open Mouse BAC browser

Click to get alignment info.

name	Igh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111507 MGI:96442
definition	gene_synonym : MGC118122; MGC118132; MGC19003; MGC25748; MGC6342; MGC68311; MGC91096 note : immunoglobulin heavy chain complex

name	Igh-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16016 IMGT/GENE-DB:IGHG2B MGI:96445
definition	gene_synonym : gamma2b; IgG2b; IGHG2B note : immunoglobulin heavy chain 3 (serum IgG2b)

name	Ighg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16017 IMGT/GENE-DB:IGHG1 MGI:96446
definition	gene_synonym : IgG1; Igh-4; VH7183 note : immunoglobulin heavy constant gamma 1 (G1m marker)

name	AI324046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380795 IMGT/GENE-DB:IGHG3 MGI:2144790
definition	gene_synonym : IgG3; IGHG3; MGC68300 note : expressed sequence AI324046

name	LOC668370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668370
definition	note : FUS interacting protein (serine-arginine rich) 1 pseudogene pseudo : _no_value

name	LOC668375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668375
definition	note : transducin-like enhancer of split 6 pseudogene pseudo : _no_value

name	EG382645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382645 MGI:3647068
definition	note : predicted gene, EG382645 pseudo : _no_value

name	Igh-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380797 IMGT/GENE-DB:IGHD MGI:96447
definition	gene_synonym : IgD; IGHD note : immunoglobulin heavy chain 5 (delta-like heavy chain)

name	Igh-6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16019 IMGT/GENE-DB:IGHM MGI:96448
definition	gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH note : immunoglobulin heavy chain 6 (heavy chain of IgM)

name	Ighj4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777656 IMGT/GENE-DB:IGHJ4
definition	note : immunoglobulin heavy joining 4

name	Ighj3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777655 IMGT/GENE-DB:IGHJ3
definition	note : immunoglobulin heavy joining 3

name	Ighj2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777654 IMGT/GENE-DB:IGHJ2
definition	note : immunoglobulin heavy joining 2

name	Ighj1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777648 IMGT/GENE-DB:IGHJ1
definition	note : immunoglobulin heavy joining 1

name	Ighd4-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777661 IMGT/GENE-DB:IGHD4-1
definition	note : immunoglobulin heavy diversity 4-1

name	Ighd3-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777662 IMGT/GENE-DB:IGHD3-2
definition	note : immunoglobulin heavy diversity 3-2

name	Ighd5-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777663 IMGT/GENE-DB:IGHD5-6
definition	note : immunoglobulin heavy diversity 5-6 pseudo : _no_value

name	Ighd2-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777664 IMGT/GENE-DB:IGHD2-8
definition	note : immunoglobulin heavy diversity 2-8

name	Ighd5-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777665 IMGT/GENE-DB:IGHD5-5
definition	note : immunoglobulin heavy diversity 5-5 pseudo : _no_value

name	Ighd2-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777667 IMGT/GENE-DB:IGHD2-7
definition	note : immunoglobulin heavy diversity 2-7

name	Ighd5-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777669 IMGT/GENE-DB:IGHD5-8
definition	note : immunoglobulin heavy diversity 5-8 pseudo : _no_value

name	Ighd5-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777670 IMGT/GENE-DB:IGHD5-4
definition	note : immunoglobulin heavy diversity 5-4 pseudo : _no_value

name	Ighd2-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777672 IMGT/GENE-DB:IGHD2-6
definition	note : immunoglobulin heavy diversity 2-6

name	Ighd5-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777673 IMGT/GENE-DB:IGHD5-7
definition	note : immunoglobulin heavy diversity 5-7 pseudo : _no_value

name	Ighd5-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777674 IMGT/GENE-DB:IGHD5-3
definition	note : immunoglobulin heavy diversity 5-3 pseudo : _no_value

name	Ighd2-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777675 IMGT/GENE-DB:IGHD2-5
definition	note : immunoglobulin heavy diversity 2-5

name	Ighd5-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777676 IMGT/GENE-DB:IGHD5-2
definition	note : immunoglobulin heavy diversity 5-2 pseudo : _no_value

name	Ighd2-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777677 IMGT/GENE-DB:IGHD2-4
definition	note : immunoglobulin heavy diversity 2-4

name	Ighd6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777678 IMGT/GENE-DB:IGHD6-2
definition	note : immunoglobulin heavy diversity 6-2 pseudo : _no_value

name	Ighd2-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777679 IMGT/GENE-DB:IGHD2-3
definition	note : immunoglobulin heavy diversity 2-3

name	Ighd6-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777680 IMGT/GENE-DB:IGHD6-1
definition	note : immunoglobulin heavy diversity 6-1 pseudo : _no_value

name	Ighd1-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777657 IMGT/GENE-DB:IGHD1-1
definition	note : immunoglobulin heavy diversity 1-1

name	4930523C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238405 MGI:2444636
definition	gene_synonym : ADAM6b note : RIKEN cDNA 4930523C11 gene

name	Ighd3-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777681 IMGT/GENE-DB:IGHD3-1
definition	note : immunoglobulin heavy diversity 3-1

name	Ighd5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777682 IMGT/GENE-DB:IGHD5-1
definition	note : immunoglobulin heavy diversity 5-1 pseudo : _no_value

name	Adam6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238406 MGI:2676316
definition	gene_synonym : tMDCIV note : a disintegrin and metallopeptidase domain 6

name	Ighv5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777683 IMGT/GENE-DB:IGHV5-1
definition	note : immunoglobulin heavy variable V5-1 pseudo : _no_value

name	Ighv2-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777684 IMGT/GENE-DB:IGKV2-1
definition	note : immunoglobulin heavy variable V2-1 pseudo : _no_value

name	Ighv5-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777685 IMGT/GENE-DB:IGHV5-2
definition	note : immunoglobulin heavy variable V5-2

name	Ighv2-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777686 IMGT/GENE-DB:IGHV2-2
definition	note : immunoglobulin heavy variable V2-2

name	Ighv5-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777687 IMGT/GENE-DB:IGHV5-3
definition	note : immunoglobulin heavy variable V5-3 pseudo : _no_value

name	Ighv5-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777688 IMGT/GENE-DB:IGHV5-4
definition	note : immunoglobulin heavy variable V5-4

name	Ighv6-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777689 IMGT/GENE-DB:IGHV6-1
definition	note : immunoglobulin heavy variable V6-1 pseudo : _no_value

name	Ighv2-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238412 IMGT/GENE-DB:IGHV2-3
definition	note : immunoglobulin heavy variable V2-3

name	Ighv5-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777779 IMGT/GENE-DB:IGHV5-5
definition	note : immunoglobulin heavy variable V5-5 pseudo : _no_value

name	Ighv5-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777780 IMGT/GENE-DB:IGHV5-6
definition	note : immunoglobulin heavy variable V5-6

name	Ankrd12-like (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:67107
definition	gene_synonym : Ankrd12 note : ankyrin repeat domain 12-like pseudo : _no_value

name	Ighv5-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777781 IMGT/GENE-DB:IGHV5-7
definition	note : immunoglobulin heavy variable V5-7 pseudo : _no_value

name	EG668389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668389 IMGT/GENE-DB:IGHV2-4 MGI:3643263
definition	gene_synonym : IGHV2-4 note : predicted gene, EG668389

name	Ighv5-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777782 IMGT/GENE-DB:IGHV5-8
definition	note : immunoglobulin heavy variable V5-8 pseudo : _no_value

name	Ighv5-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544896 IMGT/GENE-DB:IGHV5-9
definition	note : immunoglobulin heavy variable V5-9

name	Ighv5-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777783 IMGT/GENE-DB:IGHV5-10
definition	note : immunoglobulin heavy variable V5-10 pseudo : _no_value

name	Ighv2-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638605 IMGT/GENE-DB:IGHV2-5
definition	note : immunoglobulin heavy variable V2-5

name	Ighv5-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777784 IMGT/GENE-DB:IGHV5-11
definition	note : immunoglobulin heavy variable V5-11 pseudo : _no_value

name	Ighv5-12 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668395 IMGT/GENE-DB:IGHV5-12
definition	note : immunoglobulin heavy variable V5-12

name	Ighv2-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630486 IMGT/GENE-DB:IGHV2-6
definition	note : immunoglobulin heavy variable V2-6

name	Ighv5-9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641178 IMGT/GENE-DB:IGHV5-9-1
definition	note : immunoglobulin heavy variable V5-9-1

name	EG628098 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628098 IMGT/GENE-DB:IGHV5-12-4 MGI:3645977
definition	gene_synonym : Ighv5-12-4 note : predicted gene, EG628098

name	Ighv2-9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:791089 IMGT/GENE-DB:IGHV2-9-1
definition	note : immunoglobulin heavy variable V2-9-1

name	Ighv5-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:790900 IMGT/GENE-DB:IGHV5-13
definition	note : immunoglobulin heavy variable V5-13

name	Ighv2-6-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:791090 IMGT/GENE-DB:IGHV2-6-8
definition	note : immunoglobulin heavy variable V2-6-8

name	EG629785 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629785 IMGT/GENE-DB:IGHV(III)-4 MGI:3643089
definition	gene_synonym : IGHV(III)-4 note : predicted gene, EG629785

name	Ighv2-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780793 IMGT/GENE-DB:IGHV2-7
definition	note : immunoglobulin heavy variable V2-7

name	LOC668405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668405
definition	note : ribosomal protein L26 pseudogene pseudo : _no_value

name	Ighv5-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780792 IMGT/GENE-DB:IGHV5-15
definition	note : immunoglobulin heavy variable V5-15

name	Ighv5-16 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633568 IMGT/GENE-DB:IGHV5-16
definition	note : immunoglobulin heavy variable V5-16

name	Ighv5-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780794 IMGT/GENE-DB:IGHV5-17
definition	note : immunoglobulin heavy variable V5-17

name	Ighv5-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780796 IMGT/GENE-DB:IGHV5-18
definition	note : immunoglobulin heavy variable V5-18 pseudo : _no_value

name	Ighv2-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780797 IMGT/GENE-DB:IGHV2-8
definition	note : immunoglobulin heavy variable V2-8 pseudo : _no_value

name	Ighv2-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640046 IMGT/GENE-DB:IGHV2-9
definition	note : immunoglobulin heavy variable V2-9

name	Ighv5-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780798 IMGT/GENE-DB:IGHV5-19
definition	note : immunoglobulin heavy variable V5-19 pseudo : _no_value

name	Ighv7-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780799 IMGT/GENE-DB:IGHV7-1
definition	note : immunoglobulin heavy variable V7-1 pseudo : _no_value

name	Ighv7-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780800 IMGT/GENE-DB:IGHV7-2
definition	note : immunoglobulin heavy variable V7-2

name	Ighv14-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780801 IMGT/GENE-DB:IGHV14-1
definition	note : immunoglobulin heavy variable V14-1

name	Ighv4-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780802 IMGT/GENE-DB:IGHV4-1
definition	note : immunoglobulin heavy variable V4-1

name	Ighv3-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780803 IMGT/GENE-DB:IGHV3-1
definition	note : immunoglobulin heavy variable V3-1

name	Ighv11-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780804 IMGT/GENE-DB:IGHV11-1
definition	note : immunoglobulin heavy variable V11-1

name	Ighv14-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668421 IMGT/GENE-DB:IGHV14-2
definition	note : immunoglobulin heavy variable V14-2

name	Ighv4-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668423 IMGT/GENE-DB:IGHV4-2
definition	note : immunoglobulin heavy variable V4-2 pseudo : _no_value

name	Ighv3-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780817 IMGT/GENE-DB:IGHV3-2
definition	note : immunoglobulin heavy variable V3-2 pseudo : _no_value

name	Ighv11-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780818 IMGT/GENE-DB:IGHV11-2
definition	note : immunoglobulin heavy variable V11-2

name	Ighv14-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238418 IMGT/GENE-DB:IGHV14-3
definition	note : immunoglobulin heavy variable V14-3

name	EG629812 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629812 IMGT/GENE-DB:IGHV5-20 MGI:3643819
definition	gene_synonym : IGHV5-20 note : predicted gene, EG629812

name	Ighv6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780822 IMGT/GENE-DB:IGHV6-2
definition	note : immunoglobulin heavy variable V6-2 pseudo : _no_value

name	Ighv9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195180 IMGT/GENE-DB:IGHV9-1
definition	note : immunoglobulin heavy variable V9-1

name	Ighv12-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780823 IMGT/GENE-DB:IGHV12-1
definition	note : immunoglobulin heavy variable V12-1 pseudo : _no_value

name	EG629818 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629818 IMGT/GENE-DB:IGHV9-2 MGI:3643816
definition	gene_synonym : IGHV9-2 note : predicted gene, EG629818

name	Ighv12-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780824 IMGT/GENE-DB:IGHV12-2
definition	note : immunoglobulin heavy variable V12-2 pseudo : _no_value

name	Ighv9-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780825 IMGT/GENE-DB:IGHV9-3
definition	note : immunoglobulin heavy variable V9-3

name	Ighv7-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629822 IMGT/GENE-DB:IGHV7-3
definition	gene_synonym : IgH; V(11)-djn note : immunoglobulin heavy variable V7-3 pseudo : _no_value

name	Ighv15-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780827 IMGT/GENE-DB:IGHV15-1
definition	note : immunoglobulin heavy variable V15-1 pseudo : _no_value

name	Ighv14-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629826 IMGT/GENE-DB:IGHV14-4
definition	note : immunoglobulin heavy variable V14-4

name	EG668438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668438 IMGT/GENE-DB:IGHV3-3 MGI:3643949
definition	gene_synonym : IGHV3-3 note : predicted gene, EG668438

name	Ighv7-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632654 IMGT/GENE-DB:IGHV7-4
definition	gene_synonym : V(13)-b note : immunoglobulin heavy variable V7-4

name	EG629833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629833 IMGT/GENE-DB:IGHV3-4 MGI:3644034
definition	gene_synonym : IGHV3-4 note : predicted gene, EG629833

name	EG633457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633457 IMGT/GENE-DB:IGHV3-5 MGI:3648045
definition	gene_synonym : C72-3A1; IGHV3-5 note : predicted gene, EG633457

name	Ighv13-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780828 IMGT/GENE-DB:IGHV13-1
definition	note : immunoglobulin heavy variable V13-1

name	Ighv3-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780829 IMGT/GENE-DB:IGHV3-6
definition	note : immunoglobulin heavy variable V3-6

name	EG636260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636260 IMGT/GENE-DB:IGHV9-4 MGI:3646379
definition	gene_synonym : IgH; IGHV9-4; MRP5 note : predicted gene, EG636260

name	Ighv3-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780830 IMGT/GENE-DB:IGHV3-7
definition	note : immunoglobulin heavy variable V3-7 pseudo : _no_value

name	Ighv5-21 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780832 IMGT/GENE-DB:IGHV5-21
definition	note : immunoglobulin heavy variable V5-21 pseudo : _no_value

name	Ighv3-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780831 IMGT/GENE-DB:IGHV3-8
definition	note : immunoglobulin heavy variable V3-8

name	Ighv8-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780833 IMGT/GENE-DB:IGHV8-1
definition	note : immunoglobulin heavy variable V8-1 pseudo : _no_value

name	Ighv1-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780834 IMGT/GENE-DB:IGHV1-1
definition	note : immunoglobulin heavy variable V1-1 pseudo : _no_value

name	Ighv13-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629842 IMGT/GENE-DB:IGHV13-2
definition	note : immunoglobulin heavy variable V13-2

name	EG435321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435321 IMGT/GENE-DB:IGHV12-3 MGI:3646760
definition	gene_synonym : IGHV12-3 note : predicted gene, EG435321

name	Ighv6-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629845 IMGT/GENE-DB:IGHV6-3
definition	note : immunoglobulin heavy variable V6-3

name	EG628398 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628398 IMGT/GENE-DB:IGHV6-4 MGI:3704120
definition	gene_synonym : Ighv6-4 note : predicted gene, EG628398

name	EG639510 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639510 IMGT/GENE-DB:IGHV6-5 MGI:3647134
definition	gene_synonym : IGHV6-5 note : predicted gene, EG639510

name	Ighv6-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238427 IMGT/GENE-DB:IGHV6-6
definition	gene_synonym : IgH; VH10G1 note : immunoglobulin heavy variable V6-6

name	EG432701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432701 IMGT/GENE-DB:IGHV6-7 MGI:3644477
definition	gene_synonym : IGHV6-7 note : predicted gene, EG432701

name	EG629849 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629849 IMGT/GENE-DB:IGHV8-2 MGI:3647474
definition	gene_synonym : IGHV8-2 note : predicted gene, EG629849

name	Ighv1-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238428 IMGT/GENE-DB:IGHV1-2
definition	note : immunoglobulin heavy variable V1-2 pseudo : _no_value

name	Ighv10-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380808 IMGT/GENE-DB:IGHV10-1
definition	note : immunoglobulin heavy variable V10-1

name	Ighv1-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780859 IMGT/GENE-DB:IGHV1-3
definition	note : immunoglobulin heavy variable V1-3 pseudo : _no_value

name	Ighv1-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432702 IMGT/GENE-DB:IGHV1-4
definition	note : immunoglobulin heavy variable V1-4

name	Ighv10-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780860 IMGT/GENE-DB:IGHV10-2
definition	note : immunoglobulin heavy variable V10-2 pseudo : _no_value

name	EG668469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668469 IMGT/GENE-DB:IGHV1-5 MGI:3704121
definition	gene_synonym : Ighv1-5 note : predicted gene, EG668469

name	EG380809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	gene_synonym : IgH; IGHV10-3 note : predicted gene, EG380809

name	Ighv1-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	note : immunoglobulin heavy variable V1-6 pseudo : _no_value

name	EG668474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	gene_synonym : Ighv1-7 note : predicted gene, EG668474

name	Ighv10-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	note : immunoglobulin heavy variable V10-4 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	note : immunoglobulin heavy variable V1-8 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	note : immunoglobulin heavy variable V15-2

name	Ighv1-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	note : immunoglobulin heavy variable V1-9

name	Ighv1-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	note : immunoglobulin heavy variable V1-10 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	note : immunoglobulin heavy variable V1-11

name	EG629860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	gene_synonym : IGHV1-12 note : predicted gene, EG629860

name	Ighv1-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	note : immunoglobulin heavy variable V1-13 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	note : immunoglobulin heavy variable V1-14

name	Ighv1-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	note : immunoglobulin heavy variable V1-15

name	EG629866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	gene_synonym : IGHV1-16 note : predicted gene, EG629866

name	Ighv1-17-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	note : immunoglobulin heavy variable V1-17-1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	note : immunoglobulin heavy variable V1-17 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	note : immunoglobulin heavy variable V1-18

name	EG668493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	gene_synonym : Ighv1-19-1 note : predicted gene, EG668493

name	Ighv1-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	note : immunoglobulin heavy variable V1-19

name	EG668497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	gene_synonym : IGHV1-20 note : predicted gene, EG668497

name	Ighv1-21-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631595 IMGT/GENE-DB:IGHV1-21-1
definition	note : immunoglobulin heavy variable V1-21-1 pseudo : _no_value

name	Ighv1-21 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668499 IMGT/GENE-DB:IGHV1-21
definition	note : immunoglobulin heavy variable V1-21 pseudo : _no_value

name	Ighv1-22 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780883 IMGT/GENE-DB:IGHV1-22
definition	note : immunoglobulin heavy variable V1-22

name	Ighv1-23 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780884 IMGT/GENE-DB:IGHV1-23
definition	note : immunoglobulin heavy variable V1-23

name	Ighv1-24 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780885 IMGT/GENE-DB:IGHV1-24
definition	note : immunoglobulin heavy variable V1-24

name	Ighv1-25 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640497 IMGT/GENE-DB:IGHV1-25
definition	note : immunoglobulin heavy variable V1-25 pseudo : _no_value

name	Ighv1-26 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629884 IMGT/GENE-DB:IGHV1-26
definition	note : immunoglobulin heavy variable V1-26

name	Ighv1-27 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780886 IMGT/GENE-DB:IGHV1-27
definition	note : immunoglobulin heavy variable V1-27 pseudo : _no_value

name	Ighv1-28 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668510 IMGT/GENE-DB:IGHV1-28
definition	note : immunoglobulin heavy variable V1-28 pseudo : _no_value

name	Ighv1-29 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780887 IMGT/GENE-DB:IGHV1-29
definition	note : immunoglobulin heavy variable V1-29 pseudo : _no_value

name	Ighv1-30 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668511 IMGT/GENE-DB:IGHV1-30
definition	note : immunoglobulin heavy variable V1-30 pseudo : _no_value

name	Ighv1-31 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629893 IMGT/GENE-DB:IGHV1-31
definition	note : immunoglobulin heavy variable V1-31

name	Ighv1-32 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780888 IMGT/GENE-DB:IGHV1-32
definition	note : immunoglobulin heavy variable V1-32 pseudo : _no_value

name	Ighv1-33 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641247 IMGT/GENE-DB:IGHV1-33
definition	note : immunoglobulin heavy variable V1-33 pseudo : _no_value

name	Ighv1-34 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628614 IMGT/GENE-DB:IGHV1-34
definition	note : immunoglobulin heavy variable V1-34

name	EG668515 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668515 IMGT/GENE-DB:IGHV1-35 MGI:3644935
definition	gene_synonym : Ighv1-35 note : predicted gene, EG668515 pseudo : _no_value

name	Ighv1-36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629897 IMGT/GENE-DB:IGHV1-36
definition	note : immunoglobulin heavy variable V1-36

name	Ighv1-37 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668517 IMGT/GENE-DB:IGHV1-37
definition	note : immunoglobulin heavy variable V1-37

name	Ighv1-38 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780890 IMGT/GENE-DB:IGHV1-38
definition	note : immunoglobulin heavy variable V1-38 pseudo : _no_value

name	Ighv1-39 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780891 IMGT/GENE-DB:IGHV1-39
definition	note : immunoglobulin heavy variable V1-39

name	Ighv1-40 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780892 IMGT/GENE-DB:IGHV1-40
definition	note : immunoglobulin heavy variable V1-40 pseudo : _no_value

name	Ighv1-41 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629904 IMGT/GENE-DB:IGHV1-41
definition	note : immunoglobulin heavy variable V1-41 pseudo : _no_value

name	EG629906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629906 IMGT/GENE-DB:IGHV1-42 MGI:3704123
definition	gene_synonym : Ighv1-42 note : predicted gene, EG629906

name	EG629908 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629908 IMGT/GENE-DB:IGHV1-43 MGI:3704124
definition	gene_synonym : Ighv1-43 note : predicted gene, EG629908

name	Ighv1-44 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668521 IMGT/GENE-DB:IGHV1-44
definition	note : immunoglobulin heavy variable V1-44 pseudo : _no_value

name	Ighv1-45 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780894 IMGT/GENE-DB:IGHV1-45
definition	note : immunoglobulin heavy variable V1-45 pseudo : _no_value

name	Ighv1-46 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668522 IMGT/GENE-DB:IGHV1-46
definition	note : immunoglobulin heavy variable V1-46 pseudo : _no_value

name	Ighv1-47 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629915 IMGT/GENE-DB:IGHV1-47
definition	note : immunoglobulin heavy variable V1-47

name	Ighv8-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780927 IMGT/GENE-DB:IGHV8-3
definition	note : immunoglobulin heavy variable V8-3 pseudo : _no_value

name	EG629919 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629919 IMGT/GENE-DB:IGHV8-4 MGI:3646040
definition	gene_synonym : IGHV8-4 note : predicted gene, EG629919

name	Ighv1-48 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780928 IMGT/GENE-DB:IGHV1-48
definition	note : immunoglobulin heavy variable V1-48 pseudo : _no_value

name	Ighv1-49 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629925 IMGT/GENE-DB:IGHV1-49
definition	note : immunoglobulin heavy variable V1-49

name	EG640506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640506 IMGT/GENE-DB:IGHV8-5 MGI:3645478
definition	gene_synonym : IGHV8-5 note : predicted gene, EG640506

name	Ighv1-50 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780929 IMGT/GENE-DB:IGHV1-50
definition	note : immunoglobulin heavy variable V1-50

name	Ighv1-51 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780930 IMGT/GENE-DB:IGHV1-51
definition	note : immunoglobulin heavy variable V1-51 pseudo : _no_value

name	Ighv1-52 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382696 IMGT/GENE-DB:IGHV-1-52
definition	note : immunoglobulin heavy variable V1-52

name	Ighv1-53 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780931 IMGT/GENE-DB:IGHV1-53
definition	note : immunoglobulin heavy variable V1-53

name	EG629930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629930 IMGT/GENE-DB:IGHV8-6 MGI:3645823
definition	gene_synonym : IGHV8-6 note : predicted gene, EG629930

name	EG668534 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668534 MGI:3646995
definition	note : predicted gene, EG668534 pseudo : _no_value

name	EG211331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211331 IMGT/GENE-DB:IGHV1-54 MGI:3647133
definition	gene_synonym : IgH; IGHV1-54; VH note : predicted gene, EG211331

name	Ighv1-55 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780932 IMGT/GENE-DB:IGHV1-55
definition	note : immunoglobulin heavy variable V1-55

name	EG634662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634662 MGI:3646714
definition	note : predicted gene, EG634662 pseudo : _no_value

name	Ighv1-56 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382695 IMGT/GENE-DB:IGHV1-56
definition	note : immunoglobulin heavy variable V1-56

name	EG629936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629936 MGI:3645821
definition	note : predicted gene, EG629936 pseudo : _no_value

name	Ighv8-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780936 IMGT/GENE-DB:IGHV8-7
definition	note : immunoglobulin heavy variable V8-7 pseudo : _no_value

name	Ighv1-57 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780937 IMGT/GENE-DB:IGHV1-57
definition	note : immunoglobulin heavy variable V1-57

name	Ighv8-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780938 IMGT/GENE-DB:IGHV8-8
definition	note : immunoglobulin heavy variable V8-8

name	4930523C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222275 GeneID:238405 MGI:2444636
definition	gene_synonym : ADAM6b product : RIKEN cDNA 4930523C11 gene transcript_id : NM_001009545.1

name	Adam6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709838 GeneID:238406 MGI:2676316
definition	gene_synonym : tMDCIV product : a disintegrin and metallopeptidase domain 6 transcript_id : NM_174885.3

name	Igh-3 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16016 IMGT/GENE-DB:IGHG2B MGI:96445
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gamma2b; IgG2b; IGHG2B

name	Ighg1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16017 IMGT/GENE-DB:IGHG1 MGI:96446
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgG1; Igh-4; VH7183

name	AI324046 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380795 IMGT/GENE-DB:IGHG3 MGI:2144790
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgG3; IGHG3; MGC68300

name	Igh-5 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380797 IMGT/GENE-DB:IGHD MGI:96447
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgD; IGHD

name	Igh-6 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16019 IMGT/GENE-DB:IGHM MGI:96448
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH

name	Ighj4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777656 IMGT/GENE-DB:IGHJ4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777655 IMGT/GENE-DB:IGHJ3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777654 IMGT/GENE-DB:IGHJ2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777648 IMGT/GENE-DB:IGHJ1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd4-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777661 IMGT/GENE-DB:IGHD4-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd3-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777662 IMGT/GENE-DB:IGHD3-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777663 IMGT/GENE-DB:IGHD5-6
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777664 IMGT/GENE-DB:IGHD2-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777665 IMGT/GENE-DB:IGHD5-5
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777667 IMGT/GENE-DB:IGHD2-7
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777669 IMGT/GENE-DB:IGHD5-8
definition	codon_start : 1 pseudo : _no_value

name	Ighd5-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777670 IMGT/GENE-DB:IGHD5-4
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777672 IMGT/GENE-DB:IGHD2-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777673 IMGT/GENE-DB:IGHD5-7
definition	codon_start : 1 pseudo : _no_value

name	Ighd5-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777674 IMGT/GENE-DB:IGHD5-3
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777675 IMGT/GENE-DB:IGHD2-5
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777676 IMGT/GENE-DB:IGHD5-2
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777677 IMGT/GENE-DB:IGHD2-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777678 IMGT/GENE-DB:IGHD6-2
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777679 IMGT/GENE-DB:IGHD2-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd6-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777680 IMGT/GENE-DB:IGHD6-1
definition	codon_start : 1 pseudo : _no_value

name	Ighd1-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777657 IMGT/GENE-DB:IGHD1-1
definition	codon_start : 1 exception : rearrangement required for product

name	4930523C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222276 CCDS:CCDS26207.1 GeneID:238405 MGI:2444636
definition	codon_start : 1 gene_synonym : ADAM6b note : a disintegrin and metalloproteinase domain 6-like product : a disintegrin and metalloproteinase domain 6-like protein_id : NP_001009545.1

name	Ighd3-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777681 IMGT/GENE-DB:IGHD3-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777682 IMGT/GENE-DB:IGHD5-1
definition	codon_start : 1 pseudo : _no_value

name	Adam6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119709839 CCDS:CCDS26208.1 GeneID:238406 MGI:2676316
definition	codon_start : 1 gene_synonym : tMDCIV note : disintegrin and metalloproteinase domain 6; a disintegrin and metalloprotease domain 6 product : a disintegrin and metalloprotease domain 6 protein_id : NP_777479.2

name	Ighv5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777683 IMGT/GENE-DB:IGHV5-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777684 IMGT/GENE-DB:IGKV2-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777685 IMGT/GENE-DB:IGHV5-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777686 IMGT/GENE-DB:IGHV2-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777687 IMGT/GENE-DB:IGHV5-3
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777688 IMGT/GENE-DB:IGHV5-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv6-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777689 IMGT/GENE-DB:IGHV6-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238412 IMGT/GENE-DB:IGHV2-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777779 IMGT/GENE-DB:IGHV5-5
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777780 IMGT/GENE-DB:IGHV5-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777781 IMGT/GENE-DB:IGHV5-7
definition	codon_start : 1 pseudo : _no_value

name	EG668389 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668389 IMGT/GENE-DB:IGHV2-4 MGI:3643263
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV2-4

name	Ighv5-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777782 IMGT/GENE-DB:IGHV5-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:544896 IMGT/GENE-DB:IGHV5-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777783 IMGT/GENE-DB:IGHV5-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:638605 IMGT/GENE-DB:IGHV2-5
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777784 IMGT/GENE-DB:IGHV5-11
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-12 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668395 IMGT/GENE-DB:IGHV5-12
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:630486 IMGT/GENE-DB:IGHV2-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:641178 IMGT/GENE-DB:IGHV5-9-1
definition	codon_start : 1 exception : rearrangement required for product

name	EG628098 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628098 IMGT/GENE-DB:IGHV5-12-4 MGI:3645977
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv5-12-4

name	Ighv2-9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:791089 IMGT/GENE-DB:IGHV2-9-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:790900 IMGT/GENE-DB:IGHV5-13
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-6-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:791090 IMGT/GENE-DB:IGHV2-6-8
definition	codon_start : 1 exception : rearrangement required for product

name	EG629785 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629785 IMGT/GENE-DB:IGHV(III)-4 MGI:3643089
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV(III)-4

name	Ighv2-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780793 IMGT/GENE-DB:IGHV2-7
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780792 IMGT/GENE-DB:IGHV5-15
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-16 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:633568 IMGT/GENE-DB:IGHV5-16
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780794 IMGT/GENE-DB:IGHV5-17
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780796 IMGT/GENE-DB:IGHV5-18
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780797 IMGT/GENE-DB:IGHV2-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:640046 IMGT/GENE-DB:IGHV2-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780798 IMGT/GENE-DB:IGHV5-19
definition	codon_start : 1 pseudo : _no_value

name	Ighv7-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780799 IMGT/GENE-DB:IGHV7-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv7-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780800 IMGT/GENE-DB:IGHV7-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780801 IMGT/GENE-DB:IGHV14-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv4-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780802 IMGT/GENE-DB:IGHV4-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv3-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780803 IMGT/GENE-DB:IGHV3-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv11-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780804 IMGT/GENE-DB:IGHV11-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668421 IMGT/GENE-DB:IGHV14-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv4-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668423 IMGT/GENE-DB:IGHV4-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv3-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780817 IMGT/GENE-DB:IGHV3-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv11-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780818 IMGT/GENE-DB:IGHV11-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238418 IMGT/GENE-DB:IGHV14-3
definition	codon_start : 1 exception : rearrangement required for product

name	EG629812 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629812 IMGT/GENE-DB:IGHV5-20 MGI:3643819
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV5-20

name	Ighv6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780822 IMGT/GENE-DB:IGHV6-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:195180 IMGT/GENE-DB:IGHV9-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv12-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780823 IMGT/GENE-DB:IGHV12-1
definition	codon_start : 1 pseudo : _no_value

name	EG629818 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629818 IMGT/GENE-DB:IGHV9-2 MGI:3643816
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV9-2

name	Ighv12-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780824 IMGT/GENE-DB:IGHV12-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv9-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780825 IMGT/GENE-DB:IGHV9-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv7-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629822 IMGT/GENE-DB:IGHV7-3
definition	codon_start : 1 gene_synonym : IgH; V(11)-djn pseudo : _no_value

name	Ighv15-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780827 IMGT/GENE-DB:IGHV15-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv14-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629826 IMGT/GENE-DB:IGHV14-4
definition	codon_start : 1 exception : rearrangement required for product

name	EG668438 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668438 IMGT/GENE-DB:IGHV3-3 MGI:3643949
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV3-3

name	Ighv7-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:632654 IMGT/GENE-DB:IGHV7-4
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : V(13)-b

name	EG629833 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629833 IMGT/GENE-DB:IGHV3-4 MGI:3644034
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV3-4

name	EG633457 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:633457 IMGT/GENE-DB:IGHV3-5 MGI:3648045
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : C72-3A1; IGHV3-5

name	Ighv13-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780828 IMGT/GENE-DB:IGHV13-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv3-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780829 IMGT/GENE-DB:IGHV3-6
definition	codon_start : 1 exception : rearrangement required for product

name	EG636260 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:636260 IMGT/GENE-DB:IGHV9-4 MGI:3646379
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV9-4; MRP5

name	Ighv3-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780830 IMGT/GENE-DB:IGHV3-7
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-21 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780832 IMGT/GENE-DB:IGHV5-21
definition	codon_start : 1 pseudo : _no_value

name	Ighv3-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780831 IMGT/GENE-DB:IGHV3-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780833 IMGT/GENE-DB:IGHV8-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780834 IMGT/GENE-DB:IGHV1-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv13-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629842 IMGT/GENE-DB:IGHV13-2
definition	codon_start : 1 exception : rearrangement required for product

name	EG435321 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:435321 IMGT/GENE-DB:IGHV12-3 MGI:3646760
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV12-3

name	Ighv6-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629845 IMGT/GENE-DB:IGHV6-3
definition	codon_start : 1 exception : rearrangement required for product

name	EG628398 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628398 IMGT/GENE-DB:IGHV6-4 MGI:3704120
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv6-4

name	EG639510 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:639510 IMGT/GENE-DB:IGHV6-5 MGI:3647134
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV6-5

name	Ighv6-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238427 IMGT/GENE-DB:IGHV6-6
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; VH10G1

name	EG432701 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432701 IMGT/GENE-DB:IGHV6-7 MGI:3644477
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV6-7

name	EG629849 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629849 IMGT/GENE-DB:IGHV8-2 MGI:3647474
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-2

name	Ighv1-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238428 IMGT/GENE-DB:IGHV1-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv10-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380808 IMGT/GENE-DB:IGHV10-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780859 IMGT/GENE-DB:IGHV1-3
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:432702 IMGT/GENE-DB:IGHV1-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv10-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780860 IMGT/GENE-DB:IGHV10-2
definition	codon_start : 1 pseudo : _no_value

name	EG668469 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668469 IMGT/GENE-DB:IGHV1-5 MGI:3704121
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-5

name	EG380809 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV10-3

name	Ighv1-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	codon_start : 1 pseudo : _no_value

name	EG668474 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-7

name	Ighv10-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	codon_start : 1 exception : rearrangement required for product

name	EG629860 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-12

name	Ighv1-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	codon_start : 1 exception : rearrangement required for product

name	EG629866 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	codon_start : 1 exception : rearrangement required for product

name	EG668493 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-19-1

name	Ighv1-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	codon_start : 1 exception : rearrangement required for product

name	EG668497 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-20

name	Ighv1-21-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:631595 IMGT/GENE-DB:IGHV1-21-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-21 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668499 IMGT/GENE-DB:IGHV1-21
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-22 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780883 IMGT/GENE-DB:IGHV1-22
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-23 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780884 IMGT/GENE-DB:IGHV1-23
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-24 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780885 IMGT/GENE-DB:IGHV1-24
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-25 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:640497 IMGT/GENE-DB:IGHV1-25
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-26 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629884 IMGT/GENE-DB:IGHV1-26
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-27 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780886 IMGT/GENE-DB:IGHV1-27
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-28 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668510 IMGT/GENE-DB:IGHV1-28
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-29 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780887 IMGT/GENE-DB:IGHV1-29
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-30 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668511 IMGT/GENE-DB:IGHV1-30
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-31 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629893 IMGT/GENE-DB:IGHV1-31
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-32 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780888 IMGT/GENE-DB:IGHV1-32
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-33 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:641247 IMGT/GENE-DB:IGHV1-33
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-34 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628614 IMGT/GENE-DB:IGHV1-34
definition	codon_start : 1 exception : rearrangement required for product

name	EG668515 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668515 IMGT/GENE-DB:IGHV1-35 MGI:3644935
definition	codon_start : 1 gene_synonym : Ighv1-35 pseudo : _no_value

name	Ighv1-36 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629897 IMGT/GENE-DB:IGHV1-36
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-37 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668517 IMGT/GENE-DB:IGHV1-37
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-38 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780890 IMGT/GENE-DB:IGHV1-38
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-39 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780891 IMGT/GENE-DB:IGHV1-39
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-40 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780892 IMGT/GENE-DB:IGHV1-40
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-41 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629904 IMGT/GENE-DB:IGHV1-41
definition	codon_start : 1 pseudo : _no_value

name	EG629906 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629906 IMGT/GENE-DB:IGHV1-42 MGI:3704123
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-42

name	EG629908 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629908 IMGT/GENE-DB:IGHV1-43 MGI:3704124
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-43

name	Ighv1-44 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668521 IMGT/GENE-DB:IGHV1-44
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-45 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780894 IMGT/GENE-DB:IGHV1-45
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-46 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668522 IMGT/GENE-DB:IGHV1-46
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-47 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629915 IMGT/GENE-DB:IGHV1-47
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780927 IMGT/GENE-DB:IGHV8-3
definition	codon_start : 1 pseudo : _no_value

name	EG629919 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629919 IMGT/GENE-DB:IGHV8-4 MGI:3646040
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-4

name	Ighv1-48 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780928 IMGT/GENE-DB:IGHV1-48
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-49 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629925 IMGT/GENE-DB:IGHV1-49
definition	codon_start : 1 exception : rearrangement required for product

name	EG640506 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:640506 IMGT/GENE-DB:IGHV8-5 MGI:3645478
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-5

name	Ighv1-50 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780929 IMGT/GENE-DB:IGHV1-50
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-51 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780930 IMGT/GENE-DB:IGHV1-51
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-52 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382696 IMGT/GENE-DB:IGHV-1-52
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-53 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780931 IMGT/GENE-DB:IGHV1-53
definition	codon_start : 1 exception : rearrangement required for product

name	EG629930 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629930 IMGT/GENE-DB:IGHV8-6 MGI:3645823
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-6

name	EG211331 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:211331 IMGT/GENE-DB:IGHV1-54 MGI:3647133
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-54; VH

name	Ighv1-55 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780932 IMGT/GENE-DB:IGHV1-55
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-56 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382695 IMGT/GENE-DB:IGHV1-56
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780936 IMGT/GENE-DB:IGHV8-7
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-57 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780937 IMGT/GENE-DB:IGHV1-57
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780938 IMGT/GENE-DB:IGHV8-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777683
definition	pseudo : _no_value standard_name : IGHV5-1

name	Ighv2-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777684
definition	pseudo : _no_value standard_name : IGHV2-1

name	Ighv5-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777685
definition	standard_name : IGHV5-2

name	Ighv2-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777686
definition	standard_name : IGHV2-2

name	Ighv5-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777687
definition	pseudo : _no_value standard_name : IGHV5-3

name	Ighv5-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777688
definition	standard_name : IGHV5-4

name	Ighv6-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777689
definition	pseudo : _no_value standard_name : IGHV6-1

name	Ighv2-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238412
definition	standard_name : IGHV2-3

name	Ighv5-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777779
definition	pseudo : _no_value standard_name : IGHV5-5

name	Ighv5-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777780
definition	standard_name : IGHV5-6

name	Ighv5-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777781
definition	pseudo : _no_value standard_name : IGHV5-7

name	EG668389 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668389
definition	gene_synonym : IGHV2-4 standard_name : IGHV2-4

name	Ighv5-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777782
definition	pseudo : _no_value standard_name : IGHV5-8

name	Ighv5-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:544896
definition	standard_name : IGHV5-9

name	Ighv5-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777783
definition	pseudo : _no_value standard_name : IGHV5-10

name	Ighv2-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:638605
definition	standard_name : IGHV2-5

name	Ighv5-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777784
definition	pseudo : _no_value standard_name : IGHV5-11

name	Ighv5-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668395
definition	standard_name : IGHV5-12

name	Ighv2-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:630486
definition	standard_name : IGHV2-6

name	Ighv5-9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:641178
definition	standard_name : IGHV5-9-1

name	EG628098 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628098
definition	gene_synonym : Ighv5-12-4 standard_name : IGHV5-12-4

name	Ighv2-9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:791089
definition	standard_name : IGHV2-9-1

name	Ighv5-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:790900
definition	standard_name : IGHV5-13

name	Ighv2-6-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:791090
definition	standard_name : Ighv2-6-8

name	EG629785 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629785
definition	gene_synonym : IGHV(III)-4 standard_name : IGHV(III)-4

name	Ighv2-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780793
definition	standard_name : IGHV2-7

name	Ighv5-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780792
definition	standard_name : IGHV5-15

name	Ighv5-16 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633568
definition	standard_name : IGHV5-16

name	Ighv5-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780794
definition	standard_name : IGHV5-17

name	Ighv5-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780796
definition	pseudo : _no_value standard_name : IGHV5-18

name	Ighv2-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780797
definition	pseudo : _no_value standard_name : IGHV2-8

name	Ighv2-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640046
definition	standard_name : IGHV2-9

name	Ighv5-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780798
definition	pseudo : _no_value standard_name : IGHV5-19

name	Ighv7-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780799
definition	pseudo : _no_value standard_name : IGHV7-1

name	Ighv7-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780800
definition	standard_name : IGHV7-2

name	Ighv14-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780801
definition	standard_name : IGHV14-1

name	Ighv4-1 (CDS detail)
type	V_segment
link	vega ensembl
xref
definition	standard_name : IGHV4-1

name	Ighv3-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780803
definition	standard_name : IGHV3-1

name	Ighv11-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780804
definition	standard_name : IGHV11-1

name	Ighv14-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668421
definition	standard_name : IGHV14-2

name	Ighv4-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668423
definition	pseudo : _no_value standard_name : IGHV4-2

name	Ighv3-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780817
definition	pseudo : _no_value standard_name : IGHV3-2

name	Ighv11-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780818
definition	standard_name : IGHV11-2

name	Ighv14-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238418
definition	standard_name : IGHV14-3

name	EG629812 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629812
definition	gene_synonym : IGHV5-20 standard_name : IGHV5-20

name	Ighv6-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780822
definition	pseudo : _no_value standard_name : IGHV6-2

name	Ighv9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:195180
definition	standard_name : IGHV9-1

name	Ighv12-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780823
definition	pseudo : _no_value standard_name : IGHV12-1

name	EG629818 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629818
definition	gene_synonym : IGHV9-2 standard_name : IGHV9-2

name	Ighv12-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780824
definition	pseudo : _no_value standard_name : IGHV12-2

name	Ighv9-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780825
definition	standard_name : IGHV9-3

name	Ighv7-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629822
definition	gene_synonym : IgH; V(11)-djn pseudo : _no_value standard_name : IGHV7-3

name	Ighv15-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780827
definition	pseudo : _no_value standard_name : IGHV15-1

name	Ighv14-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629826
definition	standard_name : IGHV14-4

name	EG668438 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668438
definition	gene_synonym : IGHV3-3 standard_name : IGHV3-3

name	Ighv7-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:632654
definition	gene_synonym : V(13)-b standard_name : IGHV7-4

name	EG629833 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629833
definition	gene_synonym : IGHV3-4 standard_name : IGHV3-4

name	EG633457 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633457
definition	gene_synonym : C72-3A1; IGHV3-5 standard_name : IGHV3-5

name	Ighv13-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780828
definition	standard_name : IGHV13-1

name	Ighv3-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780829
definition	standard_name : IGHV3-6

name	EG636260 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:636260
definition	gene_synonym : IgH; IGHV9-4; MRP5 standard_name : IGHV9-4

name	Ighv3-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780830
definition	pseudo : _no_value standard_name : IGHV3-7

name	Ighv5-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780832
definition	pseudo : _no_value standard_name : IGHV5-21

name	Ighv3-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780831
definition	standard_name : IGHV3-8

name	Ighv8-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780833
definition	pseudo : _no_value standard_name : IGHV8-1

name	Ighv1-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780834
definition	pseudo : _no_value standard_name : IGHV1-1

name	Ighv13-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629842
definition	standard_name : IGHV13-2

name	EG435321 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435321
definition	gene_synonym : IGHV12-3 standard_name : IGHV12-3

name	Ighv6-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629845
definition	standard_name : IGHV6-3

name	EG628398 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628398
definition	gene_synonym : Ighv6-4 standard_name : IGHV6-4

name	EG639510 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:639510
definition	gene_synonym : IGHV6-5 standard_name : IGHV6-5

name	Ighv6-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238427
definition	gene_synonym : IgH; VH10G1 standard_name : IGHV6-6

name	EG432701 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432701
definition	gene_synonym : IGHV6-7 standard_name : IGHV6-7

name	EG629849 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629849
definition	gene_synonym : IGHV8-2 standard_name : IGHV8-2

name	Ighv1-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238428
definition	pseudo : _no_value standard_name : IGHV1-2

name	Ighv10-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380808
definition	standard_name : IGHV10-1

name	Ighv1-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780859
definition	pseudo : _no_value standard_name : IGHV1-3

name	Ighv1-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432702
definition	standard_name : IGHV1-4

name	Ighv10-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780860
definition	pseudo : _no_value standard_name : IGHV10-2

name	EG668469 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668469
definition	gene_synonym : Ighv1-5 standard_name : IGHV1-5

name	EG380809 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380809
definition	gene_synonym : IgH; IGHV10-3 standard_name : IGHV10-3

name	Ighv1-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780861
definition	pseudo : _no_value standard_name : IGHV1-6

name	EG668474 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668474
definition	gene_synonym : Ighv1-7 standard_name : IGHV1-7

name	Ighv10-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780862
definition	pseudo : _no_value standard_name : IGHV10-4

name	Ighv1-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780863
definition	pseudo : _no_value standard_name : IGHV1-8

name	Ighv15-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780864
definition	standard_name : IGHV15-2

name	Ighv1-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668478
definition	standard_name : Ighv1-9

name	Ighv1-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:637050
definition	pseudo : _no_value standard_name : IGHV1-10

name	Ighv1-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629859
definition	standard_name : IGHV1-11

name	EG629860 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629860
definition	gene_synonym : IGHV1-12 standard_name : IGHV1-12

name	Ighv1-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780865
definition	pseudo : _no_value standard_name : IGHV1-13

name	Ighv1-14 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629863
definition	standard_name : IGHV1-14

name	Ighv1-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629865
definition	standard_name : IGHV1-15

name	EG629866 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629866
definition	gene_synonym : IGHV1-16 standard_name : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780926
definition	pseudo : _no_value standard_name : IGHV1-17-1

name	Ighv1-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629869
definition	pseudo : _no_value standard_name : IGHV1-17

name	Ighv1-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629871
definition	standard_name : IGHV1-18

name	EG668493 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668493
definition	gene_synonym : Ighv1-19-1 standard_name : IGHV1-19-1

name	Ighv1-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382692
definition	standard_name : IGHV1-19

name	EG668497 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668497
definition	gene_synonym : IGHV1-20 standard_name : IGHV1-20

name	Ighv1-21-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:631595
definition	pseudo : _no_value standard_name : IGHV1-21-1

name	Ighv1-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668499
definition	pseudo : _no_value standard_name : IGHV1-21

name	Ighv1-22 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780883
definition	standard_name : IGHV1-22

name	Ighv1-23 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780884
definition	standard_name : IGHV1-23

name	Ighv1-24 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780885
definition	standard_name : IGHV1-24

name	Ighv1-25 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640497
definition	pseudo : _no_value standard_name : IGHV1-25

name	Ighv1-26 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629884
definition	standard_name : IGHV1-26

name	Ighv1-27 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780886
definition	pseudo : _no_value standard_name : IGHV1-27

name	Ighv1-28 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668510
definition	pseudo : _no_value standard_name : IGHV1-28

name	Ighv1-29 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780887
definition	pseudo : _no_value standard_name : IGHV1-29

name	Ighv1-30 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668511
definition	pseudo : _no_value standard_name : IGHV1-30

name	Ighv1-31 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629893
definition	standard_name : IGHV1-31

name	Ighv1-32 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780888
definition	pseudo : _no_value standard_name : IGHV1-32

name	Ighv1-33 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:641247
definition	pseudo : _no_value standard_name : IGHV1-33

name	Ighv1-34 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628614
definition	standard_name : IGHV1-34

name	EG668515 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668515
definition	gene_synonym : Ighv1-35 pseudo : _no_value standard_name : IGHV1-35

name	Ighv1-36 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629897
definition	standard_name : IGHV1-36

name	Ighv1-37 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668517
definition	standard_name : IGHV1-37

name	Ighv1-38 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780890
definition	pseudo : _no_value standard_name : IGHV1-38

name	Ighv1-39 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780891
definition	standard_name : IGHV1-39

name	Ighv1-40 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780892
definition	pseudo : _no_value standard_name : IGHV1-40

name	Ighv1-41 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629904
definition	pseudo : _no_value standard_name : IGHV1-41

name	EG629906 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629906
definition	gene_synonym : Ighv1-42 standard_name : IGHV1-42

name	EG629908 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629908
definition	gene_synonym : Ighv1-43 standard_name : IGHV1-43

name	Ighv1-44 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668521
definition	pseudo : _no_value standard_name : IGHV1-44

name	Ighv1-45 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780894
definition	pseudo : _no_value standard_name : IGHV1-45

name	Ighv1-46 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668522
definition	pseudo : _no_value standard_name : IGHV1-46

name	Ighv1-47 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629915
definition	standard_name : IGHV1-47

name	Ighv8-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780927
definition	pseudo : _no_value standard_name : IGHV8-3

name	EG629919 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629919
definition	gene_synonym : IGHV8-4 standard_name : IGHV8-4

name	Ighv1-48 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780928
definition	pseudo : _no_value standard_name : IGHV1-48

name	Ighv1-49 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629925
definition	standard_name : IGHV1-49

name	EG640506 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640506
definition	gene_synonym : IGHV8-5 standard_name : IGHV8-5

name	Ighv1-50 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780929
definition	standard_name : IGHV1-50

name	Ighv1-51 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780930
definition	pseudo : _no_value standard_name : IGHV1-51

name	Ighv1-52 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382696
definition	standard_name : IGHV1-52

name	Ighv1-53 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780931
definition	standard_name : IGHV1-53

name	EG629930 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629930
definition	gene_synonym : IGHV8-6 standard_name : IGHV8-6

name	EG211331 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:211331
definition	gene_synonym : IgH; IGHV1-54; VH standard_name : IGHV1-54

name	Ighv1-55 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780932
definition	standard_name : IGHV1-55

name	Ighv1-56 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382695
definition	standard_name : IGHV1-56

name	Ighv8-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780936
definition	pseudo : _no_value standard_name : IGHV807

name	Ighv1-57 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780937
definition	standard_name : IGHV1-57

name	Ighv8-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780938
definition	standard_name : IGHV8-8

name	Ighj4 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777656
definition	standard_name : IGHJ4

name	Ighj3 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777655
definition	standard_name : IGHJ3

name	Ighj2 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777654
definition	standard_name : IGHJ2

name	Ighj1 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777648
definition	standard_name : IGHJ1

name	Ighd4-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777661
definition	standard_name : IGHD4-1

name	Ighd3-2 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777662
definition	standard_name : IGHD3-2

name	Ighd5-6 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777663
definition	pseudo : _no_value standard_name : IGHD5-6

name	Ighd2-8 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777664
definition	standard_name : IGHD2-8

name	Ighd5-5 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777665
definition	pseudo : _no_value standard_name : IGHD5-5

name	Ighd2-7 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777667
definition	standard_name : IGHD2-7

name	Ighd5-8 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777669
definition	pseudo : _no_value standard_name : IGHV5-8

name	Ighd5-4 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777670
definition	pseudo : _no_value standard_name : IGHD5-4

name	Ighd2-6 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777672
definition	standard_name : IGHD2-6

name	Ighd5-7 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777673
definition	pseudo : _no_value standard_name : IGHD5-7

name	Ighd5-3 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777674
definition	pseudo : _no_value standard_name : IGHD5-3

name	Ighd2-5 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777675
definition	standard_name : IGHD2-5

name	Ighd2-4 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777677
definition	standard_name : IGHD2-4

name	Ighd6-2 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777678
definition	pseudo : _no_value standard_name : IGHD6-2

name	Ighd2-3 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777679
definition	standard_name : IGHD2-3

name	Ighd6-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777680
definition	pseudo : _no_value standard_name : IGHD6-1

name	Ighd1-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777657
definition	standard_name : IGHD1-1

name	Ighd3-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777681
definition	standard_name : IGHD3-1

name	Ighd5-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777682
definition	pseudo : _no_value standard_name : IGHD5-1

name	Igh-3 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16016
definition	gene_synonym : gamma2b; IgG2b; IGHG2B standard_name : IGHG2B

name	Ighg1 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16017
definition	gene_synonym : IgG1; Igh-4; VH7183 standard_name : IGHG`

name	AI324046 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380795
definition	gene_synonym : IgG3; IGHG3; MGC68300 standard_name : IGHG3

name	Igh-5 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380797
definition	gene_synonym : IgD; IGHD standard_name : IGHD

name	Igh-6 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16019
definition	gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH standard_name : IGHM

clone name	MSMg01-336L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-185G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176D11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-273E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538B23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488F18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517M02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-109N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-307F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-479K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508B17
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-285M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F06
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-073M19.T7 (MSMg01no073_m19.b1)	MSMg01-073M19.TJ (MSMg01no073_m19.g1)
ACC	AG297009	AG297010
length	715	714
length of high quality (start - end)	323 (44 - 366)	290 (375 - 664)
definition	CHROMAT_FILE: MSMg01no073_m19.b1 PHD_FILE: MSMg01no073_m19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:21:59 2005	CHROMAT_FILE: MSMg01no073_m19.g1 PHD_FILE: MSMg01no073_m19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:21:59 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAA TTCTTTGTTCAGTTCTGAGCCCCATTTTTTAATGGGGTTATTTGATATTC TGAAGTCCACCTTCTTGAGTTCTTTATATATGTTGGATATTAGTCCCCTA TCTGATTTAGGATAGGTAAAGATCCTTTCCCAATCTGTTGGTGGTCTTTT TGTCTTATTGACGGTGTCTTTTGCCTTGCAGAAACTTTGGAGTTTCATTA GGTCCCATTTGTCAATTCTCGATCTTACAGCACAAGCCATTGCTGTTCTG TTCAGGAATTTTTCCCCTGTGCCCATATCTTCAAGGCTTTTCCCCACTTT CTCCTCTATAAGTTTTAGTGTCTCTGGCTTTATGTGAAGTTCCTTGATCC ACTTAGATTTGACCTTAGTACAAGGAGATAAGTATGGATCGATTCGCATT CTTCTACACGATAACAACCAGTTGTGCCAGCACCAATTGTTGAAAATGCT GTCTTTCTTCCACTGGATGGTTTTAGCTCCCTTGTCGAAGATCAAGTGAC CATAGGTGTGTGGGTTCATTTCTGGGTCTTCAATTCTATTCCATTGGTCT ACTTGTCTGTCTCTATACCAGTACCATGCAGTTTTTACCACAACTGCTCT GTAGTAAAGCTTTAGGTCAGGCATGGTGATTCCACCAGAGGTTCTTTTAT CCTTGAGAAGAGTTC	NACGATGAAGTGGGAGGCCTGGNGGCCGCCTGGCTTTCTCACCTGGGTGA ACTANAGAAGGACTGCAACATCAAGGGAAGACTTTGACAACAAAGTGGAT GTAGGGATGTAGTCTGATCTTCTCCCCCAGTTAGCAATTCCCTTACATAT GTAATAGACTGGGCTGAGACTATTTTAACCTAAAATTATAATTGAATTTA ATAGTTATTTCAATGGAAATACTTGGTAATGTGATACACTGAAATTATAA CAATTTATTAAACTGTAACCAAAAGGAATTTGTGGAAAAACTAACTTATC ACACTTTCCTCTTAATGAAATTAAATTGATTAAATCAATCAAAAATTATA AAATGAATATACTCCTTGATCTCCTTCAAAGTCATAAAGAAAATTACAAC AGTATGTGTATCACATCTCTGCCACACACATCACTCTTTCCATTTCATGT ACAAGACTCTTGCTGTGAATCAAACATGAAAACAATCCAAAGAAATATTC AGTTTATGCTATGAAATACTAAGATCTAGGTGAACTCATAATATATAAAA AAGTAACTACCTTGAATAGAAATTGCTATCTCTTCCTGAAAACTCCTATC ATTAAAGGCTATAGCAAGAGGAGCTGTGATTCTACTGGTCATGGGGTCTG AATACTTAACTATCTTTTTTGTTCACAGGGAACCTCTACATACAGCTTGC ATGTAACTTTTGTC
quality values	Open. Hide. 6 8 8 6 6 9 9 22 28 27 20 20 28 33 25 23 39 32 32 25 30 30 37 25 21 10 11 11 26 22 50 50 50 50 50 57 57 57 42 29 22 24 26 42 35 53 53 47 47 47 54 50 51 68 68 68 68 42 39 33 32 32 39 48 50 51 51 51 51 68 51 51 50 50 50 51 68 68 68 68 51 51 51 51 48 48 50 50 50 51 51 51 51 51 51 51 68 68 68 68 68 68 51 51 68 50 51 50 50 50 50 68 68 68 68 68 68 68 68 57 57 50 52 52 52 52 52 59 57 51 51 51 50 50 50 51 51 68 68 51 51 51 57 57 57 57 68 68 68 68 68 68 57 57 57 57 57 57 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 54 54 54 59 59 59 68 57 57 57 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 44 44 39 37 37 37 23 21 8 8 8 8 9 26 28 20 24 18 11 8 7 7 8 8 12 24 30 34 38 59 59 59 53 57 57 57 57 57 59 59 59 57 57 57 57 57 57 59 57 57 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 57 53 48 57 39 39 35 37 37 30 30 30 39 44 59 59 59 68 59 59 57 57 47 44 43 43 43 46 47 54 57 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 59 59 57 57 57 59 59 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 59 57 57 57 57 57 57 57 57 57 57 48 57 57 57 57 57 50 68 50 50 47 47 47 57 59 68 68 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 48 48 48 48 48 48 59 48 48 48 42 37 37 37 37 37 37 37 32 32 37 37 37 37 37 47 48 48 59 59 59 59 48 59 59 57 59 59 59 57 57 57 48 57 57 57 48 48 48 48 48 50 50 59 59 43 37 37 32 29 26 32 35 43 59 47 47 47 48 48 37 28 28 26 20 18 32 40 21 27 18 18 20 27 25 35 28 28 39 35 35 31 34 39 44 39 36 31 32 37 28 24 24 24 20 23 16 24 23 31 23 24 24 31 25 30 25 24 24 25 37 32 25 25 32 16 13 9 9 9 9 10 11 17 9 9 9	Open. Hide. 0 3 3 6 6 11 8 8 8 8 7 7 6 6 8 15 15 21 14 14 12 3 0 3 21 18 32 32 44 33 29 11 9 9 6 7 6 6 6 6 6 6 6 6 9 9 10 9 9 9 11 21 21 3 0 3 23 23 23 15 8 6 6 6 6 6 9 9 9 7 8 9 11 9 9 11 27 23 27 21 10 13 13 30 32 36 36 36 36 36 37 42 36 40 43 43 43 50 50 50 50 50 53 53 36 36 36 36 31 31 33 33 33 31 21 21 11 11 11 17 23 14 14 14 31 22 31 31 36 36 36 57 50 50 53 53 57 57 57 57 57 57 57 47 47 47 50 47 47 68 68 68 68 68 68 68 54 57 57 57 57 57 57 57 57 68 54 54 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 54 54 54 54 54 54 54 57 54 57 57 57 54 54 57 57 57 59 57 57 57 57 57 50 50 50 50 50 47 57 48 50 57 36 36 36 36 36 33 50 50 47 47 41 41 25 21 11 11 11 13 11 11 15 23 41 59 50 50 53 50 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 68 68 68 68 68 57 57 57 57 59 59 57 57 57 57 57 57 57 57 59 59 59 59 59 50 50 50 50 47 32 27 20 11 6 6 6 6 6 6 6 6 6 6 7 8 8 11 22 27 41 47 46 41 43 47 47 48 59 59 59 59 59 59 59 57 57 57 57 57 57 59 30 30 17 15 15 14 14 15 15 26 19 8 8 8 8 8 8 11 17 23 36 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 57 53 53 53 50 48 57 59 48 54 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 48 48 48 48 54 54 57 57 59 59 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 57 57 57 59 59 68 68 68 68 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 68 68 59 59 59 57 57 54 57 59 59 57 57 57 68 68 57 57 57 57 57 57 57 59 59 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 48 48 48 59 59 59 57 59 59 59 57 57 57 57 57 48 48 48 57 59 59 59 59 57 47 47 43 47 47 57 57 57 57 57 57 57 57 57 68 59 57 57 57 57 57 57 48 57 43 43 43 42 42 50 59 59 59 59 59 59 50 50 47 47 44 44 43 41 41 44 59 36 34 32 30 28 32 20 20 20 18 27 27 47 47 47 43 59 48 39 39 39 39 43 57 57 57 48 48 48 48 40 39 39 36 26 20 19 14 19 24 27 37 39 39 35 30 33 30 32 28 25 23 32 30 30 28 34 34 31 26 32 36 37 37 25 29 16 23 11 13 10 9 9 11 18 11 11 11 11 10 11 11 11 16 23 22 26 36 32 36 36 37 39 39 28 24 12 12 12 26 22 30 28 27 19 22 25 30 34 37 30 21 12 11 11 14 20 21 15 14 13 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no073_m19.g1 MSMg01no073_m19.g1 CHROMAT_FILE:
MSMg01no073_m19.g1 PHD_FILE: MSMg01no073_m19.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:21:59 2005
         (290 letters)



>mm_chr12_115536183_115536872
          Length = 690

 Score =  561 bits (290), Expect = e-164
 Identities = 290/290 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   ttcaaagtcataaagaaaattacaacagtatgtgtatcacatctctgccacacacatcac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 ttcaaagtcataaagaaaattacaacagtatgtgtatcacatctctgccacacacatcac 260

                                                                       
Query: 61  tctttccatttcatgtacaagactcttgctgtgaatcaaacatgaaaacaatccaaagaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tctttccatttcatgtacaagactcttgctgtgaatcaaacatgaaaacaatccaaagaa 320

                                                                       
Query: 121 atattcagtttatgctatgaaatactaagatctaggtgaactcataatatataaaaaagt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 atattcagtttatgctatgaaatactaagatctaggtgaactcataatatataaaaaagt 380

                                                                       
Query: 181 aactaccttgaatagaaattgctatctcttcctgaaaactcctatcattaaaggctatag 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 aactaccttgaatagaaattgctatctcttcctgaaaactcctatcattaaaggctatag 440

                                                             
Query: 241 caagaggagctgtgattctactggtcatggggtctgaatacttaactatc 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 caagaggagctgtgattctactggtcatggggtctgaatacttaactatc 490


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 13
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 290
Length of database: 690
Length adjustment: 9
Effective length of query: 281
Effective length of database: 681
Effective search space:   191361
Effective search space used:   191361
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information