MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-302I07
Chromosome	12 (Build37)
Map Location	114,968,918 - 114,969,206
singlet/doublet	singlet
Overlap gene	Igh
Upstream gene	AW555464, LOC382640, Pld4, AI450948, LOC100041194, BC022687, Cdca4, Gpr132, Jag2, Nudt14, Brf1, Btbd6, Pacs2, Tex22, Mta1, Crip2, Crip1, 4930427A07Rik, LOC676349, Tmem121, Igh-2, Gm900, Igh-1b, Igh-3, Ighg1, AI324046, LOC668370, LOC668375, EG382645, Igh-5, Igh-6, Ighj4, Ighj3, Ighj2, Ighj1, Ighd4-1, Ighd3-2, Ighd5-6, Ighd2-8, Ighd5-5, Ighd2-7, Ighd5-8, Ighd5-4, Ighd2-6, Ighd5-7, Ighd5-3, Ighd2-5, Ighd5-2, Ighd2-4, Ighd6-2, Ighd2-3, Ighd6-1, Ighd1-1, 4930523C11Rik, Ighd3-1, Ighd5-1, Adam6, Ighv5-1, Ighv2-1, Ighv5-2, Ighv2-2, Ighv5-3, Ighv5-4, Ighv6-1, Ighv2-3, Ighv5-5, Ighv5-6, Ankrd12-like, Ighv5-7, EG668389, Ighv5-8, Ighv5-9, Ighv5-10, Ighv2-5, Ighv5-11, Ighv5-12, Ighv2-6
Downstream gene	Ighv5-9-1, EG628098, Ighv2-9-1, Ighv5-13, Ighv2-6-8, EG629785, Ighv2-7, LOC668405, Ighv5-15, Ighv5-16, Ighv5-17, Ighv5-18, Ighv2-8, Ighv2-9, Ighv5-19, Ighv7-1, Ighv7-2, Ighv14-1, Ighv4-1, Ighv3-1, Ighv11-1, Ighv14-2, Ighv4-2, Ighv3-2, Ighv11-2, Ighv14-3, EG629812, Ighv6-2, Ighv9-1, Ighv12-1, EG629818, Ighv12-2, Ighv9-3, Ighv7-3, Ighv15-1, Ighv14-4, EG668438, Ighv7-4, EG629833, EG633457, Ighv13-1, Ighv3-6, EG636260, Ighv3-7, Ighv5-21, Ighv3-8, Ighv8-1, Ighv1-1, Ighv13-2, EG435321, Ighv6-3, EG628398, EG639510, Ighv6-6, EG432701, EG629849, Ighv1-2, Ighv10-1, Ighv1-3, Ighv1-4, Ighv10-2, EG668469, EG380809, Ighv1-6, EG668474, Ighv10-4, Ighv1-8, Ighv15-2, Ighv1-9, Ighv1-10, Ighv1-11, EG629860, Ighv1-13, Ighv1-14, Ighv1-15, EG629866, Ighv1-17-1, Ighv1-17, Ighv1-18, EG668493, Ighv1-19, EG668497
Link	Open Mouse BAC browser

Click to get alignment info.

name	AW555464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217882 MGI:2145043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382640 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pld4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104759 MGI:2144765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI450948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382643 MGI:2144831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 3 Proteins

name	BC022687 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217887 MGI:2443738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdca4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71963 MGI:1919213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56696 MGI:1890220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jag2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16450 MGI:1098270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66174 MGI:1913424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72308 MGI:1919558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399566 MGI:3026623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pacs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217893 MGI:1924399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75671 MGI:1922921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116870 MGI:2150037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68337 MGI:1915587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12925 MGI:88501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930427A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104732 MGI:2144738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676349 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Tmem121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69195 MGI:1916445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111507 MGI:96442
definition	gene_synonym : MGC118122; MGC118132; MGC19003; MGC25748; MGC6342; MGC68311; MGC91096 note : immunoglobulin heavy chain complex

name	Igh-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238447 IMGT/GENE-DB:IGHA MGI:96444
definition	gene_synonym : IgA; Igha note : immunoglobulin heavy chain 2 (serum IgA)

name	Gm900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380792 IMGT/GENE-DB:IGHE MGI:2685746
definition	gene_synonym : IGHE note : gene model 900, (NCBI)

name	Igh-1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404711 IMGT/GENE-DB:IGHG2C MGI:2686979
definition	gene_synonym : IGHG2C note : immunoglobulin heavy chain 1b (serum IgG2c)

name	Igh-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16016 IMGT/GENE-DB:IGHG2B MGI:96445
definition	gene_synonym : gamma2b; IgG2b; IGHG2B note : immunoglobulin heavy chain 3 (serum IgG2b)

name	Ighg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16017 IMGT/GENE-DB:IGHG1 MGI:96446
definition	gene_synonym : IgG1; Igh-4; VH7183 note : immunoglobulin heavy constant gamma 1 (G1m marker)

name	AI324046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380795 IMGT/GENE-DB:IGHG3 MGI:2144790
definition	gene_synonym : IgG3; IGHG3; MGC68300 note : expressed sequence AI324046

name	LOC668370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668370
definition	note : FUS interacting protein (serine-arginine rich) 1 pseudogene pseudo : _no_value

name	LOC668375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668375
definition	note : transducin-like enhancer of split 6 pseudogene pseudo : _no_value

name	EG382645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382645 MGI:3647068
definition	note : predicted gene, EG382645 pseudo : _no_value

name	Igh-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380797 IMGT/GENE-DB:IGHD MGI:96447
definition	gene_synonym : IgD; IGHD note : immunoglobulin heavy chain 5 (delta-like heavy chain)

name	Igh-6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16019 IMGT/GENE-DB:IGHM MGI:96448
definition	gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH note : immunoglobulin heavy chain 6 (heavy chain of IgM)

name	Ighj4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777656 IMGT/GENE-DB:IGHJ4
definition	note : immunoglobulin heavy joining 4

name	Ighj3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777655 IMGT/GENE-DB:IGHJ3
definition	note : immunoglobulin heavy joining 3

name	Ighj2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777654 IMGT/GENE-DB:IGHJ2
definition	note : immunoglobulin heavy joining 2

name	Ighj1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777648 IMGT/GENE-DB:IGHJ1
definition	note : immunoglobulin heavy joining 1

name	Ighd4-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777661 IMGT/GENE-DB:IGHD4-1
definition	note : immunoglobulin heavy diversity 4-1

name	Ighd3-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777662 IMGT/GENE-DB:IGHD3-2
definition	note : immunoglobulin heavy diversity 3-2

name	Ighd5-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777663 IMGT/GENE-DB:IGHD5-6
definition	note : immunoglobulin heavy diversity 5-6 pseudo : _no_value

name	Ighd2-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777664 IMGT/GENE-DB:IGHD2-8
definition	note : immunoglobulin heavy diversity 2-8

name	Ighd5-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777665 IMGT/GENE-DB:IGHD5-5
definition	note : immunoglobulin heavy diversity 5-5 pseudo : _no_value

name	Ighd2-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777667 IMGT/GENE-DB:IGHD2-7
definition	note : immunoglobulin heavy diversity 2-7

name	Ighd5-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777669 IMGT/GENE-DB:IGHD5-8
definition	note : immunoglobulin heavy diversity 5-8 pseudo : _no_value

name	Ighd5-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777670 IMGT/GENE-DB:IGHD5-4
definition	note : immunoglobulin heavy diversity 5-4 pseudo : _no_value

name	Ighd2-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777672 IMGT/GENE-DB:IGHD2-6
definition	note : immunoglobulin heavy diversity 2-6

name	Ighd5-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777673 IMGT/GENE-DB:IGHD5-7
definition	note : immunoglobulin heavy diversity 5-7 pseudo : _no_value

name	Ighd5-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777674 IMGT/GENE-DB:IGHD5-3
definition	note : immunoglobulin heavy diversity 5-3 pseudo : _no_value

name	Ighd2-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777675 IMGT/GENE-DB:IGHD2-5
definition	note : immunoglobulin heavy diversity 2-5

name	Ighd5-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777676 IMGT/GENE-DB:IGHD5-2
definition	note : immunoglobulin heavy diversity 5-2 pseudo : _no_value

name	Ighd2-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777677 IMGT/GENE-DB:IGHD2-4
definition	note : immunoglobulin heavy diversity 2-4

name	Ighd6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777678 IMGT/GENE-DB:IGHD6-2
definition	note : immunoglobulin heavy diversity 6-2 pseudo : _no_value

name	Ighd2-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777679 IMGT/GENE-DB:IGHD2-3
definition	note : immunoglobulin heavy diversity 2-3

name	Ighd6-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777680 IMGT/GENE-DB:IGHD6-1
definition	note : immunoglobulin heavy diversity 6-1 pseudo : _no_value

name	Ighd1-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777657 IMGT/GENE-DB:IGHD1-1
definition	note : immunoglobulin heavy diversity 1-1

name	4930523C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238405 MGI:2444636
definition	gene_synonym : ADAM6b note : RIKEN cDNA 4930523C11 gene

name	Ighd3-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777681 IMGT/GENE-DB:IGHD3-1
definition	note : immunoglobulin heavy diversity 3-1

name	Ighd5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777682 IMGT/GENE-DB:IGHD5-1
definition	note : immunoglobulin heavy diversity 5-1 pseudo : _no_value

name	Adam6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238406 MGI:2676316
definition	gene_synonym : tMDCIV note : a disintegrin and metallopeptidase domain 6

name	Ighv5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777683 IMGT/GENE-DB:IGHV5-1
definition	note : immunoglobulin heavy variable V5-1 pseudo : _no_value

name	Ighv2-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777684 IMGT/GENE-DB:IGKV2-1
definition	note : immunoglobulin heavy variable V2-1 pseudo : _no_value

name	Ighv5-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777685 IMGT/GENE-DB:IGHV5-2
definition	note : immunoglobulin heavy variable V5-2

name	Ighv2-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777686 IMGT/GENE-DB:IGHV2-2
definition	note : immunoglobulin heavy variable V2-2

name	Ighv5-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777687 IMGT/GENE-DB:IGHV5-3
definition	note : immunoglobulin heavy variable V5-3 pseudo : _no_value

name	Ighv5-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777688 IMGT/GENE-DB:IGHV5-4
definition	note : immunoglobulin heavy variable V5-4

name	Ighv6-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777689 IMGT/GENE-DB:IGHV6-1
definition	note : immunoglobulin heavy variable V6-1 pseudo : _no_value

name	Ighv2-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238412 IMGT/GENE-DB:IGHV2-3
definition	note : immunoglobulin heavy variable V2-3

name	Ighv5-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777779 IMGT/GENE-DB:IGHV5-5
definition	note : immunoglobulin heavy variable V5-5 pseudo : _no_value

name	Ighv5-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777780 IMGT/GENE-DB:IGHV5-6
definition	note : immunoglobulin heavy variable V5-6

name	Ankrd12-like (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:67107
definition	gene_synonym : Ankrd12 note : ankyrin repeat domain 12-like pseudo : _no_value

name	Ighv5-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777781 IMGT/GENE-DB:IGHV5-7
definition	note : immunoglobulin heavy variable V5-7 pseudo : _no_value

name	EG668389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668389 IMGT/GENE-DB:IGHV2-4 MGI:3643263
definition	gene_synonym : IGHV2-4 note : predicted gene, EG668389

name	Ighv5-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777782 IMGT/GENE-DB:IGHV5-8
definition	note : immunoglobulin heavy variable V5-8 pseudo : _no_value

name	Ighv5-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544896 IMGT/GENE-DB:IGHV5-9
definition	note : immunoglobulin heavy variable V5-9

name	Ighv5-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777783 IMGT/GENE-DB:IGHV5-10
definition	note : immunoglobulin heavy variable V5-10 pseudo : _no_value

name	Ighv2-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638605 IMGT/GENE-DB:IGHV2-5
definition	note : immunoglobulin heavy variable V2-5

name	Ighv5-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777784 IMGT/GENE-DB:IGHV5-11
definition	note : immunoglobulin heavy variable V5-11 pseudo : _no_value

name	Ighv5-12 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668395 IMGT/GENE-DB:IGHV5-12
definition	note : immunoglobulin heavy variable V5-12

name	Ighv2-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630486 IMGT/GENE-DB:IGHV2-6
definition	note : immunoglobulin heavy variable V2-6

name	Ighv5-9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641178 IMGT/GENE-DB:IGHV5-9-1
definition	note : immunoglobulin heavy variable V5-9-1

name	EG628098 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628098 IMGT/GENE-DB:IGHV5-12-4 MGI:3645977
definition	gene_synonym : Ighv5-12-4 note : predicted gene, EG628098

name	Ighv2-9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:791089 IMGT/GENE-DB:IGHV2-9-1
definition	note : immunoglobulin heavy variable V2-9-1

name	Ighv5-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:790900 IMGT/GENE-DB:IGHV5-13
definition	note : immunoglobulin heavy variable V5-13

name	Ighv2-6-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:791090 IMGT/GENE-DB:IGHV2-6-8
definition	note : immunoglobulin heavy variable V2-6-8

name	EG629785 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629785 IMGT/GENE-DB:IGHV(III)-4 MGI:3643089
definition	gene_synonym : IGHV(III)-4 note : predicted gene, EG629785

name	Ighv2-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780793 IMGT/GENE-DB:IGHV2-7
definition	note : immunoglobulin heavy variable V2-7

name	LOC668405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668405
definition	note : ribosomal protein L26 pseudogene pseudo : _no_value

name	Ighv5-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780792 IMGT/GENE-DB:IGHV5-15
definition	note : immunoglobulin heavy variable V5-15

name	Ighv5-16 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633568 IMGT/GENE-DB:IGHV5-16
definition	note : immunoglobulin heavy variable V5-16

name	Ighv5-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780794 IMGT/GENE-DB:IGHV5-17
definition	note : immunoglobulin heavy variable V5-17

name	Ighv5-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780796 IMGT/GENE-DB:IGHV5-18
definition	note : immunoglobulin heavy variable V5-18 pseudo : _no_value

name	Ighv2-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780797 IMGT/GENE-DB:IGHV2-8
definition	note : immunoglobulin heavy variable V2-8 pseudo : _no_value

name	Ighv2-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640046 IMGT/GENE-DB:IGHV2-9
definition	note : immunoglobulin heavy variable V2-9

name	Ighv5-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780798 IMGT/GENE-DB:IGHV5-19
definition	note : immunoglobulin heavy variable V5-19 pseudo : _no_value

name	Ighv7-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780799 IMGT/GENE-DB:IGHV7-1
definition	note : immunoglobulin heavy variable V7-1 pseudo : _no_value

name	Ighv7-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780800 IMGT/GENE-DB:IGHV7-2
definition	note : immunoglobulin heavy variable V7-2

name	Ighv14-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780801 IMGT/GENE-DB:IGHV14-1
definition	note : immunoglobulin heavy variable V14-1

name	Ighv4-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780802 IMGT/GENE-DB:IGHV4-1
definition	note : immunoglobulin heavy variable V4-1

name	Ighv3-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780803 IMGT/GENE-DB:IGHV3-1
definition	note : immunoglobulin heavy variable V3-1

name	Ighv11-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780804 IMGT/GENE-DB:IGHV11-1
definition	note : immunoglobulin heavy variable V11-1

name	Ighv14-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668421 IMGT/GENE-DB:IGHV14-2
definition	note : immunoglobulin heavy variable V14-2

name	Ighv4-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668423 IMGT/GENE-DB:IGHV4-2
definition	note : immunoglobulin heavy variable V4-2 pseudo : _no_value

name	Ighv3-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780817 IMGT/GENE-DB:IGHV3-2
definition	note : immunoglobulin heavy variable V3-2 pseudo : _no_value

name	Ighv11-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780818 IMGT/GENE-DB:IGHV11-2
definition	note : immunoglobulin heavy variable V11-2

name	Ighv14-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238418 IMGT/GENE-DB:IGHV14-3
definition	note : immunoglobulin heavy variable V14-3

name	EG629812 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629812 IMGT/GENE-DB:IGHV5-20 MGI:3643819
definition	gene_synonym : IGHV5-20 note : predicted gene, EG629812

name	Ighv6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780822 IMGT/GENE-DB:IGHV6-2
definition	note : immunoglobulin heavy variable V6-2 pseudo : _no_value

name	Ighv9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195180 IMGT/GENE-DB:IGHV9-1
definition	note : immunoglobulin heavy variable V9-1

name	Ighv12-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780823 IMGT/GENE-DB:IGHV12-1
definition	note : immunoglobulin heavy variable V12-1 pseudo : _no_value

name	EG629818 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629818 IMGT/GENE-DB:IGHV9-2 MGI:3643816
definition	gene_synonym : IGHV9-2 note : predicted gene, EG629818

name	Ighv12-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780824 IMGT/GENE-DB:IGHV12-2
definition	note : immunoglobulin heavy variable V12-2 pseudo : _no_value

name	Ighv9-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780825 IMGT/GENE-DB:IGHV9-3
definition	note : immunoglobulin heavy variable V9-3

name	Ighv7-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629822 IMGT/GENE-DB:IGHV7-3
definition	gene_synonym : IgH; V(11)-djn note : immunoglobulin heavy variable V7-3 pseudo : _no_value

name	Ighv15-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780827 IMGT/GENE-DB:IGHV15-1
definition	note : immunoglobulin heavy variable V15-1 pseudo : _no_value

name	Ighv14-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629826 IMGT/GENE-DB:IGHV14-4
definition	note : immunoglobulin heavy variable V14-4

name	EG668438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668438 IMGT/GENE-DB:IGHV3-3 MGI:3643949
definition	gene_synonym : IGHV3-3 note : predicted gene, EG668438

name	Ighv7-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632654 IMGT/GENE-DB:IGHV7-4
definition	gene_synonym : V(13)-b note : immunoglobulin heavy variable V7-4

name	EG629833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629833 IMGT/GENE-DB:IGHV3-4 MGI:3644034
definition	gene_synonym : IGHV3-4 note : predicted gene, EG629833

name	EG633457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633457 IMGT/GENE-DB:IGHV3-5 MGI:3648045
definition	gene_synonym : C72-3A1; IGHV3-5 note : predicted gene, EG633457

name	Ighv13-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780828 IMGT/GENE-DB:IGHV13-1
definition	note : immunoglobulin heavy variable V13-1

name	Ighv3-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780829 IMGT/GENE-DB:IGHV3-6
definition	note : immunoglobulin heavy variable V3-6

name	EG636260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636260 IMGT/GENE-DB:IGHV9-4 MGI:3646379
definition	gene_synonym : IgH; IGHV9-4; MRP5 note : predicted gene, EG636260

name	Ighv3-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780830 IMGT/GENE-DB:IGHV3-7
definition	note : immunoglobulin heavy variable V3-7 pseudo : _no_value

name	Ighv5-21 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780832 IMGT/GENE-DB:IGHV5-21
definition	note : immunoglobulin heavy variable V5-21 pseudo : _no_value

name	Ighv3-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780831 IMGT/GENE-DB:IGHV3-8
definition	note : immunoglobulin heavy variable V3-8

name	Ighv8-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780833 IMGT/GENE-DB:IGHV8-1
definition	note : immunoglobulin heavy variable V8-1 pseudo : _no_value

name	Ighv1-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780834 IMGT/GENE-DB:IGHV1-1
definition	note : immunoglobulin heavy variable V1-1 pseudo : _no_value

name	Ighv13-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629842 IMGT/GENE-DB:IGHV13-2
definition	note : immunoglobulin heavy variable V13-2

name	EG435321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435321 IMGT/GENE-DB:IGHV12-3 MGI:3646760
definition	gene_synonym : IGHV12-3 note : predicted gene, EG435321

name	Ighv6-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629845 IMGT/GENE-DB:IGHV6-3
definition	note : immunoglobulin heavy variable V6-3

name	EG628398 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628398 IMGT/GENE-DB:IGHV6-4 MGI:3704120
definition	gene_synonym : Ighv6-4 note : predicted gene, EG628398

name	EG639510 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639510 IMGT/GENE-DB:IGHV6-5 MGI:3647134
definition	gene_synonym : IGHV6-5 note : predicted gene, EG639510

name	Ighv6-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238427 IMGT/GENE-DB:IGHV6-6
definition	gene_synonym : IgH; VH10G1 note : immunoglobulin heavy variable V6-6

name	EG432701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432701 IMGT/GENE-DB:IGHV6-7 MGI:3644477
definition	gene_synonym : IGHV6-7 note : predicted gene, EG432701

name	EG629849 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629849 IMGT/GENE-DB:IGHV8-2 MGI:3647474
definition	gene_synonym : IGHV8-2 note : predicted gene, EG629849

name	Ighv1-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238428 IMGT/GENE-DB:IGHV1-2
definition	note : immunoglobulin heavy variable V1-2 pseudo : _no_value

name	Ighv10-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380808 IMGT/GENE-DB:IGHV10-1
definition	note : immunoglobulin heavy variable V10-1

name	Ighv1-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780859 IMGT/GENE-DB:IGHV1-3
definition	note : immunoglobulin heavy variable V1-3 pseudo : _no_value

name	Ighv1-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432702 IMGT/GENE-DB:IGHV1-4
definition	note : immunoglobulin heavy variable V1-4

name	Ighv10-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780860 IMGT/GENE-DB:IGHV10-2
definition	note : immunoglobulin heavy variable V10-2 pseudo : _no_value

name	EG668469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668469 IMGT/GENE-DB:IGHV1-5 MGI:3704121
definition	gene_synonym : Ighv1-5 note : predicted gene, EG668469

name	EG380809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	gene_synonym : IgH; IGHV10-3 note : predicted gene, EG380809

name	Ighv1-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	note : immunoglobulin heavy variable V1-6 pseudo : _no_value

name	EG668474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	gene_synonym : Ighv1-7 note : predicted gene, EG668474

name	Ighv10-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	note : immunoglobulin heavy variable V10-4 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	note : immunoglobulin heavy variable V1-8 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	note : immunoglobulin heavy variable V15-2

name	Ighv1-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	note : immunoglobulin heavy variable V1-9

name	Ighv1-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	note : immunoglobulin heavy variable V1-10 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	note : immunoglobulin heavy variable V1-11

name	EG629860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	gene_synonym : IGHV1-12 note : predicted gene, EG629860

name	Ighv1-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	note : immunoglobulin heavy variable V1-13 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	note : immunoglobulin heavy variable V1-14

name	Ighv1-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	note : immunoglobulin heavy variable V1-15

name	EG629866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	gene_synonym : IGHV1-16 note : predicted gene, EG629866

name	Ighv1-17-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	note : immunoglobulin heavy variable V1-17-1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	note : immunoglobulin heavy variable V1-17 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	note : immunoglobulin heavy variable V1-18

name	EG668493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	gene_synonym : Ighv1-19-1 note : predicted gene, EG668493

name	Ighv1-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	note : immunoglobulin heavy variable V1-19

name	EG668497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	gene_synonym : IGHV1-20 note : predicted gene, EG668497

name	AW555464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352514 GeneID:217882 MGI:2145043
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW555464 transcript_id : NM_001024602.2

name	Pld4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801925 GeneID:104759 MGI:2144765
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D family, member 4 transcript_id : NM_178911.3

name	AI450948 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702000 GeneID:382643 MGI:2144831
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI450948 transcript_id : NM_001033476.1

name	LOC100041194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263537 GeneID:100041194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 3 Proteins product : similar to KIAA2019 protein transcript_id : XM_001475946.1

name	BC022687 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351874 GeneID:217887 MGI:2443738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC022687 transcript_id : NM_145450.3

name	Cdca4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328499 GeneID:71963 MGI:1919213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle associated 4 transcript_id : NM_028023.3

name	Gpr132 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803482 GeneID:56696 MGI:1890220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 132 transcript_id : NM_019925.4

name	Jag2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553296 GeneID:16450 MGI:1098270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jagged 2 transcript_id : NM_010588.1

name	Nudt14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352246 GeneID:66174 MGI:1913424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 14 transcript_id : NM_025399.2

name	Brf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130445 GeneID:72308 MGI:1919558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) transcript_id : NM_028193.3

name	Btbd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42517137 GeneID:399566 MGI:3026623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 6 transcript_id : NM_201646.1

name	Pacs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487180 GeneID:217893 MGI:1924399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofurin acidic cluster sorting protein 2 transcript_id : NM_001081170.1

name	Tex22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037426 GeneID:75671 MGI:1922921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 22 transcript_id : NM_029381.1

name	Mta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598895 GeneID:116870 MGI:2150037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis associated 1 transcript_id : NM_054081.2

name	Crip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195645 GeneID:68337 MGI:1915587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine rich protein 2 transcript_id : NM_024223.1

name	Crip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123701561 GeneID:12925 MGI:88501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich protein 1 (intestinal) transcript_id : NM_007763.3

name	4930427A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364664 GeneID:104732 MGI:2144738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930427A07 gene transcript_id : NM_134041.2

name	Tmem121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053940 GeneID:69195 MGI:1916445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 121 transcript_id : NM_153776.2

name	4930523C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222275 GeneID:238405 MGI:2444636
definition	gene_synonym : ADAM6b product : RIKEN cDNA 4930523C11 gene transcript_id : NM_001009545.1

name	Adam6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709838 GeneID:238406 MGI:2676316
definition	gene_synonym : tMDCIV product : a disintegrin and metallopeptidase domain 6 transcript_id : NM_174885.3

name	AW555464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677549 GeneID:217882 MGI:2145043
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC217882 protein_id : NP_001019773.1

name	Pld4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725764 CCDS:CCDS26195.1 GeneID:104759 MGI:2144765
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phospholipase D4 product : phospholipase D family, member 4 protein_id : NP_849242.1

name	AI450948 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702001 CCDS:CCDS26196.1 GeneID:382643 MGI:2144831
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC382643 protein_id : NP_001028648.1

name	LOC100041194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263538 GeneID:100041194
definition	codon_start : 1 product : similar to KIAA2019 protein protein_id : XP_001475996.1

name	BC022687 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32526898 GeneID:217887 MGI:2443738
definition	codon_start : 1 product : hypothetical protein LOC217887 protein_id : NP_663425.2

name	Cdca4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229143 CCDS:CCDS26198.1 GeneID:71963 MGI:1919213
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : cell division cycle associated 4 protein_id : NP_082299.1

name	Gpr132 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910232 CCDS:CCDS26199.1 GeneID:56696 MGI:1890220
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G2 accumulation; G protein-coupled receptor G2A product : G protein-coupled receptor 132 protein_id : NP_064309.1

name	Jag2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553297 CCDS:CCDS26200.1 GeneID:16450 MGI:1098270
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence ISS]; GO:0005112 - Notch binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009912 - auditory receptor cell fate commitment [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0007049 - cell cycle [Evidence ISS]; GO:0030154 - cell differentiation [Evidence NAS]; GO:0001709 - cell fate determination [Evidence NAS]; GO:0007267 - cell-cell signaling [Evidence NAS]; GO:0007275 - development [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence ISS]; GO:0042492 - gamma-delta T cell differentiation [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence ISS] [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0030155 - regulation of cell adhesion [Evidence IMP]; GO:0030334 - regulation of cell migration [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0007605 - sensory perception of sound [Evidence NAS]; GO:0001501 - skeletal development [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence ISS]; GO:0045061 - thymic T cell selection [Evidence ISS] codon_start : 1 exception : mismatches in translation note : syndactylism product : jagged 2 protein_id : NP_034718.1

name	Nudt14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956126 CCDS:CCDS26201.1 GeneID:66174 MGI:1913424
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008768 - UDP-sugar diphosphatase activity [Evidence IEA] codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 14 protein_id : NP_079675.1

name	Brf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608137 GeneID:72308 MGI:1919558
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0043488 - regulation of mRNA stability [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 product : transcription initiation factor IIIB protein_id : NP_082469.2

name	Btbd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42517138 GeneID:399566 MGI:3026623
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : BTB (POZ) domain containing 6 protein_id : NP_964008.1

name	Pacs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487181 GeneID:217893 MGI:1924399
definition	codon_start : 1 note : phosphofurin acidic cluster sorting protein 1-like product : phosphofurin acidic cluster sorting protein 2 protein_id : NP_001074639.1

name	Tex22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037427 CCDS:CCDS26203.1 GeneID:75671 MGI:1922921
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] codon_start : 1 product : testis expressed gene 22 protein_id : NP_083657.1

name	Mta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598896 GeneID:116870 MGI:2150037
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IPI] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : metastasis associated 1 protein_id : NP_473422.2

name	Crip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195646 CCDS:CCDS26204.1 GeneID:68337 MGI:1915587
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 product : LIM only protein HLP protein_id : NP_077185.1

name	Crip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681015 CCDS:CCDS26205.1 GeneID:12925 MGI:88501
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] codon_start : 1 note : cysteine rich intestinal protein; cysteine-rich intestinal protein product : cysteine-rich protein 1 (intestinal) protein_id : NP_031789.1

name	4930427A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789353 GeneID:104732 MGI:2144738
definition	codon_start : 1 product : hypothetical protein LOC104732 protein_id : NP_598802.1

name	Tmem121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053941 CCDS:CCDS26206.1 GeneID:69195 MGI:1916445
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hole protein protein_id : NP_722471.2

name	Igh-2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:238447 IMGT/GENE-DB:IGHA MGI:96444
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgA; Igha

name	Gm900 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380792 IMGT/GENE-DB:IGHE MGI:2685746
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHE

name	Igh-1b (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:404711 IMGT/GENE-DB:IGHG2C MGI:2686979
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHG2C

name	Igh-3 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16016 IMGT/GENE-DB:IGHG2B MGI:96445
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gamma2b; IgG2b; IGHG2B

name	Ighg1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16017 IMGT/GENE-DB:IGHG1 MGI:96446
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgG1; Igh-4; VH7183

name	AI324046 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380795 IMGT/GENE-DB:IGHG3 MGI:2144790
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgG3; IGHG3; MGC68300

name	Igh-5 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380797 IMGT/GENE-DB:IGHD MGI:96447
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgD; IGHD

name	Igh-6 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16019 IMGT/GENE-DB:IGHM MGI:96448
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH

name	Ighj4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777656 IMGT/GENE-DB:IGHJ4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777655 IMGT/GENE-DB:IGHJ3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777654 IMGT/GENE-DB:IGHJ2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777648 IMGT/GENE-DB:IGHJ1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd4-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777661 IMGT/GENE-DB:IGHD4-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd3-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777662 IMGT/GENE-DB:IGHD3-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777663 IMGT/GENE-DB:IGHD5-6
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777664 IMGT/GENE-DB:IGHD2-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777665 IMGT/GENE-DB:IGHD5-5
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777667 IMGT/GENE-DB:IGHD2-7
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777669 IMGT/GENE-DB:IGHD5-8
definition	codon_start : 1 pseudo : _no_value

name	Ighd5-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777670 IMGT/GENE-DB:IGHD5-4
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777672 IMGT/GENE-DB:IGHD2-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777673 IMGT/GENE-DB:IGHD5-7
definition	codon_start : 1 pseudo : _no_value

name	Ighd5-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777674 IMGT/GENE-DB:IGHD5-3
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777675 IMGT/GENE-DB:IGHD2-5
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777676 IMGT/GENE-DB:IGHD5-2
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777677 IMGT/GENE-DB:IGHD2-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777678 IMGT/GENE-DB:IGHD6-2
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777679 IMGT/GENE-DB:IGHD2-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd6-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777680 IMGT/GENE-DB:IGHD6-1
definition	codon_start : 1 pseudo : _no_value

name	Ighd1-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777657 IMGT/GENE-DB:IGHD1-1
definition	codon_start : 1 exception : rearrangement required for product

name	4930523C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222276 CCDS:CCDS26207.1 GeneID:238405 MGI:2444636
definition	codon_start : 1 gene_synonym : ADAM6b note : a disintegrin and metalloproteinase domain 6-like product : a disintegrin and metalloproteinase domain 6-like protein_id : NP_001009545.1

name	Ighd3-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777681 IMGT/GENE-DB:IGHD3-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777682 IMGT/GENE-DB:IGHD5-1
definition	codon_start : 1 pseudo : _no_value

name	Adam6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119709839 CCDS:CCDS26208.1 GeneID:238406 MGI:2676316
definition	codon_start : 1 gene_synonym : tMDCIV note : disintegrin and metalloproteinase domain 6; a disintegrin and metalloprotease domain 6 product : a disintegrin and metalloprotease domain 6 protein_id : NP_777479.2

name	Ighv5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777683 IMGT/GENE-DB:IGHV5-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777684 IMGT/GENE-DB:IGKV2-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777685 IMGT/GENE-DB:IGHV5-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777686 IMGT/GENE-DB:IGHV2-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777687 IMGT/GENE-DB:IGHV5-3
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777688 IMGT/GENE-DB:IGHV5-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv6-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777689 IMGT/GENE-DB:IGHV6-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238412 IMGT/GENE-DB:IGHV2-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777779 IMGT/GENE-DB:IGHV5-5
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777780 IMGT/GENE-DB:IGHV5-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777781 IMGT/GENE-DB:IGHV5-7
definition	codon_start : 1 pseudo : _no_value

name	EG668389 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668389 IMGT/GENE-DB:IGHV2-4 MGI:3643263
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV2-4

name	Ighv5-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777782 IMGT/GENE-DB:IGHV5-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:544896 IMGT/GENE-DB:IGHV5-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777783 IMGT/GENE-DB:IGHV5-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:638605 IMGT/GENE-DB:IGHV2-5
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777784 IMGT/GENE-DB:IGHV5-11
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-12 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668395 IMGT/GENE-DB:IGHV5-12
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:630486 IMGT/GENE-DB:IGHV2-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:641178 IMGT/GENE-DB:IGHV5-9-1
definition	codon_start : 1 exception : rearrangement required for product

name	EG628098 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628098 IMGT/GENE-DB:IGHV5-12-4 MGI:3645977
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv5-12-4

name	Ighv2-9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:791089 IMGT/GENE-DB:IGHV2-9-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:790900 IMGT/GENE-DB:IGHV5-13
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-6-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:791090 IMGT/GENE-DB:IGHV2-6-8
definition	codon_start : 1 exception : rearrangement required for product

name	EG629785 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629785 IMGT/GENE-DB:IGHV(III)-4 MGI:3643089
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV(III)-4

name	Ighv2-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780793 IMGT/GENE-DB:IGHV2-7
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780792 IMGT/GENE-DB:IGHV5-15
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-16 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:633568 IMGT/GENE-DB:IGHV5-16
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780794 IMGT/GENE-DB:IGHV5-17
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780796 IMGT/GENE-DB:IGHV5-18
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780797 IMGT/GENE-DB:IGHV2-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:640046 IMGT/GENE-DB:IGHV2-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780798 IMGT/GENE-DB:IGHV5-19
definition	codon_start : 1 pseudo : _no_value

name	Ighv7-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780799 IMGT/GENE-DB:IGHV7-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv7-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780800 IMGT/GENE-DB:IGHV7-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780801 IMGT/GENE-DB:IGHV14-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv4-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780802 IMGT/GENE-DB:IGHV4-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv3-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780803 IMGT/GENE-DB:IGHV3-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv11-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780804 IMGT/GENE-DB:IGHV11-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668421 IMGT/GENE-DB:IGHV14-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv4-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668423 IMGT/GENE-DB:IGHV4-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv3-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780817 IMGT/GENE-DB:IGHV3-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv11-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780818 IMGT/GENE-DB:IGHV11-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238418 IMGT/GENE-DB:IGHV14-3
definition	codon_start : 1 exception : rearrangement required for product

name	EG629812 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629812 IMGT/GENE-DB:IGHV5-20 MGI:3643819
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV5-20

name	Ighv6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780822 IMGT/GENE-DB:IGHV6-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:195180 IMGT/GENE-DB:IGHV9-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv12-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780823 IMGT/GENE-DB:IGHV12-1
definition	codon_start : 1 pseudo : _no_value

name	EG629818 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629818 IMGT/GENE-DB:IGHV9-2 MGI:3643816
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV9-2

name	Ighv12-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780824 IMGT/GENE-DB:IGHV12-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv9-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780825 IMGT/GENE-DB:IGHV9-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv7-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629822 IMGT/GENE-DB:IGHV7-3
definition	codon_start : 1 gene_synonym : IgH; V(11)-djn pseudo : _no_value

name	Ighv15-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780827 IMGT/GENE-DB:IGHV15-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv14-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629826 IMGT/GENE-DB:IGHV14-4
definition	codon_start : 1 exception : rearrangement required for product

name	EG668438 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668438 IMGT/GENE-DB:IGHV3-3 MGI:3643949
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV3-3

name	Ighv7-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:632654 IMGT/GENE-DB:IGHV7-4
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : V(13)-b

name	EG629833 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629833 IMGT/GENE-DB:IGHV3-4 MGI:3644034
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV3-4

name	EG633457 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:633457 IMGT/GENE-DB:IGHV3-5 MGI:3648045
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : C72-3A1; IGHV3-5

name	Ighv13-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780828 IMGT/GENE-DB:IGHV13-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv3-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780829 IMGT/GENE-DB:IGHV3-6
definition	codon_start : 1 exception : rearrangement required for product

name	EG636260 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:636260 IMGT/GENE-DB:IGHV9-4 MGI:3646379
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV9-4; MRP5

name	Ighv3-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780830 IMGT/GENE-DB:IGHV3-7
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-21 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780832 IMGT/GENE-DB:IGHV5-21
definition	codon_start : 1 pseudo : _no_value

name	Ighv3-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780831 IMGT/GENE-DB:IGHV3-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780833 IMGT/GENE-DB:IGHV8-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780834 IMGT/GENE-DB:IGHV1-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv13-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629842 IMGT/GENE-DB:IGHV13-2
definition	codon_start : 1 exception : rearrangement required for product

name	EG435321 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:435321 IMGT/GENE-DB:IGHV12-3 MGI:3646760
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV12-3

name	Ighv6-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629845 IMGT/GENE-DB:IGHV6-3
definition	codon_start : 1 exception : rearrangement required for product

name	EG628398 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628398 IMGT/GENE-DB:IGHV6-4 MGI:3704120
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv6-4

name	EG639510 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:639510 IMGT/GENE-DB:IGHV6-5 MGI:3647134
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV6-5

name	Ighv6-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238427 IMGT/GENE-DB:IGHV6-6
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; VH10G1

name	EG432701 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432701 IMGT/GENE-DB:IGHV6-7 MGI:3644477
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV6-7

name	EG629849 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629849 IMGT/GENE-DB:IGHV8-2 MGI:3647474
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-2

name	Ighv1-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238428 IMGT/GENE-DB:IGHV1-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv10-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380808 IMGT/GENE-DB:IGHV10-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780859 IMGT/GENE-DB:IGHV1-3
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:432702 IMGT/GENE-DB:IGHV1-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv10-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780860 IMGT/GENE-DB:IGHV10-2
definition	codon_start : 1 pseudo : _no_value

name	EG668469 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668469 IMGT/GENE-DB:IGHV1-5 MGI:3704121
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-5

name	EG380809 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV10-3

name	Ighv1-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	codon_start : 1 pseudo : _no_value

name	EG668474 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-7

name	Ighv10-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	codon_start : 1 exception : rearrangement required for product

name	EG629860 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-12

name	Ighv1-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	codon_start : 1 exception : rearrangement required for product

name	EG629866 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	codon_start : 1 exception : rearrangement required for product

name	EG668493 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-19-1

name	Ighv1-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	codon_start : 1 exception : rearrangement required for product

name	EG668497 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-20

name	LOC382640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382640
definition	number : 2 pseudo : _no_value

name	LOC382640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382640
definition	number : 1 pseudo : _no_value

name	LOC676349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676349
definition	number : 3 pseudo : _no_value

name	LOC676349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676349
definition	number : 2 pseudo : _no_value

name	LOC676349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676349
definition	number : 1 pseudo : _no_value

name	Ighv5-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777683
definition	pseudo : _no_value standard_name : IGHV5-1

name	Ighv2-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777684
definition	pseudo : _no_value standard_name : IGHV2-1

name	Ighv5-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777685
definition	standard_name : IGHV5-2

name	Ighv2-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777686
definition	standard_name : IGHV2-2

name	Ighv5-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777687
definition	pseudo : _no_value standard_name : IGHV5-3

name	Ighv5-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777688
definition	standard_name : IGHV5-4

name	Ighv6-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777689
definition	pseudo : _no_value standard_name : IGHV6-1

name	Ighv2-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238412
definition	standard_name : IGHV2-3

name	Ighv5-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777779
definition	pseudo : _no_value standard_name : IGHV5-5

name	Ighv5-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777780
definition	standard_name : IGHV5-6

name	Ighv5-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777781
definition	pseudo : _no_value standard_name : IGHV5-7

name	EG668389 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668389
definition	gene_synonym : IGHV2-4 standard_name : IGHV2-4

name	Ighv5-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777782
definition	pseudo : _no_value standard_name : IGHV5-8

name	Ighv5-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:544896
definition	standard_name : IGHV5-9

name	Ighv5-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777783
definition	pseudo : _no_value standard_name : IGHV5-10

name	Ighv2-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:638605
definition	standard_name : IGHV2-5

name	Ighv5-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777784
definition	pseudo : _no_value standard_name : IGHV5-11

name	Ighv5-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668395
definition	standard_name : IGHV5-12

name	Ighv2-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:630486
definition	standard_name : IGHV2-6

name	Ighv5-9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:641178
definition	standard_name : IGHV5-9-1

name	EG628098 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628098
definition	gene_synonym : Ighv5-12-4 standard_name : IGHV5-12-4

name	Ighv2-9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:791089
definition	standard_name : IGHV2-9-1

name	Ighv5-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:790900
definition	standard_name : IGHV5-13

name	Ighv2-6-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:791090
definition	standard_name : Ighv2-6-8

name	EG629785 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629785
definition	gene_synonym : IGHV(III)-4 standard_name : IGHV(III)-4

name	Ighv2-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780793
definition	standard_name : IGHV2-7

name	Ighv5-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780792
definition	standard_name : IGHV5-15

name	Ighv5-16 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633568
definition	standard_name : IGHV5-16

name	Ighv5-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780794
definition	standard_name : IGHV5-17

name	Ighv5-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780796
definition	pseudo : _no_value standard_name : IGHV5-18

name	Ighv2-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780797
definition	pseudo : _no_value standard_name : IGHV2-8

name	Ighv2-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640046
definition	standard_name : IGHV2-9

name	Ighv5-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780798
definition	pseudo : _no_value standard_name : IGHV5-19

name	Ighv7-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780799
definition	pseudo : _no_value standard_name : IGHV7-1

name	Ighv7-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780800
definition	standard_name : IGHV7-2

name	Ighv14-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780801
definition	standard_name : IGHV14-1

name	Ighv4-1 (CDS detail)
type	V_segment
link	vega ensembl
xref
definition	standard_name : IGHV4-1

name	Ighv3-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780803
definition	standard_name : IGHV3-1

name	Ighv11-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780804
definition	standard_name : IGHV11-1

name	Ighv14-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668421
definition	standard_name : IGHV14-2

name	Ighv4-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668423
definition	pseudo : _no_value standard_name : IGHV4-2

name	Ighv3-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780817
definition	pseudo : _no_value standard_name : IGHV3-2

name	Ighv11-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780818
definition	standard_name : IGHV11-2

name	Ighv14-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238418
definition	standard_name : IGHV14-3

name	EG629812 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629812
definition	gene_synonym : IGHV5-20 standard_name : IGHV5-20

name	Ighv6-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780822
definition	pseudo : _no_value standard_name : IGHV6-2

name	Ighv9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:195180
definition	standard_name : IGHV9-1

name	Ighv12-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780823
definition	pseudo : _no_value standard_name : IGHV12-1

name	EG629818 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629818
definition	gene_synonym : IGHV9-2 standard_name : IGHV9-2

name	Ighv12-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780824
definition	pseudo : _no_value standard_name : IGHV12-2

name	Ighv9-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780825
definition	standard_name : IGHV9-3

name	Ighv7-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629822
definition	gene_synonym : IgH; V(11)-djn pseudo : _no_value standard_name : IGHV7-3

name	Ighv15-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780827
definition	pseudo : _no_value standard_name : IGHV15-1

name	Ighv14-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629826
definition	standard_name : IGHV14-4

name	EG668438 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668438
definition	gene_synonym : IGHV3-3 standard_name : IGHV3-3

name	Ighv7-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:632654
definition	gene_synonym : V(13)-b standard_name : IGHV7-4

name	EG629833 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629833
definition	gene_synonym : IGHV3-4 standard_name : IGHV3-4

name	EG633457 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633457
definition	gene_synonym : C72-3A1; IGHV3-5 standard_name : IGHV3-5

name	Ighv13-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780828
definition	standard_name : IGHV13-1

name	Ighv3-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780829
definition	standard_name : IGHV3-6

name	EG636260 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:636260
definition	gene_synonym : IgH; IGHV9-4; MRP5 standard_name : IGHV9-4

name	Ighv3-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780830
definition	pseudo : _no_value standard_name : IGHV3-7

name	Ighv5-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780832
definition	pseudo : _no_value standard_name : IGHV5-21

name	Ighv3-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780831
definition	standard_name : IGHV3-8

name	Ighv8-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780833
definition	pseudo : _no_value standard_name : IGHV8-1

name	Ighv1-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780834
definition	pseudo : _no_value standard_name : IGHV1-1

name	Ighv13-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629842
definition	standard_name : IGHV13-2

name	EG435321 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435321
definition	gene_synonym : IGHV12-3 standard_name : IGHV12-3

name	Ighv6-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629845
definition	standard_name : IGHV6-3

name	EG628398 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628398
definition	gene_synonym : Ighv6-4 standard_name : IGHV6-4

name	EG639510 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:639510
definition	gene_synonym : IGHV6-5 standard_name : IGHV6-5

name	Ighv6-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238427
definition	gene_synonym : IgH; VH10G1 standard_name : IGHV6-6

name	EG432701 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432701
definition	gene_synonym : IGHV6-7 standard_name : IGHV6-7

name	EG629849 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629849
definition	gene_synonym : IGHV8-2 standard_name : IGHV8-2

name	Ighv1-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238428
definition	pseudo : _no_value standard_name : IGHV1-2

name	Ighv10-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380808
definition	standard_name : IGHV10-1

name	Ighv1-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780859
definition	pseudo : _no_value standard_name : IGHV1-3

name	Ighv1-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432702
definition	standard_name : IGHV1-4

name	Ighv10-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780860
definition	pseudo : _no_value standard_name : IGHV10-2

name	EG668469 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668469
definition	gene_synonym : Ighv1-5 standard_name : IGHV1-5

name	EG380809 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380809
definition	gene_synonym : IgH; IGHV10-3 standard_name : IGHV10-3

name	Ighv1-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780861
definition	pseudo : _no_value standard_name : IGHV1-6

name	EG668474 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668474
definition	gene_synonym : Ighv1-7 standard_name : IGHV1-7

name	Ighv10-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780862
definition	pseudo : _no_value standard_name : IGHV10-4

name	Ighv1-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780863
definition	pseudo : _no_value standard_name : IGHV1-8

name	Ighv15-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780864
definition	standard_name : IGHV15-2

name	Ighv1-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668478
definition	standard_name : Ighv1-9

name	Ighv1-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:637050
definition	pseudo : _no_value standard_name : IGHV1-10

name	Ighv1-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629859
definition	standard_name : IGHV1-11

name	EG629860 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629860
definition	gene_synonym : IGHV1-12 standard_name : IGHV1-12

name	Ighv1-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780865
definition	pseudo : _no_value standard_name : IGHV1-13

name	Ighv1-14 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629863
definition	standard_name : IGHV1-14

name	Ighv1-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629865
definition	standard_name : IGHV1-15

name	EG629866 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629866
definition	gene_synonym : IGHV1-16 standard_name : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780926
definition	pseudo : _no_value standard_name : IGHV1-17-1

name	Ighv1-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629869
definition	pseudo : _no_value standard_name : IGHV1-17

name	Ighv1-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629871
definition	standard_name : IGHV1-18

name	EG668493 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668493
definition	gene_synonym : Ighv1-19-1 standard_name : IGHV1-19-1

name	Ighv1-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382692
definition	standard_name : IGHV1-19

name	EG668497 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668497
definition	gene_synonym : IGHV1-20 standard_name : IGHV1-20

name	Ighj4 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777656
definition	standard_name : IGHJ4

name	Ighj3 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777655
definition	standard_name : IGHJ3

name	Ighj2 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777654
definition	standard_name : IGHJ2

name	Ighj1 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777648
definition	standard_name : IGHJ1

name	Ighd4-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777661
definition	standard_name : IGHD4-1

name	Ighd3-2 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777662
definition	standard_name : IGHD3-2

name	Ighd5-6 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777663
definition	pseudo : _no_value standard_name : IGHD5-6

name	Ighd2-8 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777664
definition	standard_name : IGHD2-8

name	Ighd5-5 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777665
definition	pseudo : _no_value standard_name : IGHD5-5

name	Ighd2-7 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777667
definition	standard_name : IGHD2-7

name	Ighd5-8 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777669
definition	pseudo : _no_value standard_name : IGHV5-8

name	Ighd5-4 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777670
definition	pseudo : _no_value standard_name : IGHD5-4

name	Ighd2-6 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777672
definition	standard_name : IGHD2-6

name	Ighd5-7 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777673
definition	pseudo : _no_value standard_name : IGHD5-7

name	Ighd5-3 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777674
definition	pseudo : _no_value standard_name : IGHD5-3

name	Ighd2-5 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777675
definition	standard_name : IGHD2-5

name	Ighd2-4 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777677
definition	standard_name : IGHD2-4

name	Ighd6-2 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777678
definition	pseudo : _no_value standard_name : IGHD6-2

name	Ighd2-3 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777679
definition	standard_name : IGHD2-3

name	Ighd6-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777680
definition	pseudo : _no_value standard_name : IGHD6-1

name	Ighd1-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777657
definition	standard_name : IGHD1-1

name	Ighd3-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777681
definition	standard_name : IGHD3-1

name	Ighd5-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777682
definition	pseudo : _no_value standard_name : IGHD5-1

name	Igh-2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:238447
definition	gene_synonym : IgA; Igha standard_name : IGHA

name	Gm900 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380792
definition	gene_synonym : IGHE standard_name : IGHE

name	Igh-1b (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:404711
definition	gene_synonym : IGHG2C standard_name : IGHG2C

name	Igh-3 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16016
definition	gene_synonym : gamma2b; IgG2b; IGHG2B standard_name : IGHG2B

name	Ighg1 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16017
definition	gene_synonym : IgG1; Igh-4; VH7183 standard_name : IGHG`

name	AI324046 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380795
definition	gene_synonym : IgG3; IGHG3; MGC68300 standard_name : IGHG3

name	Igh-5 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380797
definition	gene_synonym : IgD; IGHD standard_name : IGHD

name	Igh-6 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16019
definition	gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH standard_name : IGHM

clone name	MSMg01-062P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417M23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176D11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-273E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538B23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488F18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517M02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-109N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-307F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-302I07.T7 (MSMg01no302_i07.b1)	MSMg01-302I07.TJ (MSMg01no302_i07.g1)
ACC	AG428385	AG428386
length	729	731
length of high quality (start - end)	319 (43 - 361)	292 (73 - 364)
definition	CHROMAT_FILE: MSMg01no302_i07.b1 PHD_FILE: MSMg01no302_i07.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:40:10 2005	CHROMAT_FILE: MSMg01no302_i07.g1 PHD_FILE: MSMg01no302_i07.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:40:10 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAAT TCTTCATGTCATTTGGATATTGGCCTTCCATGGGACTTAGGGATAGTGAA GAACTTTTTCTAATCTGTAGGCTGCCATTTTGTCTTATTGACTATGTCCT TTGCCTTACAGATTTTTTTCAGTTTCATGAGATCCTGTCTACCAATTTAT GATCCTAGAGCCTGAACCATTGTGGTTCTCTTCAGGGAATTGTCTCCTGT ATCAATGAGTTCAAAACTATTCTCCACTTTTTGTTCATTTAGATTTAGTT AATCCAGTATAGGTTGAAGTCTGCCATTCACTTTGATTTGAAGTTCGTGC AGGATGATATATATGAATCTACTCCGCCTCTAGATCAGCACCATTTGTTG GGGGATGCATTCTTTTTATTATGAGTTTTATTATGATTATTGGGTTCTTT ATCAAAAATCAAATGTCCATAAATGTGTGGTATTTTTTCAGAGCATTCGA TTCAATTCCATTGATCATTGTATGTGTTTCTATACAAATACCATGCAGTT TTTATTACTATTACTGTACAGTACAGCTTGAGGTCAGGGATGGTGATTTC TCCTGAAGTTGTTTCATTATTCAGGATTGTTTTAGCTTTATGAATTTGAG ATTTGCTTTTTCAAGGTACGTAATAAATTGGGTTGGAAATTTAATGGGAA TTGCACTGAATGTGTAGATTGATTTATTA	GACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXCAAGGAGATTCATGCCTTGTGAATCCAT CCCAATCTGATCTCAATCTTCAAACATGTTTGTGCATAATTTACATCTTA ATCAGTTGCTGGAAATTAAAAGGACATAAGCTAAACTTTAAAACTCTTTC TATTTAATGTGTCAGAATAGAATATGTGGACTGAAGTTTACATGTGCATA GGATATCATTGTTACAATGATGGTTCAGATATGCACCAGTAGCACAGGTG ATGCTTAACTGGAAAAAACTGTGACCAGAGCCCAGATGTTGATGTTGGCT GAAAGAACCTATTGTTCCATACTCCCACCCACCAGAAGTGTTATTCAGAG AAGCAGTGCTGGATTTGGGATCCATCTTAATGAATCAGCAACATGAGGAA GATTTGGAAGCCAGATTGATGAGATTACTATAATCCTGGTTCTGAACACA CAACACACAATAGTAAGTTGAACTTCTCCATGCAATGCTAAAGATAAAGC ATCCAGTATCATGTTACACAGGACCAAGCTGAGGATCAGTCTGTGGGTGA AATACAATGAACAGAAAGTCGGTTGGAATATATATATATATATATATATA TATATATATATATATATATATATATATATATATATATATATATATCNAAA CCNATATTTATATTTCTAATTCTTAAGGACG
quality values	Open. Hide. 6 6 9 15 37 39 37 33 32 32 28 28 30 30 30 30 33 33 33 33 39 43 35 30 30 32 32 36 44 53 53 53 50 57 57 57 57 42 42 37 36 36 42 59 68 68 47 47 47 47 51 51 51 51 50 50 50 51 68 68 68 68 68 68 50 50 50 50 50 51 68 68 68 68 68 68 51 51 50 50 50 48 50 50 50 51 51 68 68 68 51 51 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 52 52 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 54 57 57 54 54 57 57 59 59 68 68 68 59 57 53 53 53 53 53 57 59 57 57 57 57 57 57 59 59 59 59 50 50 50 41 41 34 24 13 10 8 8 8 9 12 15 12 18 19 10 8 8 8 6 6 10 10 10 10 12 12 18 11 13 18 41 41 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 53 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 48 43 41 41 35 41 39 44 47 48 59 59 59 68 68 59 59 57 57 47 59 43 43 43 44 47 48 57 57 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 54 54 52 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 57 57 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 47 47 47 48 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 57 57 50 50 50 50 50 50 42 41 44 44 39 31 32 37 37 37 47 41 41 41 48 50 50 59 59 59 47 47 47 59 43 41 31 32 32 37 37 37 37 37 37 37 37 37 41 41 41 29 31 37 34 39 36 36 36 37 37 36 36 37 41 41 41 39 44 37 31 31 37 37 37 59 34 34 28 37 37 39 43 41 41 41 59 37 37 41 32 29 29 31 41 41 41 41 41 41 41 44 44 44 47 47 41 41 39 39 34 34 37 37 37 37 41 44 44 41 41 41 41 34 35 30 30 23 23 23 30 34 37 37 39 39 37 31 34 23 23 18 25 21 26 12 19 17 32 30 25 25 24 28 18 21 17	Open. Hide. 8 8 8 6 9 19 17 30 30 30 33 30 35 44 37 37 41 42 37 39 50 50 53 53 57 50 50 50 50 50 43 43 34 29 28 22 29 29 48 32 48 42 42 48 48 42 47 47 47 50 50 46 46 37 43 43 59 33 48 36 36 41 48 44 68 68 50 50 50 50 50 50 50 50 50 50 57 46 46 46 50 48 50 54 54 57 59 59 59 59 54 57 57 57 57 50 50 50 50 50 50 51 51 50 50 50 57 57 57 57 57 50 50 50 50 50 50 57 57 57 57 57 57 57 57 57 57 57 57 54 57 54 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 57 57 57 57 57 57 57 68 68 68 68 57 57 57 57 57 59 57 57 57 59 59 59 59 62 62 62 62 59 59 59 59 57 57 59 59 59 59 57 57 57 59 59 57 57 57 57 52 57 57 44 44 31 28 28 43 43 35 35 35 43 43 57 57 57 57 52 57 57 57 57 57 57 57 57 59 57 59 59 57 54 54 54 59 59 59 59 59 57 57 57 57 57 57 57 59 59 57 59 54 59 57 57 57 57 54 57 57 57 57 57 59 59 44 44 31 31 31 44 44 59 59 59 59 59 57 57 57 57 54 57 57 59 59 59 59 54 54 54 57 57 57 57 59 59 57 57 57 57 54 57 57 68 68 57 57 48 48 48 48 48 48 48 46 46 43 46 46 57 57 59 44 43 43 43 43 43 59 48 57 57 59 57 59 59 48 59 47 43 43 43 44 37 39 32 34 22 24 15 15 14 11 8 8 8 8 8 10 10 10 9 8 8 8 8 11 8 8 8 8 8 9 11 11 18 25 34 47 47 59 48 48 48 41 41 25 25 25 43 43 57 57 57 57 48 48 48 59 59 48 48 48 53 50 57 59 43 43 37 43 37 47 34 28 21 13 12 12 11 11 11 12 15 15 15 11 22 23 43 30 26 18 18 26 24 28 25 30 25 25 28 28 28 28 28 43 43 57 57 48 48 43 43 43 57 57 53 50 43 43 28 28 28 43 37 48 48 59 59 59 59 59 59 59 59 59 47 59 59 59 59 59 37 32 35 37 41 41 47 47 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 48 57 57 59 59 59 59 59 57 57 57 54 54 54 48 59 48 48 48 48 48 50 50 42 42 43 42 42 57 59 59 59 57 59 59 57 57 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 48 48 48 57 57 50 57 54 57 57 57 54 50 50 44 57 52 52 52 57 52 52 52 59 59 48 44 44 43 43 43 57 57 57 57 57 68 57 57 59 59 54 54 48 57 48 57 57 57 57 57 57 57 57 68 57 68 68 68 68 59 59 57 57 57 59 59 59 59 59 54 54 54 59 59 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 59 59 59 59 59 48 46 46 46 46 48 59 59 59 59 59 59 53 53 50 50 50 50 59 59 36 23 16 3 0 3 16 13 15 3 0 3 13 10 15 10 9 8 8 10 16 13 15 15 8 8 6 6 8 6 8 9 9 9 11 13 10 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no302_i07.g1 MSMg01no302_i07.g1 CHROMAT_FILE:
MSMg01no302_i07.g1 PHD_FILE: MSMg01no302_i07.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:40:10 2005
         (292 letters)



>mm_chr12_114968654_114969345
          Length = 692

 Score =  366 bits (189), Expect = e-105
 Identities = 264/291 (90%), Gaps = 10/291 (3%)
 Strand = Plus / Minus

                                                                       
Query: 7   gattcatgccttgtgaatccatcccaatctgatctcaatcttcaaacatgtt--tg--tg 62
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |  ||  | 
Sbjct: 553 gattcatggcttgtgaatccatcccaatctgatctcaatcttcaaacatgatcatgatta 494

                                                                       
Query: 63  ca--taatttacatcttaatcagttgctggaaattaaaaggacataagctaaactttaaa 120
           ||  |||||||||||| || || ||||||| |||||||| ||||||||||||||||||||
Sbjct: 493 caagtaatttacatctaaagcatttgctgggaattaaaaagacataagctaaactttaaa 434

                                                                       
Query: 121 actctttctatttaatgtgtcagaatagaatatgtggactgaagtttacatgtgcatagg 180
           ||||||||||||||||| ||||||||||||||||||||| ||||| || |||||||||| 
Sbjct: 433 actctttctatttaatgggtcagaatagaatatgtggacggaagtctaaatgtgcataga 374

                                                                       
Query: 181 atatcattgttacaatgatggttcagatatgcaccagtagcacaggtgatgcttaac-tg 239
           ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||
Sbjct: 373 atatcattgttacaatgatggttcaaatacgcaccagtagcacaggtgatgcttaacatg 314

                                                              
Query: 240 gaaaaaac-tgtgaccagagcccagatgttgatgttggctgaaagaaccta 289
            ||||||| | ||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 313 -aaaaaacctatgaccagagcccagatgttgatgttggct-aaagagccta 265


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 7
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 292
Length of database: 692
Length adjustment: 9
Effective length of query: 283
Effective length of database: 683
Effective search space:   193289
Effective search space used:   193289
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information