MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-381C15
Chromosome	12 (Build37)
Map Location	113,006,854 - 113,007,137
singlet/doublet	singlet
Overlap gene	Klc1
Upstream gene	Wdr20a, Rage, 2810455K09Rik, LOC100041649, 2810452K22Rik, 4930573I19Rik, Ankrd9, 6030440G07Rik, Rcor1, 4930595D18Rik, Traf3, Amn, Cdc42bpb, A230065H16Rik, 1200009I06Rik, Tnfaip2, Gm266, Eif5, Mark3, Ckb, 6720458F09Rik, Bag5, 2810002N01Rik
Downstream gene	Xrcc3, Zfyve21, Ppp1r13b, LOC100041886, 2010107E04Rik, BC048943, Tdrd9, A530050D06Rik, Kif26a, A730018C14Rik, A530016L24Rik, Tmem179, 2610204M08Rik, Adssl1, Siva1, Akt1, EG382639, AW555464, LOC382640, Pld4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Wdr20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69641 MGI:1916891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rage (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26448 MGI:1347040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810455K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72805 MGI:1920055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein

name	LOC100041649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 367 ESTs, 3 Proteins

name	2810452K22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67236 MGI:1914486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930573I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104859 MGI:2144865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74251 MGI:1921501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030440G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77878 MGI:1925128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rcor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217864 MGI:106340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930595D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78062 MGI:1925312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Traf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22031 MGI:108041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Amn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93835 MGI:1934943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42bpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217866 MGI:2136459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230065H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380787 MGI:2685744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	1200009I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74190 MGI:1921363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfaip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21928 MGI:104960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm266 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212539 MGI:2685112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217869 MGI:95309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mark3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17169 MGI:1341865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ckb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12709 MGI:88407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6720458F09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328162 MGI:2443487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bag5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70369 MGI:1917619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810002N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68020 MGI:1915270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16593 MGI:107978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Xrcc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74335 MGI:1921585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfyve21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68520 MGI:1915770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21981 MGI:1336199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041886 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 6 Proteins pseudo : _no_value

name	2010107E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70257 MGI:1917507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048943 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217874 MGI:2675860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein

name	Tdrd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74691 MGI:1921941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins

name	A530050D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104816 MGI:2144822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif26a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668303 MGI:2447072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 89 ESTs, 3 Proteins

name	A730018C14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319590 MGI:2442339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530016L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319942 MGI:2443020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104885 MGI:2144891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610204M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70435 MGI:1917685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adssl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11565 MGI:87947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siva1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30954 MGI:1353606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11651 MGI:87986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382639 MGI:3644133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 21 ESTs, 4 Proteins

name	AW555464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217882 MGI:2145043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382640 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pld4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104759 MGI:2144765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742803 GeneID:69641 MGI:1916891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 20a transcript_id : NM_027149.2

name	Rage (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129968 GeneID:26448 MGI:1347040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : renal tumor antigen transcript_id : NM_011973.2

name	2810455K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263529 GeneID:72805 MGI:1920055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein product : RIKEN cDNA 2810455K09 gene transcript_id : XM_138271.7

name	LOC100041649 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263551 GeneID:100041649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 251 ESTs, 3 Proteins product : similar to brain protein 44-like protein, transcript variant 2 transcript_id : XM_001477002.1

name	LOC100041649 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263549 GeneID:100041649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 366 ESTs, 3 Proteins product : similar to brain protein 44-like protein, transcript variant 1 transcript_id : XM_001476987.1

name	2810452K22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344970 GeneID:67236 MGI:1914486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810452K22 gene transcript_id : NM_026048.3

name	4930573I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486689 GeneID:104859 MGI:2144865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930573I19 gene transcript_id : NM_001081057.1

name	Ankrd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802286 GeneID:74251 MGI:1921501
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 9 transcript_id : NM_175207.4

name	6030440G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393143 GeneID:77878 MGI:1925128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 6030440G07 gene transcript_id : XM_901637.2

name	Rcor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130783 GeneID:217864 MGI:106340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REST corepressor 1 transcript_id : NM_198023.2

name	4930595D18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263553 GeneID:78062 MGI:1925312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930595D18 gene transcript_id : XM_001477231.1

name	Traf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842404 GeneID:22031 MGI:108041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 3 transcript_id : NM_011632.2

name	Traf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842402 GeneID:22031 MGI:108041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 3 transcript_id : NM_001048206.1

name	Amn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077082 GeneID:93835 MGI:1934943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amnionless transcript_id : NM_033603.2

name	Cdc42bpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942080 GeneID:217866 MGI:2136459
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc42 binding protein kinase beta transcript_id : NM_183016.1

name	A230065H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393146 GeneID:380787 MGI:2685744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA A230065H16 gene transcript_id : XM_354697.3

name	1200009I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054027 GeneID:74190 MGI:1921363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200009I06 gene transcript_id : NM_028807.2

name	Tnfaip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678374 GeneID:21928 MGI:104960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor, alpha-induced protein 2 transcript_id : NM_009396.1

name	Gm266 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801866 GeneID:212539 MGI:2685112
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 266, (NCBI) transcript_id : NM_001033248.2

name	Eif5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430533 GeneID:217869 MGI:95309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 5 transcript_id : NM_173363.4

name	Eif5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430540 GeneID:217869 MGI:95309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 5 transcript_id : NM_178041.1

name	Mark3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378748 GeneID:17169 MGI:1341865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 3 transcript_id : NM_021516.2

name	Mark3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365044 GeneID:17169 MGI:1341865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 3 transcript_id : NM_022801.2

name	Ckb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131180 GeneID:12709 MGI:88407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : creatine kinase, brain transcript_id : NM_021273.3

name	6720458F09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386064 GeneID:328162 MGI:2443487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720458F09 gene transcript_id : NM_177374.3

name	Bag5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037204 GeneID:70369 MGI:1917619
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-associated athanogene 5 transcript_id : NM_027404.1

name	2810002N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21735434 GeneID:68020 MGI:1915270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002N01 gene transcript_id : NM_026511.1

name	Klc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131412177 GeneID:16593 MGI:107978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 1 transcript_id : NM_001025360.2

name	Klc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131412206 GeneID:16593 MGI:107978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 1 transcript_id : NM_001081959.1

name	Klc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131412197 GeneID:16593 MGI:107978
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 1 transcript_id : NM_008450.2

name	Xrcc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366270 GeneID:74335 MGI:1921585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-ray repair complementing defective repair in Chinese hamster cells 3 transcript_id : NM_028875.2

name	Zfyve21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980849 GeneID:68520 MGI:1915770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 21 transcript_id : NM_026752.2

name	Ppp1r13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45592935 GeneID:21981 MGI:1336199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 13B transcript_id : NM_011625.1

name	2010107E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387144 GeneID:70257 MGI:1917507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010107E04 gene transcript_id : NM_027360.2

name	BC048943 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393098 GeneID:217874 MGI:2675860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : cDNA sequence BC048943, transcript variant 1 transcript_id : XM_127170.7

name	BC048943 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393097 GeneID:217874 MGI:2675860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : cDNA sequence BC048943, transcript variant 2 transcript_id : XM_902085.2

name	Tdrd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263535 GeneID:74691 MGI:1921941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins product : tudor domain containing 9 transcript_id : XM_001475772.1

name	A530050D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487182 GeneID:104816 MGI:2144822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530050D06 gene transcript_id : NM_001081169.1

name	Kif26a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263556 GeneID:668303 MGI:2447072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 89 ESTs, 3 Proteins product : kinesin family member 26A transcript_id : XM_001477732.1

name	A730018C14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342465 GeneID:319590 MGI:2442339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730018C14 gene transcript_id : NM_176956.2

name	A530016L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383812 GeneID:319942 MGI:2443020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530016L24 gene transcript_id : NM_177039.3

name	Tmem179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125660459 GeneID:104885 MGI:2144891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 179 transcript_id : NM_178915.3

name	2610204M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052808 GeneID:70435 MGI:1917685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610204M08 gene transcript_id : NM_198411.2

name	Adssl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671518 GeneID:11565 MGI:87947
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylosuccinate synthetase like 1 transcript_id : NM_007421.1

name	Siva1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305492 GeneID:30954 MGI:1353606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SIVA1, apoptosis-inducing factor transcript_id : NM_013929.1

name	Akt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891722 GeneID:11651 MGI:87986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymoma viral proto-oncogene 1 transcript_id : NM_009652.2

name	EG382639 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263560 GeneID:382639 MGI:3644133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 21 ESTs, 4 Proteins product : predicted gene, EG382639, transcript variant 2 transcript_id : XM_356600.6

name	EG382639 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263558 GeneID:382639 MGI:3644133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 19 ESTs, 4 Proteins product : predicted gene, EG382639, transcript variant 1 transcript_id : XM_001477883.1

name	AW555464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352514 GeneID:217882 MGI:2145043
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW555464 transcript_id : NM_001024602.2

name	Pld4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801925 GeneID:104759 MGI:2144765
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D family, member 4 transcript_id : NM_178911.3

name	Wdr20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742804 CCDS:CCDS26173.1 GeneID:69641 MGI:1916891
definition	codon_start : 1 product : WD repeat domain 20 protein_id : NP_081425.2

name	Rage (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106391 GeneID:26448 MGI:1347040
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : MOK protein kinase; MAPK/MAK/MRK/ overlapping kinase product : MAPK/MAK/MRK overlapping kinase protein_id : NP_036103.1

name	2810455K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263530 GeneID:72805 MGI:1920055
definition	codon_start : 1 product : hypothetical protein LOC72805 protein_id : XP_138271.6

name	LOC100041649 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263550 GeneID:100041649
definition	codon_start : 1 product : similar to brain protein 44-like protein isoform 1 protein_id : XP_001477037.1

name	LOC100041649 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263552 GeneID:100041649
definition	codon_start : 1 product : similar to brain protein 44-like protein isoform 2 protein_id : XP_001477052.1

name	2810452K22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361248 GeneID:67236 MGI:1914486
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 2-interacting protein protein_id : NP_080324.1

name	4930573I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486690 GeneID:104859 MGI:2144865
definition	codon_start : 1 product : hypothetical protein LOC104859 protein_id : NP_001074526.1

name	Ankrd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75991698 CCDS:CCDS26174.1 GeneID:74251 MGI:1921501
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : ankyrin repeat domain 9 protein_id : NP_780416.2

name	6030440G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943186 GeneID:77878 MGI:1925128
definition	codon_start : 1 product : hypothetical protein LOC77878 protein_id : XP_906730.1

name	Rcor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930559 GeneID:217864 MGI:106340
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : REST corepressor 1 protein_id : NP_932140.1

name	4930595D18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263554 GeneID:78062 MGI:1925312
definition	codon_start : 1 product : hypothetical protein LOC78062 protein_id : XP_001477281.1

name	Traf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842405 CCDS:CCDS26175.1 GeneID:22031 MGI:108041
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : Tnf receptor-associated factor 3 isoform a protein_id : NP_035762.2

name	Traf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842403 GeneID:22031 MGI:108041
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : Tnf receptor-associated factor 3 isoform b protein_id : NP_001041671.1

name	Amn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077083 GeneID:93835 MGI:1934943
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007588 - excretion [Evidence IMP]; GO:0008104 - protein localization [Evidence IMP] codon_start : 1 note : type I transmembrane protein product : amnionless protein_id : NP_291081.2

name	Cdc42bpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942081 CCDS:CCDS26176.1 GeneID:217866 MGI:2136459
definition	GO_component : GO:0005911 - intercellular junction [Evidence ISS]; GO:0031252 - leading edge [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031532 - actin cytoskeleton reorganization [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Cdc42 binding protein kinase beta protein_id : NP_898837.1

name	A230065H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38073748 GeneID:380787 MGI:2685744
definition	codon_start : 1 product : hypothetical protein protein_id : XP_354697.1

name	1200009I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054028 CCDS:CCDS26177.1 GeneID:74190 MGI:1921363
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74190 protein_id : NP_083083.2

name	Tnfaip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678375 CCDS:CCDS26178.1 GeneID:21928 MGI:104960
definition	GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : tumor necrosis factor induced protein 2 product : tumor necrosis factor, alpha-induced protein 2 protein_id : NP_033422.1

name	Gm266 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677504 CCDS:CCDS26179.1 GeneID:212539 MGI:2685112
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC212539 protein_id : NP_001028420.1

name	Eif5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29893569 CCDS:CCDS26180.1 GeneID:217869 MGI:95309
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 5 protein_id : NP_775539.1

name	Eif5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430541 GeneID:217869 MGI:95309
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 5 protein_id : NP_829887.1

name	Mark3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12313871 CCDS:CCDS26181.1 GeneID:17169 MGI:1341865
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; ELKL motif kinase 2 long form; EMK2/MARK3 serine-threonine protein kinase product : MAP/microtubule affinity-regulating kinase 3 isoform 1 protein_id : NP_067491.1

name	Mark3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12313875 CCDS:CCDS26182.1 GeneID:17169 MGI:1341865
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; ELKL motif kinase 2 long form; EMK2/MARK3 serine-threonine protein kinase product : MAP/microtubule affinity-regulating kinase 3 isoform 2 protein_id : NP_073712.1

name	Ckb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946574 CCDS:CCDS26183.1 GeneID:12709 MGI:88407
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004111 - creatine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] codon_start : 1 product : creatine kinase, brain protein_id : NP_067248.1

name	6720458F09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893533 CCDS:CCDS26184.1 GeneID:328162 MGI:2443487
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016429 - tRNA (adenine-N1-)-methyltransferase activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC328162 protein_id : NP_796348.1

name	Bag5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037205 CCDS:CCDS26185.1 GeneID:70369 MGI:1917619
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : BCL2-associated athanogene 5 protein_id : NP_081680.1

name	2810002N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735435 CCDS:CCDS26186.1 GeneID:68020 MGI:1915270
definition	codon_start : 1 product : hypothetical protein LOC68020 protein_id : NP_080787.1

name	Klc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131412178 GeneID:16593 MGI:107978
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0035253 - ciliary rootlet [Evidence IDA] [Evidence IPI]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008088 - axon cargo transport [Evidence IMP] codon_start : 1 note : isoform 1D is encoded by transcript variant d; kinesin 2 60/70kDa product : kinesin light chain 1 isoform 1D protein_id : NP_001020531.2

name	Klc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131412207 GeneID:16593 MGI:107978
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0035253 - ciliary rootlet [Evidence IDA] [Evidence IPI]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008088 - axon cargo transport [Evidence IMP] codon_start : 1 note : isoform 1H is encoded by transcript variant h; kinesin 2 60/70kDa product : kinesin light chain 1 isoform 1H protein_id : NP_001075428.1

name	Klc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131412198 GeneID:16593 MGI:107978
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0035253 - ciliary rootlet [Evidence IDA] [Evidence IPI]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008088 - axon cargo transport [Evidence IMP] codon_start : 1 note : isoform 1A is encoded by transcript variant a; kinesin 2 60/70kDa product : kinesin light chain 1 isoform 1A protein_id : NP_032476.2

name	Xrcc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312694 CCDS:CCDS26187.1 GeneID:74335 MGI:1921585
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : X-ray repair complementing defective repair in Chinese hamster cells 3 protein_id : NP_083151.1

name	Zfyve21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980850 GeneID:68520 MGI:1915770
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger, FYVE domain containing 21 protein_id : NP_081028.2

name	Ppp1r13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592936 GeneID:21981 MGI:1336199
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS] codon_start : 1 note : tumor protein p53-binding protein, 2; tumor protein p53 binding protein, 2; transformation related protein 53 binding protein 2 product : apoptosis-stimulating protein of p53, 1 protein_id : NP_035755.1

name	2010107E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312554 GeneID:70257 MGI:1917507
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC70257 protein_id : NP_081636.1

name	BC048943 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25071028 GeneID:217874 MGI:2675860
definition	codon_start : 1 product : similar to hCG1646947 isoform 1 protein_id : XP_127170.2

name	BC048943 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82942950 GeneID:217874 MGI:2675860
definition	codon_start : 1 product : similar to hCG1646947 isoform 2 protein_id : XP_907178.1

name	Tdrd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263536 GeneID:74691 MGI:1921941
definition	codon_start : 1 product : tudor domain containing 9 protein_id : XP_001475822.1

name	A530050D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487183 GeneID:104816 MGI:2144822
definition	GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence ISS]; GO:0004067 - asparaginase activity [Evidence IEA] [Evidence ISS]; GO:0004622 - lysophospholipase activity [Evidence ISS] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC104816 protein_id : NP_001074638.1

name	Kif26a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263557 GeneID:668303 MGI:2447072
definition	codon_start : 1 product : similar to KIAA1236 protein protein_id : XP_001477782.1

name	A730018C14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892773 GeneID:319590 MGI:2442339
definition	codon_start : 1 product : hypothetical protein LOC319590 protein_id : NP_795930.1

name	A530016L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892925 GeneID:319942 MGI:2443020
definition	codon_start : 1 product : hypothetical protein LOC319942 protein_id : NP_796013.1

name	Tmem179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125660460 GeneID:104885 MGI:2144891
definition	codon_start : 1 product : hypothetical protein LOC104885 protein_id : NP_849246.2

name	2610204M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052809 GeneID:70435 MGI:1917685
definition	codon_start : 1 product : formin, inverted protein_id : NP_940803.2

name	Adssl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671519 CCDS:CCDS26192.1 GeneID:11565 MGI:87947
definition	GO_function : GO:0004019 - adenylosuccinate synthase activity [Evidence IDA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006164 - purine nucleotide biosynthesis [Evidence IDA]; GO:0006163 - purine nucleotide metabolism [Evidence TAS] codon_start : 1 note : adenylosuccinate synthetase 1, muscle; adenylosuccinate synthetase, muscle product : adenylosuccinate synthetase 1 protein_id : NP_031447.1

name	Siva1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305493 CCDS:CCDS26193.1 GeneID:30954 MGI:1353606
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005175 - CD27 receptor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Cd27 binding protein (Hindu God of destruction) protein_id : NP_038957.1

name	Akt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753034 CCDS:CCDS26194.1 GeneID:11651 MGI:87986
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042640 - anagen [Evidence IMP]; GO:0006915 - apoptosis [Evidence IDA]; GO:0008637 - apoptotic mitochondrial changes [Evidence IDA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007281 - germ cell development [Evidence IDA]; GO:0006006 - glucose metabolism [Evidence IEA]; GO:0015758 - glucose transport [Evidence IMP]; GO:0005978 - glycogen biosynthesis [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence ISS] [Evidence IMP]; GO:0048009 - insulin-like growth factor receptor signaling pathway [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence ISS]; GO:0030163 - protein catabolism [Evidence IDA]; GO:0016567 - protein ubiquitination [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0045884 - regulation of survival gene product activity [Evidence IDA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0009725 - response to hormone stimulus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : thymoma viral proto-oncogene 1 protein_id : NP_033782.1

name	EG382639 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263559 GeneID:382639 MGI:3644133
definition	codon_start : 1 product : similar to hCG1802417, isoform 1 protein_id : XP_001477933.1

name	EG382639 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63635383 GeneID:382639 MGI:3644133
definition	codon_start : 1 product : similar to hCG1802417, isoform 2 protein_id : XP_356600.3

name	AW555464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677549 GeneID:217882 MGI:2145043
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC217882 protein_id : NP_001019773.1

name	Pld4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725764 CCDS:CCDS26195.1 GeneID:104759 MGI:2144765
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phospholipase D4 product : phospholipase D family, member 4 protein_id : NP_849242.1

name	LOC382640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382640
definition	number : 2 pseudo : _no_value

name	LOC382640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382640
definition	number : 1 pseudo : _no_value

name	LOC100041886 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263555 GeneID:100041886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 6 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_033328.1

clone name	MSMg01-144G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-381C15.T7 (MSMg01no381_c15.b1)	MSMg01-381C15.TJ (MSMg01no381_c15.g1)
ACC	AG485369	AG485370
length	732	831
length of high quality (start - end)	284 (319 - 602)	---
definition	CHROMAT_FILE: MSMg01no381_c15.b1 PHD_FILE: MSMg01no381_c15.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:22:28 2005	CHROMAT_FILE: MSMg01no381_c15.g1 PHD_FILE: MSMg01no381_c15.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:22:28 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXTTCAAGAGCATGCGCGGAATTCTTCTGA TTACTGATATATTTGTTATGGTTATTTCTCTGAGAACAGCTAATATTATT TTGGCAGCTGCAAGCTTAGTCATTTTAACCGACATAACTATGTTTTTGCA TTTGTGTAGTCAGCCAAGCGAGAGAGTGAGAGTGCACATGAGCTCATACA CTTTTTCAAACGAAGTTCAAGTTCACGAGCTATGTGTGGAGTATGAGGCT GGCGTAGGCTAAACAGTTTTGGAGGGCATTTTCATACTTGTATGTTATGA AAATGAACCTCTCTTGTCGTTTCATGACTGTCAAGGTTTCCACCTACACC ATGGAGAGCTGAGACAAGCTGATGTGACTCGAGTTCCCTCCGCTCTAACC AAGGCTTTTCGACATCCTGCCCTGCACACATACCTGCTACACTAACACAT ATTTCCCACTGCTTTCTGTTTGCCAGCAGGGGTGGGGACCAATGTCTAAC AGGCTAGAAGTCTAGACCTTCAAGGCTTCTTCAGATGCAGAAAGGATCTT TTTGCCACAATAAAAAAATAGACTGATGTAACAATGGACCAAGAATAGAA CTTCTGAACACACTGAATTCGCTTTGCCTTTGTTTTCGCCCTTCTTTCTT TTCTTTTAAAGATTTATTTACTTAGCATATGCNAGCACTCTGCAACCTGC CTTCCTATACCTCCACAATAAGGCCTCCCAAA	AACGGAAAGCCCGGGGNNNNNCCGCGTCGGTACCCGCCTTGNNNNNNNNN NNNTTACAAGCACAGCANGGGNNNNGNNNGGNNNNGGGGNNNGGGGCGGN NNGGGGCTTTTCCCCTGAGCTGGTGTNGGGGGGTTTTTGGGGGGGGCTTT TTTTTGTGGGGGGGGGCGTNGTTNTTCGTNGTTTGTTGGTGGTGGGGGTG GTGTGAGCCCGCCGGCGCGCGCGCGTCCCGGGCCCGGGGCGGTTTTTTTT GCGCGGGCGCGGCCGCGGGGCGGGCCCGGCGCGGCGCGGGCCGCCCCCGC CGCCGACCTTTTAGTGGTGTTGCAAAAAAACAACCACGCAGGGGAGGAAT TTTTCCCCCCCCCCAAAGAAAAAAAGGGAGGAGGAGGAANGAAAGGCGGA CAAAACCCCCCCCCCCCCGGGCATAAAAGAATCCAGCACCATGAGACAGA CAGAACCAAGAGCGGCAGACAGACACAAAGTATAGGGGTGACCGCAAACA GTCGAGAGGGCAGCCAACACAAACACCGAACCTAGTGACCCAAACAGACA ACAACACGGGGAATTACTCCTTAATCCCAAAAAAGATAGCGAACACGAAG TAGCCAAAAATACGCGGGAGGAAGAGACCAANGATAAGCAGGGCACAAGA CACAACGAAAAAAACGTAGCCGCGATGACAACGACACACACACGGACAAA CGGAGACCCATTTTTTATTTTTTTTTAAACAGAGGCGCGGGGAGACACCC AAAGAAAAACACGAGGGGACGAGCGGCGACAAAAAAAGTGCGGAACGAAG ACGAGGACAATCGAACGGATATATATTACGG
quality values	Open. Hide. 11 11 23 21 18 17 12 10 8 8 8 26 26 59 30 28 28 19 13 11 12 6 9 9 7 6 6 9 9 9 9 9 9 9 9 16 27 31 37 37 37 37 39 37 59 36 29 20 9 11 10 10 10 10 12 11 13 12 10 10 10 10 18 21 30 33 33 37 50 50 53 53 57 57 53 53 53 53 53 53 53 57 57 53 53 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 59 50 46 42 39 41 41 42 42 32 35 35 42 59 59 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 68 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 40 34 27 17 17 17 24 32 44 59 59 59 68 68 59 59 57 59 57 68 68 68 57 57 48 48 48 48 57 59 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 47 41 30 28 10 8 8 7 6 6 6 6 6 6 9 15 12 18 28 34 50 50 50 50 59 59 59 57 57 57 57 57 57 59 59 59 57 57 57 53 53 53 53 68 68 57 57 43 46 46 43 43 36 43 43 47 47 47 59 57 57 57 57 57 57 57 59 59 59 59 59 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 57 68 68 57 57 57 57 68 68 68 68 68 59 59 59 59 54 54 47 57 47 47 47 48 46 43 43 43 39 39 37 37 43 43 39 46 39 39 41 42 47 59 43 43 43 48 48 48 59 43 57 57 59 43 40 40 43 47 39 47 40 43 37 37 37 37 37 37 39 36 36 37 39 36 41 39 39 39 40 37 37 28 28 23 32 24 21 15 18 24 34 43 37 37 36 36 36 37 59 59 37 30 18 17 11 11 12 18 18 30 23 29 32 31 29 39 34 32 23 18 21 28 28 32 23 23 14 14 14 28 14 14 14 28 24 37 37 31 31 35 31 31 28 27 33 23 23 11 13 16 18 21 14 19 18 8 8 8 8 8 20 15 18 22 30 21 20 14 12 9 9 10 8 8 6 6 8 7 10 14 12 13 13 14 10 10 9 8 8 8 6 6 8 11 8 8 8 8 8 8 8 8 11 11 18 19 19 19 19 19 15 15 18 19 17 12 12 13 15 16 21 12 11 11 12 8 8 8 8 8 3 0 3 13 13 14 12 12 10 8 6 6 6 6 8 9 9 9 9 10 13 10 10 10 10 10 10 10 9 9 7 7 8 8 7 6 6 6 6 6 6 9 8 8 8 8 6 6 6 8 8	Open. Hide. 12 15 14 10 10 9 9 8 8 8 12 8 8 13 17 3 0 0 0 0 0 3 8 6 3 3 3 6 6 7 7 7 8 8 8 8 7 9 9 9 3 0 0 0 0 0 0 0 0 0 0 0 0 3 7 7 6 8 6 6 6 8 8 7 9 9 3 0 3 12 3 0 0 0 0 3 0 0 0 3 3 0 0 0 0 3 12 12 3 0 0 0 3 8 8 6 7 8 3 0 0 0 3 9 9 11 12 11 12 11 9 8 10 9 7 7 7 6 6 6 6 6 6 7 6 3 0 3 11 8 8 8 19 10 8 8 8 8 17 12 6 6 6 6 6 6 11 13 9 8 8 8 6 6 6 6 6 6 10 13 11 12 13 14 17 10 9 9 3 0 3 10 3 0 3 6 8 10 3 0 3 6 6 6 6 6 6 8 7 9 6 6 6 6 6 6 9 9 9 6 6 6 6 8 6 8 7 7 9 7 11 16 12 11 10 8 8 8 8 8 8 8 8 8 9 9 11 9 9 9 9 10 8 15 9 9 9 9 9 8 8 6 7 8 9 14 26 19 17 11 9 9 9 9 16 9 9 9 9 8 8 6 7 10 8 8 8 8 8 10 8 8 8 6 6 6 6 6 6 8 8 8 8 8 7 7 8 8 8 8 8 8 8 10 11 11 11 10 9 9 9 6 6 6 6 6 6 8 6 6 7 6 6 6 8 6 6 6 6 6 6 9 8 10 14 14 15 13 13 8 6 6 8 8 8 8 13 10 11 10 11 9 8 14 8 8 8 6 6 6 12 21 15 18 18 15 13 12 9 9 9 15 10 10 10 10 10 11 15 12 11 11 8 8 8 8 8 8 11 10 13 12 10 10 9 9 9 12 3 0 3 8 8 8 8 8 8 10 10 15 11 9 9 9 9 9 10 10 10 11 10 10 15 16 17 15 13 9 8 7 6 6 6 6 8 10 10 10 8 8 6 6 8 6 8 8 8 8 8 8 8 6 6 6 8 10 10 10 10 6 6 8 8 8 10 8 10 8 8 8 8 8 8 9 8 8 8 8 8 10 9 6 8 8 8 7 6 8 8 10 8 8 8 8 8 8 15 12 12 11 11 15 12 11 11 9 10 8 8 8 8 8 8 8 9 8 10 8 10 9 11 11 11 11 8 6 6 6 6 6 9 11 11 15 11 11 10 9 9 9 9 9 8 8 6 7 7 11 12 10 9 10 8 8 8 8 8 7 6 6 8 8 10 8 8 6 6 10 8 8 8 8 6 6 8 6 6 8 8 9 9 8 8 8 8 8 8 11 10 12 11 13 13 10 10 8 8 8 8 6 6 8 8 11 10 9 9 9 12 8 6 6 6 8 8 9 11 20 19 12 12 8 8 6 6 8 6 6 7 7 7 7 8 8 8 8 8 8 8 8 3 0 3 9 9 10 10 8 8 6 6 8 8 10 7 6 8 8 6 6 8 6 6 8 8 8 6 6 8 8 10 10 8 10 8 8 8 8 8 8 8 8 10 10 10 11 8 8 8 8 6 6 8 8 8 8 8 8 6 6 8 8 10 10 10 9 9 7 10 10 10 8 6 6 8 8 8 8 8 8 8 13 16 9 8 6 6 6 6 12 10 17 12 12 10 9 9 10 9 8 8 8 7 7 6 8 10 9 10 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 18 10 8 8 8 8 8 8 11 8 8 8 8 8 8 8 8 8 8 9 12 11 11 11 18 18 12 12 8 8 8 6 6 6 6 8 8 6 6 6 6 10 12 10 8 8 8 8 6 8 6 6 10 8 8 8 8 8 8 8 8 8 8 8 8 10 12 8 8 7 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no381_c15.b1 MSMg01no381_c15.b1 CHROMAT_FILE:
MSMg01no381_c15.b1 PHD_FILE: MSMg01no381_c15.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:22:28 2005
         (284 letters)



>mm_chr12_113006654_113007337
          Length = 684

 Score =  549 bits (284), Expect = e-161
 Identities = 284/284 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   gtttcatgactgtcaaggtttccacctacaccatggagagctgagacaagctgatgtgac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 gtttcatgactgtcaaggtttccacctacaccatggagagctgagacaagctgatgtgac 260

                                                                       
Query: 61  tcgagttccctccgctctaaccaaggcttttcgacatcctgccctgcacacatacctgct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tcgagttccctccgctctaaccaaggcttttcgacatcctgccctgcacacatacctgct 320

                                                                       
Query: 121 acactaacacatatttcccactgctttctgtttgccagcaggggtggggaccaatgtcta 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 acactaacacatatttcccactgctttctgtttgccagcaggggtggggaccaatgtcta 380

                                                                       
Query: 181 acaggctagaagtctagaccttcaaggcttcttcagatgcagaaaggatctttttgccac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 acaggctagaagtctagaccttcaaggcttcttcagatgcagaaaggatctttttgccac 440

                                                       
Query: 241 aataaaaaaatagactgatgtaacaatggaccaagaatagaact 284
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 aataaaaaaatagactgatgtaacaatggaccaagaatagaact 484


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 13
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 284
Length of database: 684
Length adjustment: 9
Effective length of query: 275
Effective length of database: 675
Effective search space:   185625
Effective search space used:   185625
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information