MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-022F23
Chromosome	13 (Build37)
Map Location	14,198,219 - 14,199,280
singlet/doublet	singlet
Overlap gene	Arid4b
Upstream gene	LOC434483, LOC674723, Prl2c5, LOC630611, LOC100039786, LOC385049, LOC630663, LOC100040108, Gpr137b, LOC664960, Nid1, Lyst, LOC100039831, Gng4, EG665000, EG665008, LOC630894, LOC100040205, B3galnt2, Tbce, Ggps1, LOC100040243
Downstream gene	LOC100039916, Hecw1, Mrpl32, Psma2, AW209491, EG665099, LOC670994
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC434483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC674723 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Prl2c5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107849 MGI:1858413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC630611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039786 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 1049 ESTs, 37 Proteins

name	LOC385049 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins

name	LOC630663 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 55 ESTs, 9 Proteins

name	LOC100040108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Gpr137b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83924 MGI:1891463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 21 Proteins pseudo : _no_value

name	Nid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18073 MGI:97342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyst (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17101 MGI:107448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gng4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14706 MGI:102703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665000 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665000 MGI:3644941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665008 MGI:3644947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 650 ESTs, 15 Proteins pseudo : _no_value

name	LOC630894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	B3galnt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97884 MGI:2145517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbce (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70430 MGI:1917680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14593 MGI:1341724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs

name	Arid4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94246 MGI:2137512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039916 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Hecw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94253 MGI:2444115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75398 MGI:2137226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psma2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19166 MGI:104885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW209491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105351 MGI:2145422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665099 MGI:3647001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC670994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 551 ESTs, 13 Proteins pseudo : _no_value

name	Prl2c5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49258207 GeneID:107849 MGI:1858413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 2, subfamily c, member 5 transcript_id : NM_181852.1

name	LOC100039786 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263878 GeneID:100039786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 1049 ESTs, 37 Proteins product : similar to Ywhaq protein transcript_id : XM_001473500.1

name	LOC385049 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263880 GeneID:385049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins product : similar to Rho-associated kinase beta transcript_id : XM_001473528.1

name	LOC630663 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263882 GeneID:630663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 55 ESTs, 9 Proteins product : similar to Proliferin-3 precursor (Mitogen-regulated protein 3) transcript_id : XM_001473551.1

name	LOC100040108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263897 GeneID:100040108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100040108 transcript_id : XM_001474087.1

name	Gpr137b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14269573 GeneID:83924 MGI:1891463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 137B transcript_id : NM_031999.1

name	Nid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754853 GeneID:18073 MGI:97342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nidogen 1 transcript_id : NM_010917.1

name	Lyst (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955375 GeneID:17101 MGI:107448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal trafficking regulator transcript_id : NM_010748.2

name	LOC100039831 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263886 GeneID:100039831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039831 transcript_id : XM_001473628.1

name	Gng4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542900 GeneID:14706 MGI:102703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 4 subunit transcript_id : NM_010317.2

name	LOC100040205 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263900 GeneID:100040205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100040205 transcript_id : XM_001474246.1

name	B3galnt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130611 GeneID:97884 MGI:2145517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2 transcript_id : NM_178640.2

name	Tbce (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130586 GeneID:70430 MGI:1917680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin-specific chaperone e transcript_id : NM_178337.2

name	Ggps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271502 GeneID:14593 MGI:1341724
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : geranylgeranyl diphosphate synthase 1 transcript_id : NM_010282.2

name	LOC100040243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263902 GeneID:100040243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs product : hypothetical protein LOC100040243 transcript_id : XM_001474366.1

name	Arid4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37694071 GeneID:94246 MGI:2137512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 4B (Rbp1 like) transcript_id : NM_194262.1

name	Arid4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37694069 GeneID:94246 MGI:2137512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 4B (Rbp1 like) transcript_id : NM_198122.1

name	Hecw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486826 GeneID:94253 MGI:2444115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 transcript_id : NM_001081348.1

name	Mrpl32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372971 GeneID:75398 MGI:2137226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L32 transcript_id : NM_029271.2

name	Psma2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031993 GeneID:19166 MGI:104885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, alpha type 2 transcript_id : NM_008944.2

name	AW209491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801141 GeneID:105351 MGI:2145422
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW209491 transcript_id : NM_134067.3

name	Prl2c5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49258208 CCDS:CCDS26242.1 GeneID:107849 MGI:1858413
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : mitogen regulated protein, proliferin 4 product : prolactin family 2, subfamily c, member 5 protein_id : NP_862900.1

name	LOC100039786 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263879 GeneID:100039786
definition	codon_start : 1 product : similar to Ywhaq protein protein_id : XP_001473550.1

name	LOC385049 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263881 GeneID:385049
definition	codon_start : 1 product : similar to Rho-associated kinase beta protein_id : XP_001473578.1

name	LOC630663 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263883 GeneID:630663
definition	codon_start : 1 product : similar to Proliferin-3 precursor (Mitogen-regulated protein 3) protein_id : XP_001473601.1

name	LOC100040108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263898 GeneID:100040108
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474137.1

name	Gpr137b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14269574 CCDS:CCDS26243.1 GeneID:83924 MGI:1891463
definition	codon_start : 1 exception : mismatches in translation product : transmembrane 7 superfamily member 1 protein_id : NP_114388.1

name	Nid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754854 CCDS:CCDS26244.1 GeneID:18073 MGI:97342
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA] [Evidence IPI] [Evidence TAS]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IDA] codon_start : 1 exception : mismatches in translation note : entactin 1 product : nidogen 1 protein_id : NP_035047.1

name	Lyst (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955376 GeneID:17101 MGI:107448
definition	GO_process : GO:0015031 - protein transport [Evidence IEA] codon_start : 1 product : lysosomal trafficking regulator protein_id : NP_034878.2

name	LOC100039831 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263887 GeneID:100039831
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473678.1

name	Gng4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754024 GeneID:14706 MGI:102703
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 4 subunit protein_id : NP_034447.1

name	LOC100040205 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263901 GeneID:100040205
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474296.1

name	B3galnt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47716521 CCDS:CCDS26246.1 GeneID:97884 MGI:2145517
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008376 - acetylgalactosaminyltransferase activity [Evidence ISS]; GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA]; GO:0019276 - UDP-N-acetylgalactosamine metabolism [Evidence ISS] codon_start : 1 product : UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2 protein_id : NP_848755.1

name	Tbce (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543843 CCDS:CCDS26247.1 GeneID:70430 MGI:1917680
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence TAS] GO_process : GO:0007024 - alpha-tubulin folding [Evidence TAS]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0007021 - tubulin folding [Evidence TAS] codon_start : 1 note : progressive motor neuropathy product : tubulin-specific chaperone e protein_id : NP_848027.1

name	Ggps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6806915 CCDS:CCDS26248.1 GeneID:14593 MGI:1341724
definition	GO_component : GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004161 - dimethylallyltranstransferase activity [Evidence IEA]; GO:0004311 - farnesyltranstransferase activity [Evidence IEA] [Evidence ISS]; GO:0004337 - geranyltranstransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008299 - isoprenoid biosynthesis [Evidence IEA] codon_start : 1 note : GGPP synthase product : geranylgeranyl diphosphate synthase 1 protein_id : NP_034412.1

name	LOC100040243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263903 GeneID:100040243
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474416.1

name	Arid4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37694072 GeneID:94246 MGI:2137512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000785 - chromatin [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006333 - chromatin assembly or disassembly [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; breast cancer-associated antigen; RBP1-like protein; retinoblastoma binding protein 1-like 1 product : retinoblastoma binding protein 1-like 1 isoform 1 protein_id : NP_919238.1

name	Arid4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37694070 GeneID:94246 MGI:2137512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000785 - chromatin [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006333 - chromatin assembly or disassembly [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; breast cancer-associated antigen; RBP1-like protein; retinoblastoma binding protein 1-like 1 product : retinoblastoma binding protein 1-like 1 isoform 2 protein_id : NP_937755.1

name	Hecw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486827 GeneID:94253 MGI:2444115
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : HECT type E3 ubiquitin ligase product : HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 protein_id : NP_001074817.1

name	Mrpl32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312948 CCDS:CCDS26249.1 GeneID:75398 MGI:2137226
definition	GO_component : GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence ISS]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS]; GO:0006626 - protein targeting to mitochondrion [Evidence ISS] codon_start : 1 product : mitochondrial ribosomal protein L32 protein_id : NP_083547.1

name	Psma2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031994 GeneID:19166 MGI:104885
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, alpha type 2 protein_id : NP_032970.2

name	AW209491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559977 CCDS:CCDS26250.1 GeneID:105351 MGI:2145422
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC105351 protein_id : NP_598828.2

name	LOC434483 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434483
definition	number : 2 pseudo : _no_value

name	LOC434483 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434483
definition	number : 1 pseudo : _no_value

name	LOC674723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674723
definition	number : 1 pseudo : _no_value

name	LOC674723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674723
definition	number : 2 pseudo : _no_value

name	LOC674723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674723
definition	number : 3 pseudo : _no_value

name	LOC674723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674723
definition	number : 4 pseudo : _no_value

name	LOC674723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674723
definition	number : 5 pseudo : _no_value

name	LOC674723 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674723
definition	number : 6 pseudo : _no_value

name	LOC630611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630611
definition	number : 2 pseudo : _no_value

name	LOC630611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630611
definition	number : 1 pseudo : _no_value

name	LOC664960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664960
definition	number : 2 pseudo : _no_value

name	LOC664960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664960
definition	number : 1 pseudo : _no_value

name	EG665000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665000
definition	number : 1 pseudo : _no_value

name	EG665000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665000
definition	number : 2 pseudo : _no_value

name	EG665000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665000
definition	number : 3 pseudo : _no_value

name	EG665000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665000
definition	number : 4 pseudo : _no_value

name	LOC630894 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630894
definition	number : 2 pseudo : _no_value

name	LOC630894 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630894
definition	number : 1 pseudo : _no_value

name	LOC100039916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039916
definition	number : 1 pseudo : _no_value

name	EG665099 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665099
definition	number : 1 pseudo : _no_value

name	EG665099 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665099
definition	number : 2 pseudo : _no_value

name	EG665099 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665099
definition	number : 3 pseudo : _no_value

name	EG665099 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665099
definition	number : 4 pseudo : _no_value

name	EG665008 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263899 GeneID:665008 MGI:3644947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 650 ESTs, 15 Proteins product : predicted gene, EG665008 pseudo : _no_value transcript_id : XR_001680.2

name	LOC670994 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263892 GeneID:670994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 551 ESTs, 13 Proteins product : similar to unnamed protein product pseudo : _no_value transcript_id : XR_031420.1

clone name	MSMg01-344C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-382E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-082N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-045N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-126E19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-495M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-116I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128F18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-168J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-497M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269F17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-022F23.b	B6Ng01-022F23.g
ACC	DH854613	DH854614
length	972	1,061
definition	DH854613\|Mus musculus domesticus DNA, BAC clone: B6Ng01-022F23, 5' end.	DH854614\|Mus musculus domesticus DNA, BAC clone: B6Ng01-022F23, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctctatttagctctgtaccccagttttaattggttatttggtctg ttgatgtttaatttctcgagttcttcatatatttggatattagccttatc tgatgtaggattggtgaagatcttttcccattctgtatgttgatgttttg tcctattggtggtatactttgccttacagaagtttttcagcttcatgagg tcctgtttattaattgttgatcttaatgcctgaactgttggtgttatgct caggaagttgtctctggtgacaatgtgttcaaggcagctccccactctct cttatatcagacttagaggatccagctttatgttgaggtctttgatctac ttggacttgagttttttcaaatgataaatatgaatttatttgaattcttc tacatgcagttagaccagcaccatttgttgaagatgctttctttttttcc attgtatagttttggcttctttgtcaaaaatcaagtgtccataggagtgt gagtttaattctgggtcttcaatgcatttctattgattaacctgtctgtt tttatgccaataaaatgagatttttattactattgctctgtagtacagtt ttgagacgtctttttattgtaaaggattgttttagctatcctgggtcttt tgtttttccatatgaagctgagtattgtcctttaagggtctgtaaaaatt gtgttggaattttgatgggaattgcattgaatctgtagattgcttttgtt aagatggccattttttactatgttaatcttactaatccatgagcatggga gatctttccatcttatgatatcttcttcaatttctttcttcagagacttg atgttcttgtaatagagatctttcacttgcttagttagagtaccccaaaa tatttaaattatttgtggctattgtgaagggatctttcccctaattcctt cccagttcaacgatcaagttta	gaattcaattacataaaaaccaatttgttgtcactcgaaggaagaaaagg acatttttaaaaagcaacatgctatttaaaaatactaatttaattttgtg tgtataggtgttttggccacatctatgtctgtgtaccatgggtatgcagt gccagaagaggacattggattccttggaactggtgttctatagactgttg tgggtcagcctgtgtgttcgggggtcctctggaagaccaggcccaaaatt tggtccctctggaagagcagctagcatacttaaccttcagactgagaagg gctttagaaagaaagaaagaaagaaaggaaggaaggaaggaaggaaggaa ggaaggaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagg gaaaaagggaaaaggaaagggaaaaagggaaagggaaagaaaagagaaaa ggaaaagaaagagaaagaaataaagtttattaacaattcttttaggtagc tgaggcaggaagacttcatgcttgatagtcactctcaaaaacaaaagtaa atcaagaaaaagtaatactggtcaccttttctaccatatagcatctgttc tgattcatgacctatgggtacatggaattgtcaggaagctagacagaaat acttctatgtttgtatttggaaaaaatcactgagtctggtttaacaaaat ggctgcttgtttgttcttactatgggtatttcctagtcatcccttttgct gtttcatatccataaaactaacagccacctaggcttttctgagctgcttc taccttttaatttctatgtcatctggctaagtacaaaatctactttaaaa atatatgagcgattaaagcaatatagtcttcaaagtttatcacaggacag gcacttaaacatttacatttgattttttttttttcttaaacatggggtct ttttatttagtcaatagctgtcctggagcaaactatgtggatcaagcctg aattaaattcacagatctacttgcctctgctttctagcacttgaggaatg tagtaccatgt
quality values	Open. Hide. 47 41 34 33 61 61 61 61 53 61 61 61 47 47 61 61 61 61 61 61 61 61 61 61 61 55 28 13 21 22 19 18 12 21 25 19 44 30 47 61 61 59 61 61 61 59 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 52 59 49 30 35 28 52 52 52 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 53 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 52 61 43 61 61 61 61 61 61 42 61 61 61 61 43 61 61 61 53 53 53 47 57 53 53 57 52 57 57 53 57 53 57 57 50 53 50 47 53 53 53 42 45 53 57 57 53 53 45 53 47 39 53 52 53 57 57 57 53 45 52 57 57 42 50 57 53 47 47 37 24 57 53 24 57 57 52 50 38 53 53 53 53 53 47 43 57 57 57 52 52 52 57 57 57 40 20 57 57 53 52 52 47 33 52 45 45 38 53 53 42 50 53 50 57 17 52 32 21 57 47 30 37 37 52 53 52 32 50 18 57 24 30 50 53 53 34 42 57 57 57 23 23 31 50 20 40 42 53 53 33 52 42 37 52 33 25 47 39 40 52 57 19 53 30 19 46 40 37 28 22 52 37 36 40 38 40 37 40 31 47 20 44 24 29 40 30 40 57 57 52 52 36 31 24 52 27 33 23 52 29 6 34 30 37 57 57 57 57 40 34 29 30 36 28 57 37 24 40 33 34 40 30 23 40 39 13 20 14 19 32 33 33 27 48 40 23 40 25 40 43 53 41 44 27 32 27 28 23 51 38 35 34 26 38 38 30 10 27 22 30 31 15 25 29 30 30 33 38 32 12 28 23 34 32 46 48 39 31 36 38 30 21 30 18 18 9 33 20 29 16 21 18 24 34 28 34 13 36 15 10 10 30 12 29 29 29 30 5 25 13 35 23 27 29 39 7 10 16 23 25 17 29 31 29 28 23 17 33 31 29 13 29 28 24 12 24 7 11 17 18 31 24 11 16 5 6 22 23 11 30 30 23 27 18 16 29 29 27 14 30 15 13 25 16 29 13 46 11 18 27 39 8 29 23 10 7 22 16 28 14 27 31 28 21 11 21 23 10 19 5 8 21 16 11 9 6 7 15 14 8 22 6 5 8 5 6 5 7 8 14 10 19 10 6 6	Open. Hide. 55 47 41 49 55 35 49 26 27 21 20 19 16 27 20 27 31 52 59 61 59 59 59 61 59 59 61 59 59 59 61 59 52 61 61 61 52 59 61 59 61 61 61 61 61 61 61 61 59 61 61 59 52 59 55 55 59 59 59 59 59 59 61 59 59 59 59 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 59 59 61 59 61 59 59 61 61 59 61 61 59 59 59 59 61 61 61 59 59 59 61 61 61 59 59 61 61 59 61 59 61 61 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 52 61 61 61 61 59 61 61 61 59 59 61 61 61 61 59 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 59 44 55 59 61 61 61 61 61 61 61 61 59 61 59 61 59 61 59 59 61 61 61 61 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 59 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 59 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 59 59 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 55 55 55 61 61 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 61 61 32 47 53 61 61 61 61 61 50 61 61 61 61 61 53 61 61 61 61 61 61 53 53 53 61 61 61 53 61 61 61 61 61 31 61 61 61 61 61 31 61 61 61 52 52 42 61 61 53 61 61 61 61 61 61 61 61 61 43 53 52 53 53 53 53 53 57 53 46 53 43 39 57 53 53 57 47 57 45 35 53 53 45 53 53 53 57 57 53 53 53 57 53 53 53 57 57 53 57 42 28 53 53 42 47 57 53 43 57 53 53 50 57 57 57 38 40 45 34 53 57 57 53 50 43 57 53 27 52 45 36 43 38 53 33 43 52 53 45 50 42 37 42 57 57 53 53 37 52 52 57 57 38 57 47 53 50 46 35 53 42 45 43 57 53 57 52 38 53 46 46 46 31 37 53 28 38 53 53 47 23 53 38 37 57 52 27 57 32 40 42 40 39 52 57 39 32 43 29 32 41 42 37 27 38 43 15 57 53 52 28 37 53 33 43 30 38 48 48 38 44 33 38 29 32 19 57 34 34 57 36 53 29 30 44 36 39 39 57 31 29 57 57 34 34 23 36 42 26 57 36 37 28 33 36 37 44 40 27 41 37 57 57 47 40 37 30 53 37 29 32 33 47 29 31 41 29 35 25 37 37 43 53 48 44 37 25 32 37 20 34 32 39 27 30 36 46 32 30 31 19 5 51 46 17 15 33 30 51 36 47 20 33 28 29 21 17 23 34 33 31 46 45 17 31 27 22 11 14 29 30 29 46 45 23 21 33 37 30 29 28 51 29 48 48 51 46 41 28 29 9 17 28 21 21 24 28 29 29 11 33 23 37 23 27 25 12 25 33 29 26 20 34 31 41 31 33 29 26 37 43 26 28 51 21 10 11 23 17 26 12 24 20 17 27 22 28 17 7 15 29 21 33 24 46 28 17 12 51 39 43 28 29 8 8 41 29 20 17 10 46 51 51 51 51 41 41 51 41 41 33 25 24 25 7 31 9 17 14 21 43 51 51 15 5 10 10 51 46 51 9 24 7 51 23 24 24 9 19 5 6 10 14 12 31 20 13 6 28 10 9 25 23 29 14 24 20 51 27 9 5 8 7 12 9 26 36 27 15 9 7 8 11 8 9 22 22 25 28 12 17 25 42 25 6 21 9 7 7 15 16 17 8 25 27 13 33 9 8 26 24 30 5 7 8 24 9 15 28 11 38 19 20 5 4 7 8 13 15 7 10 5 5 6 5 5 7 5 9 9 5 17 10 21 5 4 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_14198219_14199280
seq2: B6Ng01-022F23.g_67_1127

seq1  GAATTCAATTACATAAAAACCAATTTGTTGTCACTCGAAGGAAGAAAAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATTACATAAAAACCAATTTGTTGTCACTCGAAGGAAGAAAAGG  50

seq1  ACATTTTTAAAAAGCAACATGCTATTTAAAAATACTAATTTAATTTTGTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTTTAAAAAGCAACATGCTATTTAAAAATACTAATTTAATTTTGTG  100

seq1  TGTATAGGTGTTTTGGCCACATCTATGTCTGTGTACCATGGGTATGCAGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATAGGTGTTTTGGCCACATCTATGTCTGTGTACCATGGGTATGCAGT  150

seq1  GCCAGAAGAGGACATTGGATTCCTTGGAACTGGTGTTCTATAGACTGTTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGAAGAGGACATTGGATTCCTTGGAACTGGTGTTCTATAGACTGTTG  200

seq1  TGGGTCAGCCTGTGTGTTCGGGGGTCCTCTGGAAGACCAGGCCCAAAATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTCAGCCTGTGTGTTCGGGGGTCCTCTGGAAGACCAGGCCCAAAATT  250

seq1  TGGTCCCTCTGGAAGAGCAGCTAGCATACTTAACCTTCAGACTGAGAAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCCCTCTGGAAGAGCAGCTAGCATACTTAACCTTCAGACTGAGAAGG  300

seq1  GCTTTAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAA  350

seq1  GGAAGGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGG  400

seq1  GAAAAAGGGAAAAGGAAAGGGAAAAAGGGAAAGGGAAAGAAAAGAGAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAAGGGAAAAGGAAAGGGAAAAAGGGAAAGGGAAAGAAAAGAGAAAA  450

seq1  GGAAAAGAAAGAGAAAGAAATAAAGTTTATTAACAATTCTTTTAGGTAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAAGAAAGAGAAAGAAATAAAGTTTATTAACAATTCTTTTAGGTAGC  500

seq1  TGAGGCAGGAAGACTTCATGCTTGATAGTCACTCTCAAAAACAAAAGTAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCAGGAAGACTTCATGCTTGATAGTCACTCTCAAAAACAAAAGTAA  550

seq1  ATCAAGAAAAAGTAATACTGGTCACCTTTTCTACCATATAGCATCTGTTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGAAAAAGTAATACTGGTCACCTTTTCTACCATATAGCATCTGTTC  600

seq1  TGATTCATGACCTATGGGTACATGGAATTGTCAGGAAGCTAGACAGAAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTCATGACCTATGGGTACATGGAATTGTCAGGAAGCTAGACAGAAAT  650

seq1  ACTTCTATGTTTGTATTTGGAAAAAATCACTGAGTCTGGTTTAACAAAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCTATGTTTGTATTTGGAAAAAATCACTGAGTCTGGTTTAACAAAAT  700

seq1  GGCTGCTTGTTTGTTCTTACTATGGGTATTTCCTAGTCATCCCTTTTGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTTGTTTGTTCTTACTATGGGTATTTCCTAGTCATCCCTTTTGCT  750

seq1  GTTTCATATCCATAAAACTAACAGCCACCTAGGCTTTTCTGAGCTGCTTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCATATCCATAAAACTAACAGCCACCTAGGCTTTTCTGAGCTGCTTC  800

seq1  TACC-TTTAATTTCTATGTCATCTGGCTAAGTACAAAATCTACTTTAAAA  849
      |||| ||||||||||||||||||||||||||||||||||||||||| |||
seq2  TACCTTTTAATTTCTATGTCATCTGGCTAAGTACAAAATCTACTTT-AAA  849

seq1  AATATAATGAGCGATTAAAGCAATATAGTCTTCAAAAGTTTATCACAGGA  899
      ||||| ||||||||||||||||||||||||||| ||||||||||||||||
seq2  AATAT-ATGAGCGATTAAAGCAATATAGTCTTC-AAAGTTTATCACAGGA  897

seq1  CAGGCACTTAAACATTTTACATTTGATTTTTTTTTTTCTTTAAACATGGG  949
      |||||||||||||| ||||||||||||||||||||||  |||||||||||
seq2  CAGGCACTTAAACA-TTTACATTTGATTTTTTTTTTTTCTTAAACATGGG  946

seq1  GTCTTTTTATTTAGTC-ATAGCTGTCCTGGAGCAAACTATGTGGATC-AG  997
      |||||||||||||||| |||||||||||||||||||||||||||||| ||
seq2  GTCTTTTTATTTAGTCAATAGCTGTCCTGGAGCAAACTATGTGGATCAAG  996

seq1  GCTGAATTAAAATTCACAGATCTACCTGCCTCTGCTTCCTAGCACTTGA-  1046
       ||||||| |||||||||||||||| ||||||||||| ||||||||||| 
seq2  CCTGAATT-AAATTCACAGATCTACTTGCCTCTGCTTTCTAGCACTTGAG  1045

seq1  GCATGTAGTACCATGT  1062
      | ||||||||||||||
seq2  GAATGTAGTACCATGT  1061

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information