MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-031J16
Chromosome	13 (Build37)
Map Location	21,634,336 - 21,635,325
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Elmo1, LOC100040226, LOC665381, LOC665386, Aoah, Olfr1370, Olfr1369-ps1, Olfr42, Olfr1368, Trim27, Gpx5, LOC625752, Gpx6, Olfr1367, Zfp96, LOC665454, Zkscan3, Pgbd1, 4930470G03Rik, Zfp187, 4921504I05Rik, OTTMUSG00000000421, AK157302, LOC100040340, Zfp192, Olfr1366
Downstream gene	Olfr1365, Olfr1364, Olfr1362, Olfr1363-ps1, Olfr11, Olfr1361, Olfr1360, Olfr1359, Hist1h2bl, Hist1h2ai, Hist1h3h, Hist1h2aj, Hist1h2bm, Hist1h4j, Hist1h4k, Hist1h2ak, Hist1h2bn, LOC100041150, Hist1h1b, Hist1h3i, Hist1h2an, Hist1h2bp, LOC665596, Rp23-480b19.10, LOC100041230, Hist1h4m, Hist1h2ao, LOC665622, LOC665634, Zfp184, Gm24, Prss16, Hist1h2ah, Hist1h2bk, Hist1h4i, Hist1h2ag, Hist1h2bj, LOC665690, V1rh17, V1rh2, V1ri8, LOC632534, V1ri1, V1ri9, OTTMUSG00000000480, V1ri6, LOC665726, V1rh21, V1ri3, V1rh4, V1rh3, V1rh1, LOC665749, V1ri4, V1ri7, V1rh11
Link	Open Mouse BAC browser

Click to get alignment info.

name	Elmo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140580 MGI:2153044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040226 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC665381 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	LOC665386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins pseudo : _no_value

name	Aoah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27052 MGI:1350928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258528 MGI:3031204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1369-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404504 MGI:3031203
definition	gene_synonym : MOR256-31 note : olfactory receptor 1369, pseudogene 1 pseudo : _no_value

name	Olfr42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18341 MGI:1333771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258527 MGI:3031202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19720 MGI:97904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14780 MGI:104886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Gpx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75512 MGI:1922762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258526 MGI:3031201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp96 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22758 MGI:1099444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zkscan3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72739 MGI:1919989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgbd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319207 MGI:2441675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein

name	4930470G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74921 MGI:1922171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Zfp187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432731 MGI:3531417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921504I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66707 MGI:1913957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000421 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544922 MGI:3649412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AK157302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432732 MGI:3574096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 474 ESTs, 8 Proteins

name	LOC100040340 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp192 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93681 MGI:1913815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258280 MGI:3031200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1365 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404335 MGI:3031199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1364 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258533 MGI:3031198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1362 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258739 MGI:3031196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1363-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404503 MGI:3031197
definition	note : olfactory receptor 1363, pseudogene 1 pseudo : _no_value

name	Olfr11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218066 MGI:104715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258534 MGI:3031195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258536 MGI:3031194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258067 MGI:3031193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319185 MGI:2448403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ai (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319191 MGI:2448457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319152 MGI:2448349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2aj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319174 MGI:2448312
definition	gene_synonym : H2a-291b note : histone cluster 1, H2aj pseudo : _no_value

name	Hist1h2bm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319186 MGI:2448404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4j (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319159 MGI:2448436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319160 MGI:2448439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319169 MGI:2448297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319187 MGI:2448407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs

name	Hist1h1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56702 MGI:1861461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319153 MGI:2448350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2an (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319170 MGI:2448300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319188 MGI:2448409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rp23-480b19.10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 mRNAs, 176 ESTs, 54 Proteins

name	LOC100041230 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 12 ESTs, 12 Proteins

name	Hist1h4m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319161 MGI:2448441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ao (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319171 MGI:2448302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665622 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 9 Proteins pseudo : _no_value

name	LOC665634 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	Zfp184 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193452 MGI:1922244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195236 MGI:2684870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 2 Proteins

name	Prss16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54373 MGI:1859181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319168 MGI:2448295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319184 MGI:2448399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319158 MGI:2448432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319167 MGI:2448293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319183 MGI:2448388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665690 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	V1rh17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252912 MGI:2182259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252906 MGI:2182257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252908 MGI:2182261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	V1ri1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252907 MGI:2182260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171259 MGI:2159695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626299 MGI:3651596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171257 MGI:2159692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	V1rh21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171278 MGI:2159686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171254 MGI:2159689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171247 MGI:2159662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171246 MGI:2159660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171245 MGI:2159658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1ri4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171255 MGI:2159690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171258 MGI:2159693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171270 MGI:2159674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elmo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17933765 GeneID:140580 MGI:2153044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : engulfment and cell motility 1, ced-12 homolog (C. elegans) transcript_id : NM_080288.1

name	Elmo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37693522 GeneID:140580 MGI:2153044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : engulfment and cell motility 1, ced-12 homolog (C. elegans) transcript_id : NM_198093.2

name	Aoah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384064 GeneID:27052 MGI:1350928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyloxyacyl hydrolase transcript_id : NM_012054.3

name	Olfr1370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238957 GeneID:258528 MGI:3031204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1370 transcript_id : NM_146535.1

name	Olfr42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559421 GeneID:18341 MGI:1333771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 42 transcript_id : NM_010984.1

name	Olfr1368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238951 GeneID:258527 MGI:3031202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1368 transcript_id : NM_146534.1

name	Trim27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347388 GeneID:19720 MGI:97904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 27 transcript_id : NM_009054.2

name	Gpx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754061 GeneID:14780 MGI:104886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 5 transcript_id : NM_010343.1

name	LOC625752 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82949721 GeneID:625752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to 60S ribosomal protein L29 (P23) transcript_id : XM_890317.1

name	Gpx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357221 GeneID:75512 MGI:1922762
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 6 transcript_id : NM_145451.2

name	Olfr1367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238953 GeneID:258526 MGI:3031201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1367 transcript_id : NM_146533.1

name	Zfp96 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032036 GeneID:22758 MGI:1099444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 96 transcript_id : NM_016684.2

name	Zkscan3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802779 GeneID:72739 MGI:1919989
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 3 transcript_id : NM_023685.3

name	Zfp187 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63003920 GeneID:432731 MGI:3531417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 187 transcript_id : NM_001013786.1

name	4921504I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371150 GeneID:66707 MGI:1913957
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921504I05 gene transcript_id : NM_025719.2

name	OTTMUSG00000000421 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993749 GeneID:544922 MGI:3649412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000421 transcript_id : NM_001039115.1

name	AK157302 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263923 GeneID:432732 MGI:3574096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 474 ESTs, 8 Proteins product : cDNA sequence AK157302 transcript_id : XM_484225.5

name	LOC100040340 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263904 GeneID:100040340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cytochrome c oxidase, subunit Vb transcript_id : XM_001474522.1

name	Zfp192 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253920 GeneID:93681 MGI:1913815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 192 transcript_id : NM_139141.3

name	Olfr1366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129716 GeneID:258280 MGI:3031200
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1366 transcript_id : NM_146283.1

name	Olfr1365 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849788 GeneID:404335 MGI:3031199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1365 transcript_id : NM_207572.1

name	Olfr1364 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238955 GeneID:258533 MGI:3031198
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1364 transcript_id : NM_146540.1

name	Olfr1362 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129356 GeneID:258739 MGI:3031196
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1362 transcript_id : NM_146744.1

name	Olfr11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575921 GeneID:218066 MGI:104715
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 11 transcript_id : NM_146542.1

name	Olfr1361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983491 GeneID:258534 MGI:3031195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1361 transcript_id : NM_146541.2

name	Olfr1360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203784 GeneID:258536 MGI:3031194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1360 transcript_id : NM_146543.1

name	Olfr1359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801403 GeneID:258067 MGI:3031193
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1359 transcript_id : NM_001011820.1

name	Hist1h2bl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061388 GeneID:319185 MGI:2448403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bl transcript_id : NM_178199.1

name	Hist1h2ai (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061392 GeneID:319191 MGI:2448457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ai transcript_id : NM_178182.1

name	Hist1h3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991705 GeneID:319152 MGI:2448349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3h transcript_id : NM_178206.2

name	Hist1h2bm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061384 GeneID:319186 MGI:2448404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bm transcript_id : NM_178200.1

name	Hist1h4j (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061350 GeneID:319159 MGI:2448436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4j transcript_id : NM_178210.1

name	Hist1h4k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061358 GeneID:319160 MGI:2448439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4k transcript_id : NM_178211.1

name	Hist1h2ak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061370 GeneID:319169 MGI:2448297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ak transcript_id : NM_178183.1

name	Hist1h2bn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061394 GeneID:319187 MGI:2448407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bn transcript_id : NM_178201.1

name	LOC100041150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263928 GeneID:100041150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs product : similar to gag protein transcript_id : XM_001475956.1

name	Hist1h1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426892 GeneID:56702 MGI:1861461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1b transcript_id : NM_020034.1

name	Hist1h3i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991704 GeneID:319153 MGI:2448350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3i transcript_id : NM_178207.2

name	Hist1h2an (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061364 GeneID:319170 MGI:2448300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2an transcript_id : NM_178184.1

name	Hist1h2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061390 GeneID:319188 MGI:2448409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bp transcript_id : NM_178202.1

name	LOC665596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263867 GeneID:665596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2b histone family, member A transcript_id : XM_798035.2

name	Rp23-480b19.10 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263930 GeneID:665433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 mRNAs, 176 ESTs, 54 Proteins product : similar to histone 2a, transcript variant 2 transcript_id : XM_978341.2

name	LOC100041230 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263931 GeneID:100041230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 12 ESTs, 12 Proteins product : similar to histone H4 transcript_id : XM_001476063.1

name	Hist1h4m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089707 GeneID:319161 MGI:2448441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4m transcript_id : NM_175657.1

name	Hist1h2ao (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061374 GeneID:319171 MGI:2448302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ao transcript_id : NM_178185.1

name	Zfp184 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942077 GeneID:193452 MGI:1922244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 184 (Kruppel-like) transcript_id : NM_183014.1

name	Prss16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893216 GeneID:54373 MGI:1859181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 16 (thymus) transcript_id : NM_019429.2

name	Hist1h2ah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061326 GeneID:319168 MGI:2448295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ah transcript_id : NM_175659.1

name	Hist1h2bk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089703 GeneID:319184 MGI:2448399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bk transcript_id : NM_175665.1

name	Hist1h4i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972651 GeneID:319158 MGI:2448432
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4i transcript_id : NM_175656.2

name	Hist1h2ag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972648 GeneID:319167 MGI:2448293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ag transcript_id : NM_178186.2

name	Hist1h2bj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061380 GeneID:319183 MGI:2448388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bj transcript_id : NM_178198.1

name	V1rh17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095332 GeneID:252912 MGI:2182259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H17 transcript_id : NM_145850.1

name	V1rh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238867 GeneID:252906 MGI:2182257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H2 transcript_id : NM_145844.1

name	V1ri8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003895 GeneID:252908 MGI:2182261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I8 transcript_id : NM_145846.1

name	V1ri1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003901 GeneID:252907 MGI:2182260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I1 transcript_id : NM_145845.1

name	V1ri9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717766 GeneID:171259 MGI:2159695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I9 transcript_id : NM_134225.1

name	OTTMUSG00000000480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430497 GeneID:626299 MGI:3651596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000480 transcript_id : NM_001080972.1

name	V1ri6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717762 GeneID:171257 MGI:2159692
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I6 transcript_id : NM_134223.1

name	V1rh21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58866044 GeneID:171278 MGI:2159686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H21 transcript_id : NM_134244.1

name	V1ri3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717748 GeneID:171254 MGI:2159689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I3 transcript_id : NM_134220.1

name	V1rh4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717746 GeneID:171247 MGI:2159662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H4 transcript_id : NM_134213.1

name	V1rh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717736 GeneID:171246 MGI:2159660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H3 transcript_id : NM_134212.1

name	V1rh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263868 GeneID:171245 MGI:2159658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H1 transcript_id : XM_001471795.1

name	V1ri4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717758 GeneID:171255 MGI:2159690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I4 transcript_id : NM_134221.1

name	V1ri7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717756 GeneID:171258 MGI:2159693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I7 transcript_id : NM_134224.1

name	V1rh11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955267 GeneID:171270 MGI:2159674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H11 transcript_id : NM_134236.1

name	Elmo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17933766 CCDS:CCDS26265.1 GeneID:140580 MGI:2153044
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0030029 - actin filament-based process [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA] [Evidence ISS]; GO:0006928 - cell motility [Evidence ISS]; GO:0006909 - phagocytosis [Evidence IDA]; GO:0006911 - phagocytosis, engulfment [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : engulfment and cell motility 1 isoform 1 protein_id : NP_525027.1

name	Elmo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674226 GeneID:140580 MGI:2153044
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0030029 - actin filament-based process [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA] [Evidence ISS]; GO:0006928 - cell motility [Evidence ISS]; GO:0006909 - phagocytosis [Evidence IDA]; GO:0006911 - phagocytosis, engulfment [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : engulfment and cell motility 1 isoform 2 protein_id : NP_932761.1

name	Aoah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753064 CCDS:CCDS26266.1 GeneID:27052 MGI:1350928
definition	GO_function : GO:0050528 - acyloxyacyl hydrolase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008653 - lipopolysaccharide metabolism [Evidence IDA]; GO:0050728 - negative regulation of inflammatory response [Evidence IDA] codon_start : 1 product : acyloxyacyl hydrolase protein_id : NP_036184.1

name	Olfr1370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238958 CCDS:CCDS26267.1 GeneID:258528 MGI:3031204
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-12181473-12182423; olfactory receptor MOR256-14 product : olfactory receptor 1370 protein_id : NP_666746.1

name	Olfr42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559422 CCDS:CCDS26268.1 GeneID:18341 MGI:1333771
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR256-31; GA_x6K02T2QHY8-12114828-12113875 product : olfactory receptor 42 protein_id : NP_035114.1

name	Olfr1368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238952 CCDS:CCDS26269.1 GeneID:258527 MGI:3031202
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-12104556-12105500; olfactory receptor MOR256-15 product : olfactory receptor 1368 protein_id : NP_666745.1

name	Trim27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347389 GeneID:19720 MGI:97904
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ret finger protein product : tripartite motif protein 27 protein_id : NP_033080.2

name	Gpx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754062 CCDS:CCDS26270.1 GeneID:14780 MGI:104886
definition	GO_function : GO:0004602 - glutathione peroxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glutathione peroxidase 5 protein_id : NP_034473.1

name	LOC625752 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82949722 GeneID:625752
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_895410.1

name	Gpx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21728388 CCDS:CCDS26271.1 GeneID:75512 MGI:1922762
definition	EC_number : 1.11.1.9 GO_process : GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory product : odorant-metabolizing protein RY2D1 protein_id : NP_663426.1

name	Olfr1367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238954 CCDS:CCDS26272.1 GeneID:258526 MGI:3031201
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-11899770-11898820; olfactory receptor MOR256-16 product : olfactory receptor 1367 protein_id : NP_666744.1

name	Zfp96 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032037 CCDS:CCDS26273.1 GeneID:22758 MGI:1099444
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 96 protein_id : NP_057893.2

name	Zkscan3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980758 CCDS:CCDS26274.1 GeneID:72739 MGI:1919989
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SCAN-KRAB-zinc finger gene 1; zinc finger protein 307 product : zinc finger protein 306 protein_id : NP_076174.2

name	Zfp187 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63003921 GeneID:432731 MGI:3531417
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 187-like product : zinc finger protein 187 protein_id : NP_001013808.1

name	4921504I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385176 CCDS:CCDS26276.1 GeneID:66707 MGI:1913957
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66707 protein_id : NP_079995.1

name	OTTMUSG00000000421 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993750 CCDS:CCDS26277.1 GeneID:544922 MGI:3649412
definition	codon_start : 1 product : zinc finger protein 306-like protein_id : NP_001034204.1

name	AK157302 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263924 GeneID:432732 MGI:3574096
definition	codon_start : 1 product : hypothetical protein LOC432732 protein_id : XP_484225.3

name	LOC100040340 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263905 GeneID:100040340
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474572.1

name	Zfp192 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46852149 CCDS:CCDS26278.1 GeneID:93681 MGI:1913815
definition	codon_start : 1 product : zinc finger protein 192 protein_id : NP_631880.2

name	Olfr1366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129717 CCDS:CCDS26279.1 GeneID:258280 MGI:3031200
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QHY8-11707053-11707994; olfactory receptor MOR130-2 product : olfactory receptor 1366 protein_id : NP_666395.1

name	Olfr1365 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849789 CCDS:CCDS26280.1 GeneID:404335 MGI:3031199
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-11688984-11689964 product : olfactory receptor 1365 protein_id : NP_997455.1

name	Olfr1364 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238956 CCDS:CCDS26281.1 GeneID:258533 MGI:3031198
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QHY8-11663090-11664010; olfactory receptor MOR256-13 product : olfactory receptor 1364 protein_id : NP_666751.1

name	Olfr1362 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129357 CCDS:CCDS26282.1 GeneID:258739 MGI:3031196
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QHY8-11617756-11618682; olfactory receptor MOR256-8 product : olfactory receptor 1362 protein_id : NP_666955.1

name	Olfr11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575922 CCDS:CCDS26283.1 GeneID:218066 MGI:104715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QHY8-11597382-11598323 product : olfactory receptor 11 protein_id : NP_666753.1

name	Olfr1361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238962 CCDS:CCDS26284.1 GeneID:258534 MGI:3031195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-11577590-11578528; olfactory receptor MOR256-12 product : olfactory receptor 1361 protein_id : NP_666752.1

name	Olfr1360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203785 GeneID:258536 MGI:3031194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2QHY8-11561962-11562903; olfactory receptor MOR256-10 product : olfactory receptor 1360 protein_id : NP_666754.1

name	Olfr1359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801404 CCDS:CCDS26286.1 GeneID:258067 MGI:3031193
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-11534186-11533245; olfactory receptor MOR256-35 product : olfactory receptor 1359 protein_id : NP_001011820.1

name	Hist1h2bl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061389 CCDS:CCDS26287.1 GeneID:319185 MGI:2448403
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bl protein_id : NP_835506.1

name	Hist1h2ai (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061393 CCDS:CCDS26288.1 GeneID:319191 MGI:2448457
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 2, H2ai product : histone 1, H2ai protein_id : NP_835489.1

name	Hist1h3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061343 CCDS:CCDS26289.1 GeneID:319152 MGI:2448349
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3h protein_id : NP_835513.1

name	Hist1h2bm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061385 CCDS:CCDS26290.1 GeneID:319186 MGI:2448404
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence ISS] [Evidence IEA] codon_start : 1 product : histone 1, H2bm protein_id : NP_835507.1

name	Hist1h4j (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061351 CCDS:CCDS26291.1 GeneID:319159 MGI:2448436
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 4 protein product : histone 1, H4j protein_id : NP_835582.1

name	Hist1h4k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061359 CCDS:CCDS26292.1 GeneID:319160 MGI:2448439
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4k protein_id : NP_835583.1

name	Hist1h2ak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061371 CCDS:CCDS26293.1 GeneID:319169 MGI:2448297
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ak protein_id : NP_835490.1

name	Hist1h2bn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061395 CCDS:CCDS26294.1 GeneID:319187 MGI:2448407
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bn protein_id : NP_835508.1

name	LOC100041150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263929 GeneID:100041150
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001476006.1

name	Hist1h1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426893 CCDS:CCDS26295.1 GeneID:56702 MGI:1861461
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007517 - muscle development [Evidence IPI]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 1, family 5; H1 histone family, member 5 product : histone 1, H1b protein_id : NP_064418.1

name	Hist1h3i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061345 CCDS:CCDS26296.1 GeneID:319153 MGI:2448350
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3i protein_id : NP_835514.1

name	Hist1h2an (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061365 CCDS:CCDS26297.1 GeneID:319170 MGI:2448300
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2an protein_id : NP_835491.1

name	Hist1h2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061391 CCDS:CCDS26298.1 GeneID:319188 MGI:2448409
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bp protein_id : NP_835509.1

name	Rp23-480b19.10 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94394730 GeneID:665433
definition	codon_start : 1 product : similar to Chain K, 2.9 Angstrom X-Ray Structure Of Hybrid Macroh2a Nucleosomes isoform 2 protein_id : XP_983435.1

name	LOC100041230 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263932 GeneID:100041230
definition	codon_start : 1 product : similar to histone H4 protein_id : XP_001476113.1

name	Hist1h4m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089708 CCDS:CCDS26300.1 GeneID:319161 MGI:2448441
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4m protein_id : NP_783588.1

name	Hist1h2ao (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061375 CCDS:CCDS26301.1 GeneID:319171 MGI:2448302
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ao protein_id : NP_835492.1

name	Zfp184 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942078 CCDS:CCDS26302.1 GeneID:193452 MGI:1922244
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Zinc finger protein 184 (Kruppel-like) protein_id : NP_898835.1

name	Prss16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506995 CCDS:CCDS26303.1 GeneID:54373 MGI:1859181
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : protease, serine, 16 (thymus) protein_id : NP_062302.1

name	Hist1h2ah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061327 CCDS:CCDS26304.1 GeneID:319168 MGI:2448295
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ah protein_id : NP_783590.1

name	Hist1h2bk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089704 CCDS:CCDS26305.1 GeneID:319184 MGI:2448399
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bk protein_id : NP_783596.1

name	Hist1h4i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430493 CCDS:CCDS26306.1 GeneID:319158 MGI:2448432
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4i protein_id : NP_783587.1

name	Hist1h2ag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061361 CCDS:CCDS26307.1 GeneID:319167 MGI:2448293
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ag protein_id : NP_835493.1

name	Hist1h2bj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061381 CCDS:CCDS26308.1 GeneID:319183 MGI:2448388
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bj protein_id : NP_835505.1

name	V1rh17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095333 CCDS:CCDS26309.1 GeneID:252912 MGI:2182259
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H17 protein_id : NP_665849.1

name	V1rh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238868 CCDS:CCDS26310.1 GeneID:252906 MGI:2182257
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H2 protein_id : NP_665843.1

name	V1ri8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003896 GeneID:252908 MGI:2182261
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I8 protein_id : NP_665845.1

name	V1ri1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003902 CCDS:CCDS26311.1 GeneID:252907 MGI:2182260
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I1 protein_id : NP_665844.1

name	V1ri9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717767 CCDS:CCDS26312.1 GeneID:171259 MGI:2159695
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I9 protein_id : NP_598986.1

name	OTTMUSG00000000480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430498 GeneID:626299 MGI:3651596
definition	codon_start : 1 product : similar to vomeronasal 1 receptor, I4 protein_id : NP_001074441.1

name	V1ri6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717763 CCDS:CCDS26314.1 GeneID:171257 MGI:2159692
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, I6 protein_id : NP_598984.1

name	V1rh21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58866045 CCDS:CCDS26315.1 GeneID:171278 MGI:2159686
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H21 protein_id : NP_599005.1

name	V1ri3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717749 CCDS:CCDS26316.1 GeneID:171254 MGI:2159689
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I3 protein_id : NP_598981.1

name	V1rh4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717747 CCDS:CCDS26317.1 GeneID:171247 MGI:2159662
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H4 protein_id : NP_598974.1

name	V1rh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717737 CCDS:CCDS26318.1 GeneID:171246 MGI:2159660
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H3 protein_id : NP_598973.1

name	V1rh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263869 GeneID:171245 MGI:2159658
definition	codon_start : 1 product : vomeronasal 1 receptor, H1 protein_id : XP_001471845.1

name	V1ri4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717759 CCDS:CCDS26319.1 GeneID:171255 MGI:2159690
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I4 protein_id : NP_598982.1

name	V1ri7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717757 CCDS:CCDS26320.1 GeneID:171258 MGI:2159693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I7 protein_id : NP_598985.1

name	V1rh11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955268 CCDS:CCDS26321.1 GeneID:171270 MGI:2159674
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H11 protein_id : NP_598997.1

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 1 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 2 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 3 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 4 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 5 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 6 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 7 pseudo : _no_value

name	LOC100040226 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040226
definition	number : 8 pseudo : _no_value

name	LOC665454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665454
definition	number : 1 pseudo : _no_value

name	LOC632534 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632534
definition	number : 1 pseudo : _no_value

name	LOC665749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665749
definition	number : 1 pseudo : _no_value

name	LOC665749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665749
definition	number : 2 pseudo : _no_value

name	LOC665749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665749
definition	number : 3 pseudo : _no_value

name	LOC665381 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263918 GeneID:665381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_032227.1

name	LOC665386 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263919 GeneID:665386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins product : similar to prothymosin, alpha (gene sequence 28) pseudo : _no_value transcript_id : XR_032236.1

name	Pgbd1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263922 GeneID:319207 MGI:2441675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 1 Protein product : piggyBac transposable element derived 1 transcript_id : XR_032424.1

name	4930470G03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94394731 GeneID:74921 MGI:1922171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930470G03 gene transcript_id : XR_002312.1

name	LOC665622 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:133506694 GeneID:665622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 9 Proteins product : histone pseudogene pseudo : _no_value transcript_id : NR_003375.1

name	LOC665634 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263907 GeneID:665634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : hypothetical LOC665634 pseudo : _no_value transcript_id : XR_031906.1

name	Gm24 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263935 GeneID:195236 MGI:2684870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 2 Proteins product : gene model 24, (NCBI) transcript_id : XR_035300.1

name	LOC665690 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263936 GeneID:665690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to ribosomal protein L37a pseudo : _no_value transcript_id : XR_032696.1

name	LOC665726 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263939 GeneID:665726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to fatty acyl elongase pseudo : _no_value transcript_id : XR_032761.1

clone name	MSMg01-503G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-381D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264O11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-521M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-083C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-335D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333L17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-113L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086C02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108G20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143L23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-143C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134L03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-260E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425P21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-215G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-328N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-060I18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-381F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-279C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491O15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-031J16.b	B6Ng01-031J16.g
ACC	DH861168	DH861169
length	1,240	980
definition	DH861168\|Mus musculus domesticus DNA, BAC clone: B6Ng01-031J16, 5' end.	DH861169\|Mus musculus domesticus DNA, BAC clone: B6Ng01-031J16, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcctctgaggaaacagactgggaggaagaagcagcccattacca gccagctaattggtcaagaaaaaagccaaaagcggctggcgaaggccagt ttgctgattggcctcagggcagttggcttcaaggtccgccctatgcggag tccccgccctgcgtagtgcgtcagcaatgcgcagagagatgcgcagagag gcagtgcgcagagaggcagtgcgcagactcattcattcccagagaggaac aaaggaaaatacaacaggcatttccggtctttgaaggagccgagggtggg cgtgtccacgctccggtagaatacttacaaattaaagaaattgccgagtc ggtccgtaaatacggaaccaatgctaattttaccttggtgcagttagaca ggctcgctggcatggcactaactcctgccgactggcaaacggttgtaaaa gccgctctccctagtatgggcaaatatatggaatggagagcgctttggca cgaagctgcacaagcgcaggcccgagcaaacgcagctgctttgactccag agcagagagattggacttttgacttgttaacgggtcagggagcttattct gctgatcagacaaactaccattggggagcttatgcccagatttcttccac ggctattagggcctggaagcgctctctcgagcacgtgaaaccactggtca gttaacaaagataatccagggacctcaggaatccttctcagattttgtgg ccagaatgacagaggcagcagagcgtatttttggagagtcagagcaagct gcgcctctgatagaacagctaatctatgagcaagccacaaaggagtgccg agcggccatagccccagaaagaacaaaggcttacaagactggctcagggt ctgtcgagagcttggggactcttcaccaatgcagcttagcggcgcatctt catctcagaacgctcatgggcagatgatcagagacagtttattgcgaaag ctgggcattttagaagattgcaggctcagataaacaggaggactctcact ctttgctctatttggcaagggttatcatagagctgaacaatgtcctctgg aggatataggcaagtcctccccactgatgtcatactgtgtgcaaccgact cggtctggtcaggccttgattggaccggttcggaccgagcttagacgaaa caggtactcggccctatctcatagtcatagtatttcgcag	gaattctacaggtggttattaggtaccgactataggttatacaaggcctt acctacagtctgaacttgtcttccttgtccaggaagtgacatatattcgt cctgattttccaaatctgctcacttcccttgttcagttccatgctcactt accaggcgatcatatgatttctttgagtgaattaacttcgaagtttcacg tggaggtaatgaaaaatgcaaaatgtgagactgtttccctttcctcagaa ggcacacagttgagggaagggacagtttgtaagcaggtcacaaaaggtgc agggtgaatgtgagtgactaaaggacttctccatattaaggctcacaacc cctttgagccctgtggggacccaatcttgatcaaagtccccgaactccag caatcatgacttcatctcctttgtggtttcccaattgtaactgtagggac aatactatggaagatgattccccagggagacccagagatagcatctagag attgtttctatgcttccaagaatgctatagcttgtctctcttccccctca aacaacaataatcacaacaacttgaggaatttcttctttagtagagttga tcagtttccctaaatgtaggtttctatgttccatgattgaacattccatt agcattatcttcctccagcttacaaatgcctgatattcaaggacccattt tgtgacaaaagagatgaagtaatgaatatgtagccagaaatcacatattc atcttattttctattccatagtactagcactaatgttatcatggatagca aggccttatagctcagtgcataggttttcctgggctgataccaaagtttt ggaaatgtcctattttaaaaatctgtataatacatggggaagatgaacag ttttgtgggacatcttttgttgtttttgttttgttttttgagacaggttc tcttgtatagctcgactgtctggaactcat
quality values	Open. Hide. 57 41 14 26 57 53 53 47 42 57 61 61 61 61 61 61 43 61 43 50 32 61 61 61 61 50 43 43 14 14 31 24 22 26 55 61 55 55 55 55 61 61 61 43 61 61 61 61 47 35 61 61 49 38 61 61 49 61 61 61 61 61 47 61 61 39 61 61 61 61 61 61 61 61 61 61 61 49 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 42 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 52 57 57 57 52 57 57 57 57 47 47 57 53 57 50 53 57 57 57 57 53 53 47 47 57 57 57 39 57 57 57 50 57 57 57 53 57 57 53 57 57 53 57 53 35 47 53 53 53 53 53 53 57 57 57 53 53 57 53 53 50 45 50 57 57 57 57 57 43 57 53 57 50 57 53 53 57 53 57 57 57 57 53 50 53 57 53 57 57 45 57 57 52 53 53 52 33 57 53 57 53 57 41 22 47 21 24 26 47 57 52 52 50 57 47 52 53 57 53 52 53 57 57 53 53 57 57 46 53 37 53 52 41 30 47 52 37 53 53 36 57 33 52 50 33 32 50 52 52 52 38 57 57 57 53 53 36 42 50 53 53 41 50 34 53 50 28 57 57 37 39 37 14 41 53 53 34 50 53 40 40 34 36 50 38 52 38 52 39 31 30 36 30 38 41 42 28 57 32 42 50 30 52 52 24 41 53 53 57 57 28 47 21 36 30 40 37 35 52 28 46 39 23 35 37 22 57 53 39 34 25 23 43 37 42 29 53 28 44 37 40 37 36 33 57 52 27 36 20 24 8 8 6 9 11 30 33 48 39 37 39 31 37 30 40 28 36 14 4 33 21 37 40 47 40 27 44 20 40 23 21 30 29 37 34 28 37 29 18 29 30 20 46 39 36 34 29 29 26 30 32 30 27 32 44 33 30 28 33 31 30 18 25 10 22 29 27 26 30 14 47 32 38 31 33 17 34 20 46 46 33 32 19 27 25 30 32 18 14 36 22 28 29 25 29 19 19 27 23 10 14 24 25 29 29 18 47 15 29 28 20 21 23 46 46 46 27 29 23 29 14 36 28 25 28 27 14 43 14 35 34 23 22 31 35 29 22 12 37 28 35 34 33 31 31 22 33 19 29 29 25 23 23 34 28 28 29 34 29 28 25 28 29 41 18 29 16 33 27 30 25 15 21 16 46 23 33 10 26 13 20 24 9 31 11 29 8 21 6 19 11 20 12 29 18 19 18 32 28 14 22 7 29 51 25 14 34 29 22 22 41 27 32 20 12 24 32 27 21 6 31 13 43 21 29 22 31 14 18 14 20 20 51 23 16 21 14 23 15 17 9 20 15 23 14 31 26 15 38 38 36 28 29 19 9 9 6 17 12 14 14 30 12 22 25 30 19 8 8 6 26 28 15 8 22 14 11 32 10 32 10 20 38 9 23 22 30 15 23 28 21 9 8 13 23 16 11 15 26 35 8 15 30 37 16 13 9 6 36 5 14 17 28 23 13 8 9 24 6 6 5 8 4 19 23 16 10 15 10 5 13 11 36 17 9 29 15 26 33 23 11 9 22 30 36 17 16 8 19 23 5 20 10 21 29 9 5 4 4 4 8 29 8 5 6 5 6 17 19 5 3 4 4 11 30 30 20 10 4 7 10 5 4 5 4 5 6 26 13 9 5 5 10 5 8 3 4 5 5 16 10 13 16 13 27 21 17 10 6 5 10 6 10 5 5 18 5 6 16 9 18 6 8 5 9 5 5 6 21 4 10 10 6 4 3 6 6 15 8 7 6 5 15 8 14 3 3 5 5 8 19 8 17 7 11 22 10 4 18 9 11 13 6 4 5 3 4 4 12 5 4 14 3 3 8 6 13 18 21 3 3 10 1 1 4 3 13 14 1 3 3 5 6 6 20 7 7 14 4 16 7 3 1 4 1 2 4 7 3 4 5 13 3 4 13 1 1 4 5 7 4 1 1 1 2 2 1 2 6 5 7 3 10 4 4 7 9 8 4 1 3 6 5 5 5 2 3 6 14 4 15 4 4 18 6 6 6 5 7 4 11 17 3 4 3 4 4 11 5 1 3 12 4 3 3	Open. Hide. 28 47 24 38 28 28 31 28 31 9 10 15 18 31 47 47 43 43 47 61 31 50 61 55 55 61 55 50 55 55 61 43 55 43 50 61 55 61 50 61 55 61 55 55 55 61 55 61 55 61 55 61 55 61 52 61 47 55 55 55 52 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 49 55 55 61 61 55 61 61 47 52 55 61 55 61 61 61 61 61 55 61 61 55 55 61 61 55 55 61 61 61 49 37 55 61 61 61 61 61 55 55 55 52 49 61 61 61 61 61 61 61 61 61 55 61 55 52 55 61 61 61 47 61 61 55 55 55 52 55 55 61 61 61 61 61 52 61 61 61 61 61 61 61 61 55 55 55 55 61 61 61 61 61 61 61 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 49 61 61 52 55 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 55 61 55 61 61 52 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 49 61 61 55 61 55 61 61 55 55 50 50 50 55 61 61 50 61 61 61 61 55 61 61 61 61 55 55 55 61 61 61 55 55 55 50 55 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 61 55 50 61 61 55 61 61 61 55 61 55 55 61 50 55 61 61 61 55 55 55 55 55 61 61 55 61 61 61 55 61 47 38 61 61 61 55 61 61 55 61 55 61 47 61 61 55 61 61 61 61 61 61 50 53 50 61 50 52 61 61 61 61 40 61 61 61 61 47 37 53 53 47 52 50 61 52 52 61 61 61 53 50 50 53 53 53 53 61 50 61 53 61 61 61 61 61 61 36 50 61 53 52 47 50 38 53 61 61 53 61 61 61 53 61 61 61 61 61 61 61 61 61 50 61 43 35 50 50 61 61 61 45 53 53 61 61 53 50 53 61 61 61 40 38 43 61 61 52 53 45 52 53 50 61 47 52 53 46 47 47 53 39 61 25 45 37 26 47 61 61 61 61 34 47 47 61 61 52 61 34 47 35 24 8 17 20 45 45 35 52 61 53 61 61 47 45 53 53 47 42 36 39 53 17 53 37 53 33 46 53 57 57 53 53 53 35 27 52 22 57 47 32 57 42 45 43 42 45 41 39 31 29 53 50 53 50 57 45 52 53 34 47 57 57 57 57 53 53 38 42 47 39 24 42 43 24 47 52 42 42 53 53 22 47 18 47 46 38 47 53 24 22 16 9 14 33 53 47 26 53 53 50 43 57 57 22 53 47 50 45 34 53 20 52 22 10 57 50 29 22 38 34 31 33 57 35 17 57 41 40 45 57 45 45 52 21 40 27 36 6 57 21 52 45 50 34 38 33 36 52 20 22 42 53 37 20 52 42 53 24 23 31 50 53 31 42 42 30 27 20 7 20 24 34 37 42 24 29 17 41 53 35 23 19 45 30 38 45 42 40 38 35 36 53 34 37 38 29 19 23 39 35 17 20 53 11 23 18 37 50 46 18 15 57 32 14 38 57 57 35 28 18 28 27 27 27 53 53 17 52 25 10 25 10 13 22 16 12 29 19 57 33 21 32 37 25 24 27 27 22 32 24 53 42 18 22 41 57 33 30 33 28 40 28 29 14 43 57 30 20 20 20 24 24 29 18 57 57 39 16 7 14 7 57 24 26 20 37 29 6 14 18 29 25 30 27 33 28 36 32 29 27 13 12 5 4 7 9 16 16 22 21 24 29 15 45 11 32 17 18 23 32 29 28 34 19 28 27 7 10 16 33 29 29 18 31 44 31 20 18 29 20 29 25 51 51 20 18 16 11 45 42 7 7 13 17 29 8 7 11 51 9 43 9 26 10 41 41 21 15 14 29 51 39 27 29 26 10 23 11 17 7 24 24 5 7 11 6 5 5 20 28 16 28 9 12 5 10 5 10 7 18 8 15 33 46 41 33 29 6 6 43 13 15 16 26 10 14 23 15 9 6 5 7 6 22 41 25 28 7 9 31 24 36 36 42 11 7 8 25 38 11 51 41 41 23 31 15 51 36 22 17 14 21 25 22 14 12 6 5 6 18 9 12 28 9 5 13 9 5 7 5 5 8 15 19 12 6 5 10 6 6 28 7 9 6 5 10 19 5 10 12 14 16 22 17 16 13 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_21634336_21635325
seq2: B6Ng01-031J16.g_69_1047

seq1  GAATTCTACAGGTGGTTATTAGGTACCGACTATAGGTTATACAAGGCCTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACAGGTGGTTATTAGGTACCGACTATAGGTTATACAAGGCCTT  50

seq1  ACCTACAGTCTGAACTTGTCTTCCTTGTCCAGGAAGTGACATATATTCGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTACAGTCTGAACTTGTCTTCCTTGTCCAGGAAGTGACATATATTCGT  100

seq1  CCTGATTTTCCAAATCTGCTCACTTCCCTTGTTCAGTTCCATGCTCACTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGATTTTCCAAATCTGCTCACTTCCCTTGTTCAGTTCCATGCTCACTT  150

seq1  ACCAGGCGATCATATGATTTCTTTGAGTGAATTAACTTCGAAGTTTCACG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGGCGATCATATGATTTCTTTGAGTGAATTAACTTCGAAGTTTCACG  200

seq1  TGGAGGTAATGAAAAATGCAAAATGTGAGACTGTTTCCCTTTCCTCAGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGTAATGAAAAATGCAAAATGTGAGACTGTTTCCCTTTCCTCAGAA  250

seq1  GGCACACAGTTGAGGGAAGGGACAGTTTGTAAGCAGGTCACAAAAGGTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACACAGTTGAGGGAAGGGACAGTTTGTAAGCAGGTCACAAAAGGTGC  300

seq1  AGGGTGAATGTGAGTGACTAAAGGACTTCTCCATATTAAGGCTCACAACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGAATGTGAGTGACTAAAGGACTTCTCCATATTAAGGCTCACAACC  350

seq1  CCTTTGAGCCCTGTGGGGACCCAATCTTGATCAAAGTCCCCGAACTCCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTGAGCCCTGTGGGGACCCAATCTTGATCAAAGTCCCCGAACTCCAG  400

seq1  CAATCATGACTTCATCTCCTTTGTGGTTTCCCAATTGTAACTGTAGGGAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATCATGACTTCATCTCCTTTGTGGTTTCCCAATTGTAACTGTAGGGAC  450

seq1  AATACTATGGAAGATGATTCCCCAGGGAGACCCAGAGATAGCATCTAGAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACTATGGAAGATGATTCCCCAGGGAGACCCAGAGATAGCATCTAGAG  500

seq1  ATTGTTTCTATGCTTCCAAGAATGCTATAGCTTGTCTCTCTTCCCCCTCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTTCTATGCTTCCAAGAATGCTATAGCTTGTCTCTCTTCCCCCTCA  550

seq1  AACAACAATAATCACAACAACTTGAGGAATTTCTTCTTTAGTAGAGTTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAACAATAATCACAACAACTTGAGGAATTTCTTCTTTAGTAGAGTTGA  600

seq1  TCAGTTTCCCTAAATGTAGG-TTCTATGTTCCATGATTGAACATTCCATT  649
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  TCAGTTTCCCTAAATGTAGGTTTCTATGTTCCATGATTGAACATTCCATT  650

seq1  AGCATTATCTTCCTCCAGCTTACAAATGCCTGATATTCAAGGACCCATTT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATTATCTTCCTCCAGCTTACAAATGCCTGATATTCAAGGACCCATTT  700

seq1  TGTGACAAAGGAGATGAAGTAATGAATATGTAGCCAGAAATCACATATTT  749
      ||||||||| ||||||||||||||||||||||||||||||||||||| ||
seq2  TGTGACAAAAGAGATGAAGTAATGAATATGTAGCCAGAAATCACATA-TT  749

seq1  CATCTTATTTTCTATTCCATAGTACTAGCACTAATGTAATCATGGATAAG  799
      ||||||||||||||||||||||||||||||||||||| ||||||||| ||
seq2  CATCTTATTTTCTATTCCATAGTACTAGCACTAATGTTATCATGGAT-AG  798

seq1  CAAGGCCTTATAGGCTCAGTGCATAGGTTTTCCTGGGGCTGATACCCAAG  849
      |||||||||||| ||||||||||||||||||||| ||||||||| |||| 
seq2  CAAGGCCTTATA-GCTCAGTGCATAGGTTTTCCT-GGGCTGATA-CCAAA  845

seq1  GTTTTGGAAATGTTCTA-TTTAACATTCTGTAT-ATACATGGGGAAGATG  897
      ||||||||||||| ||| ||||| | ||||||| ||||||||||||||||
seq2  GTTTTGGAAATGTCCTATTTTAAAAATCTGTATAATACATGGGGAAGATG  895

seq1  AACAGTTTGTGTGGGACATTCTTTTTTGTTGTTTTTGTTTTTGTTTTTTT  947
      |||||||| |||||||||   | ||||||||||||||||||   ||||||
seq2  AACAGTTT-TGTGGGACA---TCTTTTGTTGTTTTTGTTTT--GTTTTTT  939

seq1  GAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCA  990
      |||||||| | ||| |||||||| | | |||| ||||||||||
seq2  GAGACAGGTTCTCT-TGTATAGCTC-GACTGT-CTGGAACTCA  979

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information