MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-122F16
Chromosome	13 (Build37)
Map Location	33,478,061 - 33,479,243
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Wrnip1, Serpinb1a, Serpinb1-ps1, Serpinb1c, Serpinb6b, Serpinb9, Serpinb9b, Serpinb1b, LOC628301, Serpinb9c, Serpinb9d, Serpinb9e, Serpinb9f
Downstream gene	OTTMUSG00000000724, Serpinb9g, LOC100041370, EG619715, LOC382743, OTTMUSG00000000712, LOC193403, Vmn2r-ps94, OTTMUSG00000000720, Serpinb6c, Serpinb6a, Nqo2, 4930482L21Rik, Ripk1, Bphl, Tubb2a, LOC100042686, Tubb2b, 2310047M15Rik, 3110004L20Rik, LOC620132
Link	Open Mouse BAC browser

Click to get alignment info.

name	Wrnip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78903 MGI:1926153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66222 MGI:1913472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:282665 MGI:2445366
definition	gene_synonym : EID; ovalbumin note : serine (or cysteine) peptidase inhibitor, clade B, member 1, pseudogene pseudo : _no_value

name	Serpinb1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380839 MGI:2445363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20708 MGI:894688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20723 MGI:106603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20706 MGI:894668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:282663 MGI:2445361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins pseudo : _no_value

name	Serpinb9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20707 MGI:894669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb9d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20726 MGI:894667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb9e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20710 MGI:894672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb9f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20709 MGI:894671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000724 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544923 MGI:3709608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 52 ESTs, 39 Proteins

name	Serpinb9g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93806 MGI:1919260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG619715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619715 MGI:3648840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC382743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	OTTMUSG00000000712 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238568 MGI:3649829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC193403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:193403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	OTTMUSG00000000720 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435350 MGI:3651663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97848 MGI:2145481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpinb6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20719 MGI:103123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nqo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18105 MGI:104513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930482L21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435351 MGI:1922249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Ripk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19766 MGI:108212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bphl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68021 MGI:1915271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubb2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22151 MGI:107861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042686 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tubb2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73710 MGI:1920960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047M15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69666 MGI:1916916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs

name	3110004L20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73102 MGI:1920352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620132 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 448 ESTs, 13 Proteins pseudo : _no_value

name	Wrnip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981383 GeneID:78903 MGI:1926153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Werner helicase interacting protein 1 transcript_id : NM_030215.2

name	Serpinb1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158674 GeneID:66222 MGI:1913472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 1a transcript_id : NM_025429.2

name	Serpinb1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46395463 GeneID:380839 MGI:2445363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 1c transcript_id : NM_173051.1

name	Serpinb6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15826843 GeneID:20708 MGI:894688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 6b transcript_id : NM_011454.1

name	Serpinb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337275 GeneID:20723 MGI:106603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9 transcript_id : NM_009256.3

name	Serpinb9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385898 GeneID:20706 MGI:894668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9b transcript_id : NM_011452.2

name	Serpinb1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27413903 GeneID:282663 MGI:2445361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 1b transcript_id : NM_173052.1

name	Serpinb9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371127 GeneID:20707 MGI:894669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9c transcript_id : NM_011453.3

name	Serpinb9d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802884 GeneID:20726 MGI:894667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9d transcript_id : NM_011460.2

name	Serpinb9e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130179 GeneID:20710 MGI:894672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9e transcript_id : NM_011456.2

name	Serpinb9f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593100 GeneID:20709 MGI:894671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9f transcript_id : NM_183197.1

name	OTTMUSG00000000724 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94394773 GeneID:544923 MGI:3709608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 52 ESTs, 39 Proteins product : predicted gene, OTTMUSG00000000724 transcript_id : XM_619089.3

name	Serpinb9g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340615 GeneID:93806 MGI:1919260
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 9g transcript_id : NM_011455.2

name	EG619715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94394754 GeneID:619715 MGI:3648840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG619715 transcript_id : XM_895405.2

name	OTTMUSG00000000712 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115647929 GeneID:238568 MGI:3649829
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000712 transcript_id : NM_001076790.1

name	OTTMUSG00000000720 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865894 GeneID:435350 MGI:3651663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000720 transcript_id : NM_001045535.1

name	Serpinb6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347363 GeneID:97848 MGI:2145481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 6c transcript_id : NM_148942.2

name	Serpinb6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982000 GeneID:20719 MGI:103123
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade B, member 6a transcript_id : NM_009254.2

name	Nqo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981091 GeneID:18105 MGI:104513
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD(P)H dehydrogenase, quinone 2 transcript_id : NM_020282.2

name	Ripk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328466 GeneID:19766 MGI:108212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor (TNFRSF)-interacting serine-threonine kinase 1 transcript_id : NM_009068.3

name	Bphl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21624608 GeneID:68021 MGI:1915271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen) transcript_id : NM_026512.1

name	Tubb2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859487 GeneID:22151 MGI:107861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 2a transcript_id : NM_009450.1

name	LOC100042686 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263962 GeneID:100042686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042686 transcript_id : XM_001478636.1

name	Tubb2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378376 GeneID:73710 MGI:1920960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 2b transcript_id : NM_023716.2

name	2310047M15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263964 GeneID:69666 MGI:1916916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs product : RIKEN cDNA 2310047M15 gene, transcript variant 1 transcript_id : XM_884663.3

name	3110004L20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801990 GeneID:73102 MGI:1920352
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110004L20 gene transcript_id : NM_001033167.2

name	Wrnip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981384 CCDS:CCDS26427.1 GeneID:78903 MGI:1926153
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016887 - ATPase activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0000731 - DNA synthesis during DNA repair [Evidence ISS]; GO:0030174 - regulation of DNA replication initiation [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Werner syndrome homolog (human) interacting protein; Werner helicasae interacting protein 1 product : Werner helicase interacting protein 1 protein_id : NP_084491.2

name	Serpinb1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158675 CCDS:CCDS26428.1 GeneID:66222 MGI:1913472
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0042176 - regulation of protein catabolism [Evidence IPI] codon_start : 1 note : ovalbumin; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1a product : serine (or cysteine) proteinase inhibitor, clade B, member 1a protein_id : NP_079705.2

name	Serpinb1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46395464 CCDS:CCDS26429.1 GeneID:380839 MGI:2445363
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1c product : serine (or cysteine) proteinase inhibitor, clade B, member 1c protein_id : NP_766639.1

name	Serpinb6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15826844 CCDS:CCDS26430.1 GeneID:20708 MGI:894688
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 12 product : serine (or cysteine) proteinase inhibitor, clade B, member 6b protein_id : NP_035584.1

name	Serpinb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678101 CCDS:CCDS26431.1 GeneID:20723 MGI:106603
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA] codon_start : 1 note : serine protease inhibitor 6 product : serine (or cysteine) proteinase inhibitor, clade B, member 9 protein_id : NP_033282.1

name	Serpinb9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15826842 CCDS:CCDS26432.1 GeneID:20706 MGI:894668
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IDA] codon_start : 1 note : serine proteinase inhibitor R86; serine protease inhibitor 10 product : serine (or cysteine) proteinase inhibitor, clade B, member 9b protein_id : NP_035582.1

name	Serpinb1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27413904 CCDS:CCDS26433.1 GeneID:282663 MGI:2445361
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IPI] GO_process : GO:0042176 - regulation of protein catabolism [Evidence IPI] codon_start : 1 note : serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1b product : serine (or cysteine) proteinase inhibitor, clade B, member 1b protein_id : NP_766640.1

name	Serpinb9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15022803 GeneID:20707 MGI:894669
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 11 product : serine (or cysteine) proteinase inhibitor, clade B, member 9c protein_id : NP_035583.1

name	Serpinb9d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468935 CCDS:CCDS26434.1 GeneID:20726 MGI:894667
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 9 product : serine (or cysteine) proteinase inhibitor, clade B, member 9d protein_id : NP_035590.1

name	Serpinb9e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15826846 CCDS:CCDS26435.1 GeneID:20710 MGI:894672
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 14 product : serine (or cysteine) proteinase inhibitor, clade B, member 9e protein_id : NP_035586.1

name	Serpinb9f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593101 CCDS:CCDS26436.1 GeneID:20709 MGI:894671
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 13 product : serine (or cysteine) proteinase inhibitor, clade B, member 9f protein_id : NP_899020.1

name	OTTMUSG00000000724 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63641871 GeneID:544923 MGI:3709608
definition	codon_start : 1 product : similar to Serine (or cysteine) peptidase inhibitor, clade B, member 9f protein_id : XP_619089.1

name	Serpinb9g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070105 CCDS:CCDS26438.1 GeneID:93806 MGI:1919260
definition	codon_start : 1 exception : mismatches in translation note : ovalbumin product : serine (or cysteine) proteinase inhibitor, clade B, member 9g protein_id : NP_035585.1

name	EG619715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950098 GeneID:619715 MGI:3648840
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900498.1

name	OTTMUSG00000000712 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115647930 GeneID:238568 MGI:3649829
definition	codon_start : 1 product : hypothetical protein LOC238568 protein_id : NP_001070258.1

name	OTTMUSG00000000720 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865895 CCDS:CCDS26440.1 GeneID:435350 MGI:3651663
definition	codon_start : 1 product : hypothetical protein LOC435350 protein_id : NP_001039000.1

name	Serpinb6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142347364 GeneID:97848 MGI:2145481
definition	codon_start : 1 note : serine (or cysteine) proteinase inhibitor, clade B, member 6c product : serine proteinase inhibitor member 6C protein_id : NP_683744.2

name	Serpinb6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678097 CCDS:CCDS26441.1 GeneID:20719 MGI:103123
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : serine protease inhibitor 3; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 product : serine (or cysteine) proteinase inhibitor, clade B, member 6a protein_id : NP_033280.1

name	Nqo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9937970 CCDS:CCDS26442.1 GeneID:18105 MGI:104513
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003955 - NAD(P)H dehydrogenase (quinone) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NAD(P)H menadione oxidoreductase 2, dioxin inducible; NRH: quinone oxidoreductase product : NAD(P)H dehydrogenase, quinone 2 protein_id : NP_064678.1

name	Ripk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328467 CCDS:CCDS26443.1 GeneID:19766 MGI:108212
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : receptor (TNFRSF)-interacting serine-threonine kinase 1 protein_id : NP_033094.3

name	Bphl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624609 GeneID:68021 MGI:1915271
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 note : biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated antigen) product : biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen) protein_id : NP_080788.1

name	Tubb2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859488 CCDS:CCDS26444.1 GeneID:22151 MGI:107861
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, beta 2 protein_id : NP_033476.1

name	LOC100042686 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263963 GeneID:100042686
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478686.1

name	Tubb2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746161 CCDS:CCDS26445.1 GeneID:73710 MGI:1920960
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, beta protein_id : NP_076205.1

name	2310047M15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950129 GeneID:69666 MGI:1916916
definition	codon_start : 1 product : hypothetical protein LOC69666 isoform 1 protein_id : XP_889756.1

name	3110004L20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701678 CCDS:CCDS26446.1 GeneID:73102 MGI:1920352
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73102 protein_id : NP_001028339.1

name	LOC100041370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041370
definition	number : 1 pseudo : _no_value

name	LOC100041370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041370
definition	number : 2 pseudo : _no_value

name	LOC100041370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041370
definition	number : 3 pseudo : _no_value

name	LOC100041370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041370
definition	number : 4 pseudo : _no_value

name	LOC100041370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041370
definition	number : 5 pseudo : _no_value

name	LOC382743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382743
definition	number : 1 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 1 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 2 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 3 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 4 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 5 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 6 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 7 pseudo : _no_value

name	LOC193403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:193403
definition	number : 8 pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619864
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619864
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619864
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619864
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619864
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps94 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619864
definition	number : 6 pseudo : _no_value

name	4930482L21Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435351
definition	number : 2

name	4930482L21Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435351
definition	number : 1

name	LOC628301 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94394772 GeneID:628301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins product : similar to prohibitin pseudo : _no_value transcript_id : XR_001895.1

name	LOC620132 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263965 GeneID:620132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 448 ESTs, 13 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_033823.1

clone name	MSMg01-502K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478B08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535F10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-119A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-237F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237A20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-129P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070N23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087D16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466J19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100P08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-418A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339I16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-180D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151O06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318F17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-122F16.b	B6Ng01-122F16.g
ACC	DH925802	DH925803
length	1,234	1,148
definition	DH925802\|Mus musculus domesticus DNA, BAC clone: B6Ng01-122F16, 5' end.	DH925803\|Mus musculus domesticus DNA, BAC clone: B6Ng01-122F16, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctattagacctccaaaggagacctaattccaactctcgtcaaatg attacacaaaatagatacagaaggtactcttcccaattcattctatgaag ccacaattactctgatacctaagccacactaagattcaacaaagaaggag aacttcagatcaatttctcttattaatatcgatgccaaaatactcaataa aatccttgcaaaccaaatccaaaaacacatcaaaaggatcatccatcatt accaagtaggcttcatcccagggatgcagggatggtttaatatacggaaa tttatcaacgtaatccactatatagacaaactcaaagacaaaaatcacat tatcatttcattagatgctgtgaaagcatttgacaaaaatccaacacccc ttcatgagaaaagccatggattgatcaggaattcaaggcccattccttaa cataataaaagcaatatacagcaaaccagtggcaaacatcaacctaaatg gagagaagctggaagcattcccactaaaatctgggattagaaaaggctgc ccacattctccatacctattcaatatagtacttgaagtcctagccagagt aatttgacaacaaaaggagatcaagaggatacaaattggaaaggtagaat tcaaaacatccctacttgcagatgatatgatagtatatataagtgatcct aaaaattccaccagacaactcctaaacctgataaacagcttcattgaagt agctggatataaaattaactcaaacaaatcagtgacctttctgtacacaa aggataaacaggctacgaaagagattagggaaaccctccacaatagtcac aaataatataaaataccttggtgtgaccctaactaagaaagtaaaaaatc tttatgacagaacttgaagtctctgagaaagaaattgaagagatctcaga agatgaaaggatctcatgctcatgggattggcaggattaatatagtaaaa tgactatctgctgaaagcatctacaaatcatgcatcgcatcaactcactc attcttcactggagttagaaagggcattggcaattactggataacaagaa ctaggatagcaaagtatactcacataaagatctctgtagaatctgatgcc tgaactcaaggtatctactagccatgggataactgctgctaatcagagca tgatgagagatcatgtgatatagatgatagtgaa	gaattcagaatttaaaattgaacctaaaactgtaattccttaaattaatg ggacgagaaatttttgaacatgcacgttgcactctgaaaaattggctttc gaaaaaaaggggggtgggatcatgttactgtacactaaaaaaaactctaa aatttctatgccaaggaaatctctgattgtggggaagagggcatgtttgt gttttttctacaggatgctgatgctaggtgccagagtgcttaatgagact tgctgatgctgggaaaaagaatgatgctcatcatgaagtttgtatagtat cctgacaattatgatagagaagctgtattgggcctacatccctgatgcac ccttttatacatccaacaatatgggaaggtctagaagtagtggtaatggt aaacaacactaagttgatggatatgcctaactgaggaaattttactatca atagagaaattaattactaaagatttagaactaatgtctccatatgcttt tgtaggatgtgcagctacaggtgcttctgccccagttttgcaaagaaaaa gttattagcttcttggaacagcaatagatacagaataaagaaaaaaatct gagtgcacagctctccacattgtccacacattaccctttttcttggctat ctctcttaagagaggacctgacacttgccaatattactggattaagaaat gtctcggcctgcttcctttgtgctgcattagatgtcctccttgactgttg tcccttatcccatccctttgaatacgtcttgtgccagtcctaaaaatttt gtccaattttgaagtatccttgttcttgatccctgaccaacaacaatgta attctgctatactagtcttttttaataaattaaggattttcctcattaca tttccaatgctatcccaaagcccccataccctcccaccttcctacccgtc actccccacttctgggcctgacattcccttgtactgagaatataattttg cacgaccatgggcctctgtttccactgatgccactaggcaccttctgtct atgagctagagacggaagctccgggggtactgttgtccatttttgtccac ctaagggttgcgatcttatcccttggaactttctatctcccattgggg
quality values	Open. Hide. 61 30 33 39 61 53 61 39 61 61 47 53 61 61 61 61 61 47 24 61 61 61 61 61 61 31 31 37 21 10 13 19 22 43 30 36 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 52 59 59 36 35 59 59 59 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 55 55 55 55 52 53 52 50 53 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 47 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 42 40 53 61 61 61 61 61 53 53 57 45 57 57 53 57 57 50 57 53 53 57 57 57 57 53 43 57 53 47 57 57 53 57 57 42 31 57 53 53 53 57 57 53 57 57 53 57 57 57 57 53 50 47 47 53 53 52 53 53 36 53 57 50 47 53 45 40 57 53 57 53 47 53 53 57 30 53 57 53 52 57 53 52 30 27 50 45 37 52 53 45 57 41 24 34 53 45 47 50 52 52 57 52 53 57 47 38 43 25 53 45 57 38 36 41 42 40 53 53 42 45 30 52 45 34 41 47 43 50 52 46 53 50 36 24 53 40 52 52 31 50 50 53 50 45 41 53 38 42 42 45 42 45 52 50 57 43 53 53 31 31 37 52 35 28 57 57 57 34 50 53 36 39 32 53 41 23 38 53 33 28 52 37 53 38 53 40 37 53 37 47 46 34 52 40 30 24 57 37 37 31 37 34 43 40 32 28 40 39 38 27 33 25 32 40 25 40 42 38 57 29 28 31 35 19 57 57 52 37 37 32 39 35 48 36 35 53 40 37 30 57 44 36 40 39 35 40 53 29 20 37 33 53 32 32 34 39 29 24 32 21 40 17 53 29 29 40 35 30 34 45 29 31 23 31 44 20 30 28 26 12 47 45 41 25 32 9 22 14 29 30 16 47 32 36 31 30 27 30 30 30 14 32 18 30 29 30 29 29 22 18 28 28 29 14 51 32 13 9 43 28 25 25 28 51 51 29 29 20 32 32 27 28 33 39 24 48 25 29 28 20 31 27 28 14 29 24 28 13 28 22 43 51 15 21 27 33 46 43 39 43 20 28 29 31 51 29 13 25 27 34 12 15 14 30 21 24 27 22 28 14 23 10 23 28 29 34 28 20 33 10 32 36 25 15 29 41 5 24 20 21 19 31 6 29 5 23 22 10 10 15 16 12 41 22 14 20 8 23 30 51 32 7 6 18 23 14 16 24 15 25 29 23 34 28 13 21 25 36 7 9 16 28 23 15 11 14 28 23 31 19 21 17 29 16 12 6 10 16 9 29 38 38 27 10 32 16 16 20 14 7 11 13 31 19 34 33 27 38 20 27 12 17 12 9 6 5 9 32 38 33 19 12 24 7 21 19 22 4 9 7 17 9 28 16 16 18 7 16 28 17 9 18 8 28 18 15 13 26 22 17 7 12 10 16 15 19 11 21 14 29 15 27 30 13 14 34 21 10 20 21 27 8 17 11 12 18 3 4 5 5 7 14 14 15 6 10 17 16 9 12 5 7 13 4 6 9 9 7 7 11 11 10 10 18 18 27 11 16 5 13 5 6 16 9 24 11 20 7 4 3 17 7 13 15 25 11 11 6 16 3 4 7 27 5 5 4 4 16 16 10 10 10 15 9 14 10 4 13 2 6 8 7 12 14 6 3 3 4 4 3 2 1 5 4 3 4 3 3 1 6 2 3 1 4 4 6 3 5 12 3 3 2 2 1 4 4 9 4 5 4 4 20 6 6 9 13 4 17 3 3 3 6 9 5 5 18 4 18 4 13 5 7 8 4 5 4 23 6 3 8 5 4 3 1 1 2 3	Open. Hide. 50 61 35 47 24 14 14 9 19 16 27 55 55 37 50 50 55 55 61 55 61 55 55 61 61 55 55 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 59 61 59 61 59 61 59 43 59 59 35 61 52 61 61 61 61 59 59 61 61 61 61 59 59 59 61 61 59 59 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 59 61 61 61 61 59 59 59 61 59 61 61 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 61 61 61 61 61 59 59 59 59 59 59 61 59 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 55 61 55 55 55 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 55 55 55 47 55 55 61 55 61 61 61 61 61 61 61 61 55 50 55 49 55 50 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 61 61 50 55 61 50 55 61 61 61 61 61 61 61 61 61 61 61 50 53 39 50 53 43 61 61 61 61 53 53 53 61 61 53 53 61 50 50 50 47 61 61 61 61 53 61 61 61 61 61 43 47 61 53 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 42 39 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 50 61 61 61 61 61 53 57 57 57 53 53 57 52 53 53 57 53 57 53 53 57 57 57 52 50 53 43 53 53 28 57 53 53 53 53 50 53 53 52 57 45 47 47 53 57 53 57 57 57 53 42 41 57 57 53 47 47 47 57 57 57 46 45 53 42 57 45 57 57 57 57 57 33 47 52 45 36 37 53 42 53 53 53 53 53 50 57 53 57 53 50 53 53 53 53 42 53 52 36 41 37 47 53 38 31 53 47 50 53 57 57 42 53 57 57 57 57 57 35 33 53 52 52 57 27 50 53 42 45 52 52 50 53 53 53 43 50 53 33 40 32 52 52 53 30 53 36 44 44 41 53 35 57 23 39 24 57 53 44 57 57 57 10 24 40 31 34 44 33 37 30 36 40 47 53 41 36 53 31 36 41 36 57 34 38 16 32 33 20 34 37 39 45 28 36 37 36 57 30 42 37 35 41 40 40 44 36 36 31 33 53 36 29 20 25 33 53 33 57 57 35 31 40 25 53 37 53 37 23 23 57 33 47 33 33 37 33 53 36 51 32 32 27 30 29 22 38 29 32 23 33 8 6 17 25 46 25 24 38 29 39 48 25 40 31 30 23 27 47 10 25 36 25 38 47 29 29 14 29 25 29 51 31 29 28 25 51 27 25 45 30 27 38 36 28 30 31 24 32 39 22 39 38 16 29 28 35 28 25 28 41 38 28 29 46 46 43 28 37 51 43 30 12 12 29 36 23 17 46 51 46 29 17 27 39 30 35 26 29 23 33 29 13 20 19 26 33 21 32 28 20 19 24 46 36 22 29 29 31 30 19 28 15 30 17 10 26 11 17 35 12 30 30 15 15 26 24 24 25 31 23 24 19 23 21 29 22 31 33 33 43 46 41 38 24 20 10 25 5 38 24 15 34 12 10 13 17 9 10 36 36 21 29 23 18 17 6 17 13 14 19 13 30 38 25 7 12 19 14 15 31 19 34 11 23 13 42 27 28 38 32 19 33 38 38 38 33 23 15 10 23 51 19 12 6 35 26 6 6 10 20 23 22 28 25 19 24 35 18 28 16 29 4 7 14 19 39 30 15 9 10 35 8 6 8 12 35 6 21 13 26 31 31 25 22 27 16 34 42 27 7 9 17 7 9 12 12 12 12 8 10 4 4 7 6 22 21 16 34 36 18 8 6 14 12 9 29 6 13 17 10 23 37 9 15 20 10 12 15 21 13 33 27 18 7 7 9 26 23 17 11 27 5 7 16 9 9 6 12 8 13 15 6 7 20 25 14 10 4 5 4 2 3 4 3 7 5 12 22 5 5 9 4 3 4 11 6 5 5 4 5 13 8 9 4 6 36 27 12 6 9 19 5 1 3 7 2 3 4 4 7 4 17 24 30 18 10 18 7 12 4 5 13 5 12 14 10 30 13 12 6 3 3 3 17 10 14 6 4 3 3 1 3 13 3 4 4 4 2 6 10 21 13 7 18 5 5 9 3 3 13 13 16 7 6 4 13 11 7 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_33478061_33479243
seq2: B6Ng01-122F16.g_67_1214 (reverse)

seq1  CCCCAATGGAGGAGATAGAGAAAGTACCCAAGGAGATAAAGGGATCTGCA  50
      ||||||||  ||||||  |||||||  |||||| |||||   |||| |||
seq2  CCCCAATG--GGAGAT--AGAAAGT-TCCAAGG-GATAA---GATC-GCA  40

seq1  ACCCTTTAGGTGGAACAAAAATATGAACTAACTAGTACCCCCCGGAGCTC  100
      |||| |||||||| ||||||  ||| || ||| |||| ||||||||||| 
seq2  ACCC-TTAGGTGG-ACAAAA--ATGGAC-AAC-AGTA-CCCCCGGAGCTT  83

seq1  CTGTCTCTAGCTTCATATGTATCAGAAGTTGGCCTAGTTGGCCATCAGTG  150
      | ||||||||| |||||     |||||| | |||||||  | ||||||||
seq2  CCGTCTCTAGC-TCATA---GACAGAAGGT-GCCTAGT--GGCATCAGTG  126

seq1  GAAACAGAGGCCCATTGGTCGTGCAAAATTTATATGTCTCAGTACAGGGG  200
      |||||||||||||| ||||||||||||| |||||| |||||||||| |||
seq2  GAAACAGAGGCCCA-TGGTCGTGCAAAA-TTATAT-TCTCAGTACAAGGG  173

seq1  AATGTCAGGGCCAAGAAGT-GGGAGTGGACGGGTAGGGAAGTGGGAGGGT  249
      ||||||| |||| |||||| |||||| |||||||||| | ||||||||||
seq2  AATGTCA-GGCCCAGAAGTGGGGAGT-GACGGGTAGGAAGGTGGGAGGGT  221

seq1  ATGGGGGCTTTTGGGATAGCATTGGAAATGTAAATGAGGAAAATCCCTAA  299
      |||||||| |||||||||||||||||||||| |||||||||||||| |||
seq2  ATGGGGGC-TTTGGGATAGCATTGGAAATGT-AATGAGGAAAATCCTTAA  269

seq1  TTTAATTAAAAAAGACTAGTATAGCAGAATTTACATTGTTGTTGGTCAGG  349
      ||| ||||||||||||||||||||||||| ||||||||||||||||||||
seq2  TTT-ATTAAAAAAGACTAGTATAGCAGAA-TTACATTGTTGTTGGTCAGG  317

seq1  GATCAAGAACAAGGATACTTCAAAAATTGGACAAAAATTTTTAGGACTGG  399
      ||||||||||||||||||||| |||||||||| |||||||||||||||||
seq2  GATCAAGAACAAGGATACTTC-AAAATTGGAC-AAAATTTTTAGGACTGG  365

seq1  CACAAGACGTATTCAAAGGGATGGGATAAGGGACAACAGTCAAGGAGGAC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAGACGTATTCAAAGGGATGGGATAAGGGACAACAGTCAAGGAGGAC  415

seq1  ATCCTAATGCAGCACAAAGGAAGCAGGCCGAGACATTTCTTAATCCAGTA  499
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  AT-CTAATGCAGCACAAAGGAAGCAGGCCGAGACATTTCTTAATCCAGTA  464

seq1  ATATTGGCAAGTGTCAGGTCCTCTCTTAAGAGAGATAGCCAAGAAAAAGG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGGCAAGTGTCAGGTCCTCTCTTAAGAGAGATAGCCAAGAAAAAGG  514

seq1  GTAATGTGTGGACAATGTGGAGAGCTGTGCACTCAGATTTTTTTCTTTAT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATGTGTGGACAATGTGGAGAGCTGTGCACTCAGATTTTTTTCTTTAT  564

seq1  TCTGTATCTATTGCTGTTCCAAGAAGCTAATAACTTTTTCTTTGCAAAAC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTATCTATTGCTGTTCCAAGAAGCTAATAACTTTTTCTTTGCAAAAC  614

seq1  TGGGGCAGAAGCACCTGTAGCTGCACATCCTACAAAAGCATATGGAGACA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGCAGAAGCACCTGTAGCTGCACATCCTACAAAAGCATATGGAGACA  664

seq1  TTAGTTCTAAATCTTTAGTAATTAATTTCTCTATTGATAGTAAAATTTCC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTCTAAATCTTTAGTAATTAATTTCTCTATTGATAGTAAAATTTCC  714

seq1  TCAGTTAGGCATATCCATCAACTTAGTGTTGTTTACCATTACCACTACTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTAGGCATATCCATCAACTTAGTGTTGTTTACCATTACCACTACTT  764

seq1  CTAGACCTTCCCATATTGTTGGATGTATAAAAGGGTGCATCAGGGATGTA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGACCTTCCCATATTGTTGGATGTATAAAAGGGTGCATCAGGGATGTA  814

seq1  GGCCCAATACAGCTTCTCTATCATAATTGTCAGGATACTATACAAACTTC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCAATACAGCTTCTCTATCATAATTGTCAGGATACTATACAAACTTC  864

seq1  ATGATGAGCATCATTCTTTTTCCCAGCATCAGCAAGTCTCATTAAGCACT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATGAGCATCATTCTTTTTCCCAGCATCAGCAAGTCTCATTAAGCACT  914

seq1  CTGGCACCTAGCATCAGCATCCTGTAGAAAAAACACAAACATGCCCTCTT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCACCTAGCATCAGCATCCTGTAGAAAAAACACAAACATGCCCTCTT  964

seq1  CCCCACAATCAGAGATTTCCTTGGCATAGAAATTTTAGAGTTTTTTTTAG  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACAATCAGAGATTTCCTTGGCATAGAAATTTTAGAGTTTTTTTTAG  1014

seq1  TGTACAGTAACATGATCCCACCCCCCTTTTTTTCGAAAGCCAATTTTTCA  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACAGTAACATGATCCCACCCCCCTTTTTTTCGAAAGCCAATTTTTCA  1064

seq1  GAGTGCAACGTGCATGTTCAAAAATTTCTCGTCCCATTAATTTAAGGAAT  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGCAACGTGCATGTTCAAAAATTTCTCGTCCCATTAATTTAAGGAAT  1114

seq1  TACAGTTTTAGGTTCAATTTTAAATTCTGAATTC  1183
      ||||||||||||||||||||||||||||||||||
seq2  TACAGTTTTAGGTTCAATTTTAAATTCTGAATTC  1148

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information