MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-239K07
Chromosome	13 (Build37)
Map Location	61,611,879 - 61,686,587
singlet/doublet	doublet
Overlap gene	LOC665717, Ctsm, Cts3
Upstream gene	Dapk1, LOC218274, BC051665, 2310051M13Rik, 4930486L24Rik, Tpbpb, Ctla2a, Tpbpa, Ctsj, Ctsq, Ctsr, Cts6, Cts8, Cts8-ps, LOC435362, Cts7, Cts7-ps, EG624056
Downstream gene	EG665401, LOC624140, EG623505, LOC665415, LOC673332, BC052688, EG638502, LOC100041382, EG633250, EG624180, LOC100041420, LOC665444, EG630579, EG630594, LOC665455, LOC100041430, LOC100041962, LOC100041437, LOC100041979, LOC100041986, 8430426H19Rik, LOC100041455, 6720457D02Rik, EG665503
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dapk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69635 MGI:1916885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC218274 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:218274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	BC051665 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218275 MGI:2682300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310051M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70202 MGI:1917452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930486L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214639 MGI:1922258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpbpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116913 MGI:2151721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctla2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13024 MGI:88554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpbpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21984 MGI:98795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26898 MGI:1349426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104002 MGI:2137385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56835 MGI:1861723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58518 MGI:1889619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56094 MGI:1860275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts8-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116911 MGI:2151708
definition	gene_synonym : Cts2-ps note : cathepsin 8, pseudogene pseudo : _no_value

name	LOC435362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cts7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56092 MGI:1860262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116909 MGI:2151716
definition	gene_synonym : Cts1; Cts1-ps note : cathepsin 7, pseudogene pseudo : _no_value

name	EG624056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624056 MGI:3643776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	LOC665717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 39 ESTs, 7 Proteins pseudo : _no_value

name	Ctsm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64139 MGI:1927229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117066 MGI:2151929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665401 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665401 MGI:3647115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs, 6 Proteins pseudo : _no_value

name	LOC624140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	EG623505 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623505 MGI:3644667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 95 ESTs, 5 Proteins

name	LOC665415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 82 ESTs, 1 Protein pseudo : _no_value

name	LOC673332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC052688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432812 MGI:3583898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 48 ESTs

name	EG638502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638502 MGI:3643235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG633250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633250 MGI:3649075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	EG624180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624180 MGI:3647766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 93 ESTs, 7 Proteins

name	LOC100041420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	LOC665444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 2 Proteins pseudo : _no_value

name	EG630579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630579 MGI:3704127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630594 MGI:3649149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 75 ESTs, 5 Proteins pseudo : _no_value

name	LOC665455 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 41 ESTs pseudo : _no_value

name	LOC100041430 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100041962 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs

name	LOC100041437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041979 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	LOC100041986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs

name	8430426H19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71508 MGI:1918758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041455 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	6720457D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77117 MGI:1924367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665503 MGI:3645656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 101 ESTs, 7 Proteins

name	Dapk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205417 GeneID:69635 MGI:1916885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death associated protein kinase 1 transcript_id : NM_029653.2

name	Dapk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205407 GeneID:69635 MGI:1916885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death associated protein kinase 1 transcript_id : NM_134062.1

name	BC051665 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255290 GeneID:218275 MGI:2682300
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC051665 transcript_id : NM_199148.1

name	2310051M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367151 GeneID:70202 MGI:1917452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310051M13 gene transcript_id : NM_027344.3

name	4930486L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342510 GeneID:214639 MGI:1922258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930486L24 gene transcript_id : NM_178098.2

name	Tpbpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345208 GeneID:116913 MGI:2151721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophoblast specific protein beta transcript_id : NM_026429.2

name	Ctla2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681076 GeneID:13024 MGI:88554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytotoxic T lymphocyte-associated protein 2 alpha transcript_id : NM_007796.1

name	Tpbpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386437 GeneID:21984 MGI:98795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophoblast specific protein alpha transcript_id : NM_009411.3

name	Ctsj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7770061 GeneID:26898 MGI:1349426
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin J transcript_id : NM_012007.1

name	Ctsq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892435 GeneID:104002 MGI:2137385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin Q transcript_id : NM_029636.3

name	Ctsr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9931985 GeneID:56835 MGI:1861723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin R transcript_id : NM_020284.1

name	Cts6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946819 GeneID:58518 MGI:1889619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 6 transcript_id : NM_021445.1

name	Cts8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358367 GeneID:56094 MGI:1860275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 8 transcript_id : NM_019541.2

name	Cts7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130674 GeneID:56092 MGI:1860262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 7 transcript_id : NM_019539.3

name	EG624056 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63642993 GeneID:624056 MGI:3643776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : predicted gene, EG624056 transcript_id : XM_621334.1

name	Ctsm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981228 GeneID:64139 MGI:1927229
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin M transcript_id : NM_022326.2

name	Cts3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19424143 GeneID:117066 MGI:2151929
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 3 transcript_id : NM_026906.2

name	EG623505 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395163 GeneID:623505 MGI:3644667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 95 ESTs, 5 Proteins product : predicted gene, EG623505 transcript_id : XM_887972.2

name	LOC673332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264255 GeneID:673332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CDNA sequence BC012278 transcript_id : XM_001476261.1

name	BC052688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395164 GeneID:432812 MGI:3583898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs product : cDNA sequence BC052688, transcript variant 1 transcript_id : XM_888474.2

name	EG633250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264257 GeneID:633250 MGI:3649075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : predicted gene, EG633250 transcript_id : XM_976926.2

name	EG624180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395177 GeneID:624180 MGI:3647766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 93 ESTs, 5 Proteins product : predicted gene, EG624180, transcript variant 1 transcript_id : XM_892559.2

name	EG624180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395178 GeneID:624180 MGI:3647766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 78 ESTs, 4 Proteins product : predicted gene, EG624180, transcript variant 2 transcript_id : XM_900173.2

name	EG630579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815831 GeneID:630579 MGI:3704127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG630579 transcript_id : NM_001039239.2

name	LOC100041430 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264260 GeneID:100041430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001476372.1

name	LOC100041962 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264283 GeneID:100041962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs product : similar to gag protein transcript_id : XM_001477652.1

name	LOC100041979 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264286 GeneID:100041979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to crooked legs CG14938-PB transcript_id : XM_001477671.1

name	LOC100041986 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264288 GeneID:100041986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs product : similar to 6720457D02Rik protein transcript_id : XM_001477695.1

name	8430426H19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665715 GeneID:71508 MGI:1918758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430426H19 gene transcript_id : NM_178875.3

name	6720457D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354343 GeneID:77117 MGI:1924367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720457D02 gene transcript_id : NM_175252.3

name	EG665503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264290 GeneID:665503 MGI:3645656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 101 ESTs, 5 Proteins product : predicted gene, EG665503, transcript variant 2 transcript_id : XM_981603.2

name	EG665503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264291 GeneID:665503 MGI:3645656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 86 ESTs, 4 Proteins product : predicted gene, EG665503, transcript variant 1 transcript_id : XM_981561.2

name	Dapk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205418 CCDS:CCDS26581.1 GeneID:69635 MGI:1916885
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence IDA]; GO:0005516 - calmodulin binding [Evidence IEA] [Evidence IDA]; GO:0004684 - calmodulin-dependent protein kinase I activity [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence TAS]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : death associated protein kinase 1 protein_id : NP_083929.2

name	Dapk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205408 GeneID:69635 MGI:1916885
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence IDA]; GO:0005516 - calmodulin binding [Evidence IEA] [Evidence IDA]; GO:0004684 - calmodulin-dependent protein kinase I activity [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence TAS]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : death associated protein kinase 1 protein_id : NP_598823.1

name	BC051665 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255291 CCDS:CCDS26582.1 GeneID:218275 MGI:2682300
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cathepsin L-like product : hypothetical protein LOC218275 protein_id : NP_954599.1

name	2310051M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625773 GeneID:70202 MGI:1917452
definition	GO_function : GO:0004217 - cathepsin L activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70202 protein_id : NP_081620.2

name	4930486L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017423 CCDS:CCDS26583.1 GeneID:214639 MGI:1922258
definition	codon_start : 1 product : testin protein_id : NP_835199.1

name	Tpbpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385926 GeneID:116913 MGI:2151721
definition	codon_start : 1 product : trophoblast specific protein beta protein_id : NP_080705.1

name	Ctla2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681077 GeneID:13024 MGI:88554
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cytotoxic T lymphocyte-associated protein 2 alpha protein_id : NP_031822.1

name	Tpbpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560633 GeneID:21984 MGI:98795
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : clone 4311 product : trophoblast specific protein alpha protein_id : NP_033437.2

name	Ctsj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7770062 GeneID:26898 MGI:1349426
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : cathepsin P; rat gene/Cathepsin L-related protein; Cat P product : cathepsin J protein_id : NP_036137.1

name	Ctsq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532972 CCDS:CCDS26584.1 GeneID:104002 MGI:2137385
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : cathepsin Q protein_id : NP_083912.2

name	Ctsr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9931986 CCDS:CCDS26585.1 GeneID:56835 MGI:1861723
definition	GO_component : GO:0005764 - lysosome [Evidence ISS] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : lysosomal cysteine protease product : cathepsin R protein_id : NP_064680.1

name	Cts6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946820 CCDS:CCDS26586.1 GeneID:58518 MGI:1889619
definition	codon_start : 1 product : cathepsin 6 protein_id : NP_067420.1

name	Cts8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358368 CCDS:CCDS26587.1 GeneID:56094 MGI:1860275
definition	GO_function : GO:0004217 - cathepsin L activity [Evidence ISS] codon_start : 1 exception : mismatches in translation note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 68 product : cathepsin 8 protein_id : NP_062414.2

name	Cts7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956098 CCDS:CCDS26588.1 GeneID:56092 MGI:1860262
definition	GO_function : GO:0004217 - cathepsin L activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 24 product : cathepsin 7 protein_id : NP_062412.1

name	EG624056 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63642994 GeneID:624056 MGI:3643776
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621334.1

name	Ctsm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981229 GeneID:64139 MGI:1927229
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : Cat M product : cathepsin M protein_id : NP_071721.2

name	Cts3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424144 GeneID:117066 MGI:2151929
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin 3 precursor protein_id : NP_081182.2

name	EG623505 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952669 GeneID:623505 MGI:3644667
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_893065.1

name	LOC673332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264256 GeneID:673332
definition	codon_start : 1 product : similar to CDNA sequence BC012278 protein_id : XP_001476311.1

name	BC052688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952763 GeneID:432812 MGI:3583898
definition	codon_start : 1 product : similar to RIKEN cDNA 8430426H19 gene isoform 1 protein_id : XP_893567.1

name	EG633250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264258 GeneID:633250 MGI:3649075
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982020.2

name	EG624180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950648 GeneID:624180 MGI:3647766
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 1 protein_id : XP_897652.1

name	EG624180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950650 GeneID:624180 MGI:3647766
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 2 protein_id : XP_905266.1

name	EG630579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815832 GeneID:630579 MGI:3704127
definition	codon_start : 1 product : hypothetical protein LOC630579 protein_id : NP_001034328.2

name	LOC100041430 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264261 GeneID:100041430
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476422.1

name	LOC100041962 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264284 GeneID:100041962
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001477702.1

name	LOC100041979 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264287 GeneID:100041979
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477721.1

name	LOC100041986 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264289 GeneID:100041986
definition	codon_start : 1 product : similar to 6720457D02Rik protein protein_id : XP_001477745.1

name	8430426H19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665716 GeneID:71508 MGI:1918758
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB zinc finger protein product : hypothetical protein LOC71508 protein_id : NP_849206.2

name	6720457D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424892 GeneID:77117 MGI:1924367
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC77117 protein_id : NP_780461.1

name	EG665503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395189 GeneID:665503 MGI:3645656
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 1 protein_id : XP_986655.1

name	EG665503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395187 GeneID:665503 MGI:3645656
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 2 protein_id : XP_986697.1

name	LOC218274 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218274
definition	number : 1 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 8 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 7 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 6 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 5 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 4 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 3 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 2 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 1 pseudo : _no_value

name	EG638502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638502
definition	number : 1 pseudo : _no_value

name	EG638502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638502
definition	number : 2 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 1 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 2 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 3 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 4 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 4 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 3 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 2 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 1 pseudo : _no_value

name	LOC665717 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264273 GeneID:665717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 39 ESTs, 7 Proteins product : similar to protein-tyrosine-phosphatase pseudo : _no_value transcript_id : XR_001777.2

name	EG665401 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264274 GeneID:665401 MGI:3647115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs, 6 Proteins product : predicted gene, EG665401 pseudo : _no_value transcript_id : XR_033251.1

name	LOC624140 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264254 GeneID:624140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to Proteasome subunit alpha type 2 (Proteasome component C3) (Macropain subunit C3) (Multicatalytic endopeptidase complex subunit C3) pseudo : _no_value transcript_id : XR_032627.1

name	LOC665415 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264276 GeneID:665415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 82 ESTs, 1 Protein product : similar to RIKEN cDNA 4933434E20 gene pseudo : _no_value transcript_id : XR_033259.1

name	LOC100041420 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264259 GeneID:100041420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to crooked legs CG14938-PB pseudo : _no_value transcript_id : XR_032690.1

name	LOC665444 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264277 GeneID:665444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 2 Proteins product : similar to RIKEN cDNA 8430426H19 gene pseudo : _no_value transcript_id : XR_033290.1

name	EG630594 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264281 GeneID:630594 MGI:3649149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 75 ESTs, 5 Proteins product : predicted gene, EG630594 pseudo : _no_value transcript_id : XR_001823.2

name	LOC665455 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264282 GeneID:665455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 41 ESTs product : similar to Proteasome subunit alpha type 2 (Proteasome component C3) (Macropain subunit C3) (Multicatalytic endopeptidase complex subunit C3) pseudo : _no_value transcript_id : XR_033329.1

name	LOC100041437 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264263 GeneID:100041437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins product : similar to high mobility group nucleosomal binding domain 2 pseudo : _no_value transcript_id : XR_032711.1

clone name	MSMg01-367L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-275G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382I13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-530O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-064N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435P07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339K13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361O23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393E12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301F16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114H21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450P10
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-227I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286B14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-239K07.b	B6Ng01-239K07.g
ACC	GA050013	GA050014
length	1,162	1,134
definition	B6Ng01-239K07.b	B6Ng01-239K07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(61,685,415 - 61,686,587)	(61,611,879 - 61,613,022)
sequence	gaattctcactggacataggctttgggagacacttaaacaaaataattat tagtataaccattcctcccattatggtgtaagtggctatccacacatggc caaacaccccctttctttatattgcccacgaaagaaatgaccacctttag gagagtaaggaggcataaatcaagacaattagaaggtccacataaatccc aattgttcataatgggattgtattgaaatctaatgggattcctgctaacg aagagaataatattgcaatcattatatgtgataaacctccacataccaag agtgagcttaaatgataacattgggtattccctggcaaattttacaccta gtgcaggctgtcagtgcttgcaagggataagaagtctaacaaaagtgggc atttgagggacccgtttacagtgagtcaggggtggatgtgatattcctgg gggaatcctttggtgatttgtgaccagtgaacagactgtgaagttccatc cctaaatcatgccaggtgtgagctggtggtacctccaatagggctggagt ggaaggattagtgagcgaggaaacttggacagcggtgccggagtccagct tggattctgaagcagaggcaccccatccttatcgctgaaatcaacctgtt tgctggaaaaagtggaatgggttcagtaatggaaaggtgaatattagcat gatcctggctgtgtttgttatgggcagccacaaaatgaggaagatgaagt agtccatcaaccacattgggtgccagatattgcatgtgccatggacagat ctcctcctgaccctatctgcacttgagggttgtgggcaagctggcagaga gtcaaagacaccaggagcaggagagaaatgctgcagcaaggtcatctgag caagctgcaagctcctttaatccttctaccaaggccccaatgggttccaa gaaagtatctattctaaacagcagttcctgattagctggcattatttgca ccacaatccttgctctctcagtggtccactgtacttctctgcaggaatgc tggtgtccacaaggcagactcatgggttctctttaggagatggcttttgc actgccatggtccccagcatttacttaaagcaggctggccttctgctaca ttcagatagaaa	gaattcacactggagagagagtttatcaacgtgtcttatattagataata tagagaagtctaagaatttcctgagtcttcattgtcatgaacatatgtgt attggcaagaaatcatctgaacataatccatgtggtaaagctgtagccca gcacagacaggtatctcccaatgcagaagggagtacatacaggagggggg gggcttatgaatgcactcaatgtggtaaacatttgcatatcacagtcatc ttaaaatacataaaagagcacatagtggagagaaacccaacaaatgtaat aaacgtaataatgttttttcaacaaaacttagaatacataaaagaacaca caggtgaaagaaaccctaaaaacatattcaatgctgtaaatgcatgtcac agtaatctccagtacttaaaggaacacatgctggagagaaaaatcttcct catcgatgttgctaaacctttgcctgtcacagttatctcctagtgcataa aagaacacagacttataagaaaccttttgagaataagcagtgtggtaaag ttaatgcatgtatccgtttttttcaaaatcctgataaaaatctgtactgc agggaaactctataaatgtagtcagtgtggtgacatgttgcacttcacgg taactttatgagagaattaaacgtttagcatgtcatgaatctgttaaaga ttgcatgacagagtagtcgttgagaacccaaaagaactcatacttaatgc aatcagtgagtctggtggactctggtagaatctttagccaacccacttac attaagtaacagaaaattatttattcttgagaaaaacactagaagtgtca acaatctgctcaagtataatatggtctctattttgtttttaacctgcaaa ctcatgtggacaaaagccctatgaattttgattgataaggtaactggttt agctttcacaattctcttaaacgatatgcaaataactcattcaggtttaa ggctctatttgtgtatattagtgccatttgctgtgctgtgataaaaatgt ctggtatatttcaaaatgtatcccaaccagagtttaatacacatcttagc attaagcatttccagataagactcagaaaacctc
quality values	Open. Hide. 58 31 32 35 58 58 62 41 32 54 62 62 62 41 46 46 62 62 62 62 62 62 62 62 49 62 62 47 47 44 43 41 44 45 28 28 28 34 46 46 59 49 38 49 59 59 59 59 62 62 59 59 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 59 62 62 62 62 54 54 59 62 54 54 62 62 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 37 46 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 54 62 62 62 47 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 45 58 36 38 58 58 54 58 58 58 58 58 54 58 48 58 58 58 54 58 58 58 58 58 58 52 58 58 58 58 54 54 58 58 58 54 58 45 24 54 54 43 48 52 58 58 54 58 54 42 38 58 54 49 54 58 58 46 58 58 27 58 28 58 54 38 38 58 58 54 52 58 58 58 54 46 50 51 51 49 52 58 58 58 49 48 50 53 49 49 48 58 58 58 58 58 58 54 46 53 58 49 51 58 58 58 54 41 49 49 47 58 51 40 58 58 49 50 43 52 53 52 52 50 49 40 58 31 39 58 50 43 39 25 46 58 48 47 53 47 42 51 40 51 50 50 51 47 47 58 52 52 58 46 41 51 58 50 53 49 58 50 50 43 47 42 51 54 58 42 50 53 50 47 51 50 58 32 58 58 51 40 50 49 29 43 44 51 32 39 17 35 34 30 29 45 53 27 37 54 45 32 49 52 37 35 47 41 29 40 30 54 31 33 38 46 25 49 32 51 37 31 39 24 32 33 24 51 38 37 37 45 52 42 49 33 32 32 52 53 35 31 32 32 32 40 39 39 34 53 45 37 37 40 42 37 25 44 38 40 32 40 37 34 45 34 22 32 53 32 33 37 19 52 40 31 45 52 32 32 47 29 32 41 40 28 40 33 33 31 23 31 26 46 16 46 23 31 34 29 46 41 16 31 17 19 18 18 25 15 31 18 14 31 30 39 29 33 19 51 16 44 46 28 18 27 29 43 31 25 27 24 37 32 30 27 46 24 32 33 36 24 31 23 48 17 43 25 32 24 32 31 14 31 25 35 31 27 25 24 38 22 46 23 12 16 27 25 32 13 37 28 27 31 25 22 14 11 20 24 17 32 31 12 9 18 24 31 44 19 20 31 21 26 19 24 29 38 48 33 24 32 28 35 32 31 31 13 33 32 23 31 44 13 22 23 24 34 32 24 25 14 17 21 23 32 33 31 32 29 24 32 32 30 20 22 17 18 29 32 32 39 27 15 20 7 5 10 9 4 4 22 32 17 29 18 14 20 14 31 23 18 20 27 19 15 7 5 4 7 4 9 6 11 13 24 3 3 3 9 17 6 19 6 5 3 9 18 18 13 12 16 14 15 28 18 26 27 19 9 20 8 9 6 4 7 10 11 26 23 22 13 5 9 5 3 5 6 3 6 17 16 5 5 6 2 2 2 8 8 4 2 6 7 4 4 5 7 7 6 7 11 11 7 6 6 6 19 7 11 4 8 15 6 16 3 2 9 21 23 20 11 5 7 8 17 27 13 8 6 5 4 11 25 8 15 9 22 12 5 6 4 6 6 14 6 5 3 8 6 11 10 14 9 11 6 4 7 4 7 4 2 5 8 6 11 20 1	Open. Hide. 62 47 39 47 62 47 42 62 62 62 43 44 34 20 16 24 23 29 29 33 49 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 59 50 56 59 49 50 62 56 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 52 58 58 58 58 54 58 58 58 54 58 58 58 43 46 58 58 58 58 58 58 52 58 58 52 54 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 58 54 54 58 58 58 58 49 48 50 39 58 58 51 53 58 58 58 58 58 51 53 58 58 58 58 52 51 58 58 54 58 58 58 58 51 50 35 49 43 58 58 51 45 58 58 58 58 51 58 58 58 54 58 53 58 58 54 58 54 58 50 58 47 49 58 52 58 41 50 51 54 58 58 50 58 51 49 37 58 58 51 53 50 58 58 41 47 58 50 58 58 43 53 53 51 58 32 58 42 58 41 34 53 52 54 51 53 53 51 58 52 54 41 51 50 47 58 53 52 52 50 46 54 44 52 53 53 54 49 38 42 49 39 42 53 37 50 51 49 35 51 53 41 38 45 45 54 24 45 53 31 39 39 37 49 52 52 54 33 54 27 38 25 33 28 51 54 54 45 54 47 39 53 53 42 52 32 40 45 34 26 51 40 51 32 25 34 35 52 32 40 39 46 32 28 40 40 31 49 49 31 49 32 35 19 32 39 31 38 40 31 40 31 53 43 35 45 42 53 37 31 29 52 47 31 35 34 47 51 31 40 31 32 27 41 26 41 42 31 31 32 31 30 32 40 30 31 51 51 41 23 21 33 30 45 47 45 30 30 16 30 28 38 31 37 16 42 48 46 46 29 25 25 24 33 42 24 34 33 29 31 41 31 31 29 31 32 27 33 30 31 31 31 30 27 27 26 29 31 31 31 36 33 29 27 30 31 39 44 31 38 36 43 32 30 32 48 47 23 31 24 48 48 48 31 14 29 23 31 25 39 25 32 48 31 31 30 32 30 31 39 30 33 26 22 21 33 48 44 33 25 31 33 38 31 31 31 25 33 36 19 48 44 22 29 31 29 25 31 25 14 18 10 8 15 16 11 29 27 27 31 35 19 47 19 29 22 20 30 47 12 26 7 6 5 7 4 9 23 32 18 6 15 4 47 19 32 27 32 16 22 31 32 32 9 34 10 23 32 18 32 31 32 13 30 25 32 14 13 20 14 37 16 28 16 6 12 13 19 19 11 17 28 40 19 25 12 19 11 21 24 21 20 21 7 5 5 19 22 28 13 11 28 7 21 23 17 7 4 5 22 9 14 8 11 18 16 17 47 40 40 28 21 22 11 13 5 7 5 4 4 4 4 3 5 5 3 3 27 30 24 8 15 10 9 3 8 15 13 2 3 3 8 12 6 8 4 14 25 6 7 8 15 4 16 3 8 4 6 10 4 15 5 5 9 3 3 2 7 7 6 24 10 13 28 13 5 8 4 4 8 8 19 13 3 5 10 10 7 6 7 16 17 26 11 7 17 6 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_61685415_61686587
seq2: B6Ng01-239K07.b_45_1206 (reverse)

seq1  TTTCTTATCTAGAATGTAGCAGGAAAGGCAGCGCTGCCTTTATGTAAATG  50
      |||| ||||| |||||||||| ||| | |||| ||| ||||| |||||||
seq2  TTTC-TATCT-GAATGTAGCA-GAAGGCCAGC-CTG-CTTTAAGTAAATG  45

seq1  CTGGGGGCCATGCAGGTGCAAAAG-CATCTCCTTAAAGAGGACCCAATTG  99
      |||||| |||||   ||||||||| ||||||| ||||||| |||||  ||
seq2  CTGGGGACCATGGCAGTGCAAAAGCCATCTCC-TAAAGAGAACCCA--TG  92

seq1  AGGTCTGCC-TGT-GACACCAGCATTCCTGCAGGAGGAAGTAACAGTGGA  147
      | ||||||| ||| |||||||||||||||||||   ||||| ||||||||
seq2  A-GTCTGCCTTGTGGACACCAGCATTCCTGCAG--AGAAGT-ACAGTGGA  138

seq1  CCACTTGAGAGAGCAAGGATTGTTGGTGCAAATAATGCCAGCTAATCAGG  197
      |||| ||||||||||||||||| |||||||||||||||||||||||||||
seq2  CCAC-TGAGAGAGCAAGGATTG-TGGTGCAAATAATGCCAGCTAATCAGG  186

seq1  AACTGCTGTTTAGAATAGATACTTTCTTGGAACCCATTGGGGCCTTGGTA  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGCTGTTTAGAATAGATACTTTCTTGGAACCCATTGGGGCCTTGGTA  236

seq1  GAAGGATTAAAGGAGCTTGCAGCTTGCTCAGATGACCTTGCTGCAGCATT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGATTAAAGGAGCTTGCAGCTTGCTCAGATGACCTTGCTGCAGCATT  286

seq1  TCTCTCCTGCTCCTGGTGTCTTTGACTCTCTGCCAGCTTGCCCACAACCC  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCCTGCTCCTGGTGTCTTTGACTCTCTGCCAGCTTGCCCACAACCC  336

seq1  TCAAGTGCAGATAGGGTCAGGAGGAGATCTGTCCATGGCACATGCAATAT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGTGCAGATAGGGTCAGGAGGAGATCTGTCCATGGCACATGCAATAT  386

seq1  CTGGCACCCAATGTGGTTGATGGACTACTTCATCTTCCTCATTTTGTGGC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCACCCAATGTGGTTGATGGACTACTTCATCTTCCTCATTTTGTGGC  436

seq1  TGCCCATAACAAACACAGCCAGGATCATGCTAATATTCACCTTTCCATTA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCATAACAAACACAGCCAGGATCATGCTAATATTCACCTTTCCATTA  486

seq1  CTGAACCCATTCCACTTTTTCCAGCAAACAGGTTGATTTCAGCGATAAGG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACCCATTCCACTTTTTCCAGCAAACAGGTTGATTTCAGCGATAAGG  536

seq1  ATGGGGTGCCTCTGCTTCAGAATCCAAGCTGGACTCCGGCACCGCTGTCC  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGGTGCCTCTGCTTCAGAATCCAAGCTGGACTCCGGCACCGCTGTCC  586

seq1  AAGTTTCCTCGCTCACTAATCCTTCCACTCCAGCCCTATTGGAGGTACCA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTTCCTCGCTCACTAATCCTTCCACTCCAGCCCTATTGGAGGTACCA  636

seq1  CCAGCTCACACCTGGCATGATTTAGGGATGGAACTTCACAGTCTGTTCAC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCTCACACCTGGCATGATTTAGGGATGGAACTTCACAGTCTGTTCAC  686

seq1  TGGTCACAAATCACCAAAGGATTCCCCCAGGAATATCACATCCACCCCTG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCACAAATCACCAAAGGATTCCCCCAGGAATATCACATCCACCCCTG  736

seq1  ACTCACTGTAAACGGGTCCCTCAAATGCCCACTTTTGTTAGACTTCTTAT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCACTGTAAACGGGTCCCTCAAATGCCCACTTTTGTTAGACTTCTTAT  786

seq1  CCCTTGCAAGCACTGACAGCCTGCACTAGGTGTAAAATTTGCCAGGGAAT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTGCAAGCACTGACAGCCTGCACTAGGTGTAAAATTTGCCAGGGAAT  836

seq1  ACCCAATGTTATCATTTAAGCTCACTCTTGGTATGTGGAGGTTTATCACA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCAATGTTATCATTTAAGCTCACTCTTGGTATGTGGAGGTTTATCACA  886

seq1  TATAATGATTGCAATATTATTCTCTTCGTTAGCAGGAATCCCATTAGATT  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATGATTGCAATATTATTCTCTTCGTTAGCAGGAATCCCATTAGATT  936

seq1  TCAATACAATCCCATTATGAACAATTGGGATTTATGTGGACCTTCTAATT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATACAATCCCATTATGAACAATTGGGATTTATGTGGACCTTCTAATT  986

seq1  GTCTTGATTTATGCCTCCTTACTCTCCTAAAGGTGGTCATTTCTTTCGTG  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTGATTTATGCCTCCTTACTCTCCTAAAGGTGGTCATTTCTTTCGTG  1036

seq1  GGCAATATAAAGAAAGGGGGTGTTTGGCCATGTGTGGATAGCCACTTACA  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATATAAAGAAAGGGGGTGTTTGGCCATGTGTGGATAGCCACTTACA  1086

seq1  CCATAATGGGAGGAATGGTTATACTAATAATTATTTTGTTTAAGTGTCTC  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATAATGGGAGGAATGGTTATACTAATAATTATTTTGTTTAAGTGTCTC  1136

seq1  CCAAAGCCTATGTCCAGTGAGAATTC  1173
      ||||||||||||||||||||||||||
seq2  CCAAAGCCTATGTCCAGTGAGAATTC  1162

seq1: chr13_61611879_61613022
seq2: B6Ng01-239K07.g_66_1199

seq1  GAATTCACACTGGAGAGAGAGTTTATCAACGTGTCTTATATTAGATAATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACACTGGAGAGAGAGTTTATCAACGTGTCTTATATTAGATAATA  50

seq1  TAGAGAAGTCTAAGAATTTCCTGAGTCTTCATTGTCATGAACATATGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGAAGTCTAAGAATTTCCTGAGTCTTCATTGTCATGAACATATGTGT  100

seq1  ATTGGCAAGAAATCATCTGAACATAATCCATGTGGTAAAGCTGTAGCCCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGCAAGAAATCATCTGAACATAATCCATGTGGTAAAGCTGTAGCCCA  150

seq1  GCACAGACAGGTATCTCCCAATGCAGAAGGGAGTACATACAGGAGGGGGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAGACAGGTATCTCCCAATGCAGAAGGGAGTACATACAGGAGGGGGG  200

seq1  GGGCTTATGAATGCACTCAATGTGGTAAACATTTGCATATCACAGTCATC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTTATGAATGCACTCAATGTGGTAAACATTTGCATATCACAGTCATC  250

seq1  TTAAAATACATAAAAGAGCACATAGTGGAGAGAAACCCAACAAATGTAAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAATACATAAAAGAGCACATAGTGGAGAGAAACCCAACAAATGTAAT  300

seq1  AAACGTAATAATGTTTTTTCAACAAAACTTAGAATACATAAAAGAACACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGTAATAATGTTTTTTCAACAAAACTTAGAATACATAAAAGAACACA  350

seq1  CAGGTGAAAGAAACCCTAAAAACATATTCAATGCTGTAAATGCATGTCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTGAAAGAAACCCTAAAAACATATTCAATGCTGTAAATGCATGTCAC  400

seq1  AGTAATCTCCAGTACTTAAAGGAACACATGCTGGAGAGAAAAATCTTCCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAATCTCCAGTACTTAAAGGAACACATGCTGGAGAGAAAAATCTTCCT  450

seq1  CATCGATGTTGCTAAACCTTTGCCTGTCACAGTTATCTCCTAGTGCATAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCGATGTTGCTAAACCTTTGCCTGTCACAGTTATCTCCTAGTGCATAA  500

seq1  AAGAACACAGACTTATAAGAAACCTTTTGAGAATAAGCAGTGTGGTAAAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACACAGACTTATAAGAAACCTTTTGAGAATAAGCAGTGTGGTAAAG  550

seq1  TTAATGCATGTATCCGTTTTTTTCAAAATCCTGATAAAAATCTGTACTGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATGCATGTATCCGTTTTTTTCAAAATCCTGATAAAAATCTGTACTGC  600

seq1  AGGGAAACTCTATAAATGTAGTCAGTGTGGTGACATGTTGCACTTCACGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAAACTCTATAAATGTAGTCAGTGTGGTGACATGTTGCACTTCACGG  650

seq1  TAACTTTATGAGAGAATTAAACGTTTAGCATGTCATGAATCTGTTAAAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTTTATGAGAGAATTAAACGTTTAGCATGTCATGAATCTGTTAAAGA  700

seq1  TTGCATGACAGAGTAGTCGTTGAGAACCCAAAAGAACTCATACTTAATGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCATGACAGAGTAGTCGTTGAGAACCCAAAAGAACTCATACTTAATGC  750

seq1  AATCAGTGAGTCTGGTGGACTCTGGTAGAATCTTTAGCCAACCCACTTAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAGTGAGTCTGGTGGACTCTGGTAGAATCTTTAGCCAACCCACTTAC  800

seq1  ATTAAGTAACAGAAAATTATTTATTCTTGAGAAAAACACTAGAAGTGTCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAGTAACAGAAAATTATTTATTCTTGAGAAAAACACTAGAAGTGTCA  850

seq1  ACAATCTGCTCAAGTATAATATGGTCTCTATTTTGTTTTTAACCTGCAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATCTGCTCAAGTATAATATGGTCTCTATTTTGTTTTTAACCTGCAAA  900

seq1  CTCATGTGGACAAAAGCCCTATGAA-TTTGATTGATAAGGTAACTGGTTT  949
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  CTCATGTGGACAAAAGCCCTATGAATTTTGATTGATAAGGTAACTGGTTT  950

seq1  AGCTTTCACAATTCTCTTAAACGATATGC-AATAACTCATTCAGGTTTAA  998
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  AGCTTTCACAATTCTCTTAAACGATATGCAAATAACTCATTCAGGTTTAA  1000

seq1  AGCTCTATTTGTGTATATTAGTGCCA-TTGCTGTTGCTGTGATAAAAATG  1047
       ||||||||||||||||||||||||| |||||| ||||||||||||||||
seq2  GGCTCTATTTGTGTATATTAGTGCCATTTGCTG-TGCTGTGATAAAAATG  1049

seq1  TCTGTTATTATTTTTAAAAATGTAATCCCAAACCAGAGTTTATACCACAT  1097
      ||||    ||| ||| ||||||| ||||| ||||||||||||   |||||
seq2  TCTG---GTATATTTCAAAATGT-ATCCC-AACCAGAGTTTAATACACAT  1094

seq1  CTTTAGCCATTTAAAGCCATTTCCAGATAAAAGACTCAGAAAACCTC  1144
      | |||| ||||  ||| |||||||||||  |||||||||||||||||
seq2  C-TTAG-CATT--AAG-CATTTCCAGAT--AAGACTCAGAAAACCTC  1134

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information