MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-250D10
Chromosome	13 (Build37)
Map Location	74,509,946 - 74,511,121
singlet/doublet	singlet
Overlap gene	Zfp72
Upstream gene	Aytl2, Slc6a3, Clptm1l, Tert, Slc6a18, Slc6a19, Slc12a7, Nkd2, EG666360, Trip13, Brd9, Zdhhc11, LOC100042909, 2900041A09Rik, LOC621824, Cep72, Slc9a3, Exoc3, Ahrr, Pdcd6, Sdha, Ccdc127, AI595366
Downstream gene	LOC666670, LOC634386, LOC100042547, LOC666683, LOC547136, BC012278, LOC434490, Arts1, Cast, LOC622204, EG544954, Pcsk1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Aytl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210992 MGI:2384812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13162 MGI:94862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clptm1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218335 MGI:2442892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tert (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21752 MGI:1202709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22598 MGI:1336892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74338 MGI:1921588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20499 MGI:1342283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72293 MGI:1919543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666360 MGI:3643433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins

name	Trip13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69716 MGI:1916966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105246 MGI:2145317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71164 MGI:1918414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042909 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 152 ESTs, 4 Proteins

name	2900041A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72948 MGI:1920198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 72 ESTs, 2 Proteins pseudo : _no_value

name	Cep72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74470 MGI:1921720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105243 MGI:105064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211446 MGI:2443972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahrr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11624 MGI:1333776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18570 MGI:109283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66945 MGI:1914195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67433 MGI:1914683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI595366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432779 MGI:2145269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238722 MGI:3033356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666670 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC634386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 mRNAs, 3355 ESTs, 21 Proteins

name	LOC100042547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	LOC666683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC547136 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	BC012278 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235956 MGI:2385315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434490 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 4 Proteins pseudo : _no_value

name	Arts1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80898 MGI:1933403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cast (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12380 MGI:1098236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 123 ESTs, 23 Proteins pseudo : _no_value

name	EG544954 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544954 MGI:3644479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 ESTs, 18 Proteins

name	Pcsk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18548 MGI:97511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aytl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350445 GeneID:210992 MGI:2384812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyltransferase like 2 transcript_id : NM_145376.4

name	Slc6a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129796 GeneID:13162 MGI:94862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 transcript_id : NM_010020.3

name	Clptm1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122536 GeneID:218335 MGI:2442892
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLPTM1-like transcript_id : NM_146047.1

name	Tert (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678290 GeneID:21752 MGI:1202709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : telomerase reverse transcriptase transcript_id : NM_009354.1

name	Slc6a18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101943562 GeneID:22598 MGI:1336892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter), member 18 transcript_id : NM_001040692.1

name	Slc6a19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801994 GeneID:74338 MGI:1921588
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter), member 19 transcript_id : NM_028878.2

name	Slc12a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130177 GeneID:20499 MGI:1342283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12, member 7 transcript_id : NM_011390.2

name	Nkd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802218 GeneID:72293 MGI:1919543
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : naked cuticle 2 homolog (Drosophila) transcript_id : NM_028186.3

name	EG666360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264385 GeneID:666360 MGI:3643433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : predicted gene, EG666360 transcript_id : XM_988535.2

name	Trip13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350962 GeneID:69716 MGI:1916966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor interactor 13 transcript_id : NM_027182.2

name	Brd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112817627 GeneID:105246 MGI:2145317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 9 transcript_id : NM_001024508.2

name	Zdhhc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931664 GeneID:71164 MGI:1918414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 11 transcript_id : NM_027704.2

name	LOC100042909 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264387 GeneID:100042909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 152 ESTs, 4 Proteins product : similar to 40S ribosomal protein S29 transcript_id : XM_001479125.1

name	2900041A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469050 GeneID:72948 MGI:1920198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900041A09 gene transcript_id : NM_182839.1

name	Cep72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802391 GeneID:74470 MGI:1921720
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 72 transcript_id : NM_028959.2

name	Slc9a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486699 GeneID:105243 MGI:105064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), member 3 transcript_id : NM_001081060.1

name	Exoc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579824 GeneID:211446 MGI:2443972
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exocyst complex component 3 transcript_id : NM_177333.3

name	Ahrr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130328 GeneID:11624 MGI:1333776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aryl-hydrocarbon receptor repressor transcript_id : NM_009644.2

name	Pdcd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981579 GeneID:18570 MGI:109283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death 6 transcript_id : NM_011051.2

name	Sdha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607097 GeneID:66945 MGI:1914195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate dehydrogenase complex, subunit A, flavoprotein (Fp) transcript_id : NM_023281.1

name	Ccdc127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541788 GeneID:67433 MGI:1914683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 127 transcript_id : NM_024201.2

name	AI595366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383065 GeneID:432779 MGI:2145269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI595366 transcript_id : NM_001033042.2

name	Zfp72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157467 GeneID:238722 MGI:3033356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 72 transcript_id : NM_001081680.1

name	LOC634386 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264342 GeneID:634386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 mRNAs, 3355 ESTs, 21 Proteins product : similar to ferritin light chain 1 transcript_id : XM_001478411.1

name	BC012278 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122798 GeneID:235956 MGI:2385315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC012278 transcript_id : NM_146231.1

name	Arts1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370051 GeneID:80898 MGI:1933403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : type 1 tumor necrosis factor receptor shedding aminopeptidase regulator transcript_id : NM_030711.3

name	Cast (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364225 GeneID:12380 MGI:1098236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpastatin transcript_id : NM_009817.2

name	EG544954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395312 GeneID:544954 MGI:3644479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 ESTs, 17 Proteins product : predicted gene, EG544954, transcript variant 1 transcript_id : XM_619124.3

name	EG544954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264396 GeneID:544954 MGI:3644479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 5 Proteins product : predicted gene, EG544954, transcript variant 2 transcript_id : XM_888940.3

name	Pcsk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129805 GeneID:18548 MGI:97511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proprotein convertase subtilisin/kexin type 1 transcript_id : NM_013628.2

name	Aytl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542186 GeneID:210992 MGI:2384812
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047184 - 1-acylglycerophosphocholine O-acyltransferase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acyltransferase like 2 protein_id : NP_663351.2

name	Slc6a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753606 CCDS:CCDS26632.1 GeneID:13162 MGI:94862
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005329 - dopamine transporter activity [Evidence IMP]; GO:0008504 - monoamine transporter activity [Evidence ISS]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0042416 - dopamine biosynthesis [Evidence IMP]; GO:0042420 - dopamine catabolism [Evidence IMP]; GO:0015872 - dopamine transport [Evidence IMP]; GO:0015844 - monoamine transport [Evidence ISS]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0042053 - regulation of dopamine metabolism [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : dopamine transporter 1 product : solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 protein_id : NP_034150.1

name	Clptm1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122537 GeneID:218335 MGI:2442892
definition	codon_start : 1 product : cisplatin resistance related protein CRR9p protein_id : NP_666159.1

name	Tert (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678291 CCDS:CCDS26633.1 GeneID:21752 MGI:1202709
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003964 - RNA-directed DNA polymerase activity [Evidence IEA]; GO:0003720 - telomerase activity [Evidence IDA]; GO:0003721 - telomeric template RNA reverse transcriptase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006278 - RNA-dependent DNA replication [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IEA] codon_start : 1 note : telomerase catalytic subunit product : telomerase reverse transcriptase protein_id : NP_033380.1

name	Slc6a18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:101943563 GeneID:22598 MGI:1336892
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence TAS] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence TAS] codon_start : 1 note : X transporter protein 2 product : solute carrier family 6 (neurotransmitter transporter), member 18 protein_id : NP_001035782.1

name	Slc6a19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037367 CCDS:CCDS26634.1 GeneID:74338 MGI:1921588
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015175 - neutral amino acid transporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0015804 - neutral amino acid transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 6, member 19 protein_id : NP_083154.1

name	Slc12a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755534 CCDS:CCDS26635.1 GeneID:20499 MGI:1342283
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0015377 - cation:chloride symporter activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 12, member 7 protein_id : NP_035520.1

name	Nkd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980740 CCDS:CCDS26636.1 GeneID:72293 MGI:1919543
definition	codon_start : 1 exception : mismatches in translation note : naked cuticle 1 homolog product : naked cuticle-2 protein_id : NP_082462.2

name	EG666360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264386 GeneID:666360 MGI:3643433
definition	codon_start : 1 product : similar to Ac2-210 protein_id : XP_993629.2

name	Trip13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625724 CCDS:CCDS26637.1 GeneID:69716 MGI:1916966
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : thyroid hormone receptor interactor 13 protein_id : NP_081458.1

name	Brd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112817628 GeneID:105246 MGI:2145317
definition	codon_start : 1 product : bromodomain containing 9 protein_id : NP_001019679.2

name	Zdhhc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625849 GeneID:71164 MGI:1918414
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger, DHHC domain containing 20; DHHC-containing protein 10 product : zinc finger, DHHC domain containing 11 protein_id : NP_081980.1

name	LOC100042909 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264388 GeneID:100042909
definition	codon_start : 1 product : similar to 40S ribosomal protein S29 protein_id : XP_001479175.1

name	2900041A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469051 CCDS:CCDS26638.1 GeneID:72948 MGI:1920198
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : tubulin polymerization promoting protein; brain-specific protein p25 alpha product : tubulin polymerization-promoting protein protein_id : NP_878259.1

name	Cep72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62177169 CCDS:CCDS26639.1 GeneID:74470 MGI:1921720
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : centrosomal protein 72 kDa protein_id : NP_083235.2

name	Slc9a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486700 GeneID:105243 MGI:105064
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0015385 - sodium:hydrogen antiporter activity [Evidence IDA] GO_process : GO:0006885 - regulation of pH [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IDA] codon_start : 1 product : solute carrier family 9 (sodium/hydrogen exchanger), member 3 protein_id : NP_001074529.1

name	Exoc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579825 CCDS:CCDS26640.1 GeneID:211446 MGI:2443972
definition	GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : SEC6-like 1 product : exocyst complex component 3 protein_id : NP_796307.2

name	Ahrr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753016 CCDS:CCDS26641.1 GeneID:11624 MGI:1333776
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence TAS] codon_start : 1 product : aryl-hydrocarbon receptor repressor protein_id : NP_033774.1

name	Pdcd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755000 CCDS:CCDS26642.1 GeneID:18570 MGI:109283
definition	GO_component : GO:0005792 - microsome [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006919 - caspase activation [Evidence IDA] codon_start : 1 product : programmed cell death 6 protein_id : NP_035181.1

name	Sdha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607098 CCDS:CCDS26643.1 GeneID:66945 MGI:1914195
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016627 - oxidoreductase activity, acting on the CH-CH group of donors [Evidence IEA]; GO:0008177 - succinate dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0000104 - succinate dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 product : succinate dehydrogenase Fp subunit protein_id : NP_075770.1

name	Ccdc127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195630 CCDS:CCDS26644.1 GeneID:67433 MGI:1914683
definition	codon_start : 1 product : coiled-coil domain containing 127 protein_id : NP_077163.1

name	AI595366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315896 CCDS:CCDS26645.1 GeneID:432779 MGI:2145269
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC432779 protein_id : NP_001028214.1

name	Zfp72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157468 GeneID:238722 MGI:3033356
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger protein 74 product : zinc finger protein 72 protein_id : NP_001075149.1

name	LOC634386 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264343 GeneID:634386
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478461.1

name	BC012278 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122799 GeneID:235956 MGI:2385315
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC235956 protein_id : NP_666343.1

name	Arts1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507656 CCDS:CCDS26647.1 GeneID:80898 MGI:1933403
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005151 - interleukin-1, Type II receptor binding [Evidence ISS]; GO:0005138 - interleukin-6 receptor binding [Evidence ISS]; GO:0004178 - leucyl aminopeptidase activity [Evidence ISS] [Evidence IDA]; GO:0004179 - membrane alanyl aminopeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004239 - methionyl aminopeptidase activity [Evidence IDA] [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence ISS]; GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence ISS]; GO:0008217 - blood pressure regulation [Evidence ISS]; GO:0045444 - fat cell differentiation [Evidence ISS]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0045766 - positive regulation of angiogenesis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0045088 - regulation of innate immune response [Evidence ISS] codon_start : 1 note : adipocyte-derived leucine aminopeptidase product : type 1 tumor necrosis factor receptor shedding aminopeptidase regulator protein_id : NP_109636.1

name	Cast (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563246 CCDS:CCDS26648.1 GeneID:12380 MGI:1098236
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0030161 - calpain inhibitor activity [Evidence ISS] [Evidence IEA]; GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence ISS] codon_start : 1 note : calpastatin type III product : calpastatin protein_id : NP_033947.1

name	EG544954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63652391 GeneID:544954 MGI:3644479
definition	codon_start : 1 product : similar to heterogeneous nuclear ribonucleoprotein A1, isoform 1 protein_id : XP_619124.1

name	EG544954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82951294 GeneID:544954 MGI:3644479
definition	codon_start : 1 product : similar to heterogeneous nuclear ribonucleoprotein A1, isoform 2 protein_id : XP_894033.1

name	Pcsk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305371 CCDS:CCDS26649.1 GeneID:18548 MGI:97511
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004285 - proprotein convertase 1 activity [Evidence IEA] codon_start : 1 note : prohormone convertase 1/3 product : proprotein convertase subtilisin/kexin type 1 protein_id : NP_038656.1

name	LOC666670 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666670
definition	number : 2 pseudo : _no_value

name	LOC666670 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666670
definition	number : 1 pseudo : _no_value

name	LOC666683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666683
definition	number : 1 pseudo : _no_value

name	LOC666683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666683
definition	number : 2 pseudo : _no_value

name	LOC666683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666683
definition	number : 3 pseudo : _no_value

name	LOC547136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547136
definition	number : 5 pseudo : _no_value

name	LOC547136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547136
definition	number : 4 pseudo : _no_value

name	LOC547136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547136
definition	number : 3 pseudo : _no_value

name	LOC547136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547136
definition	number : 2 pseudo : _no_value

name	LOC547136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547136
definition	number : 1 pseudo : _no_value

name	LOC621824 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264341 GeneID:621824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 72 ESTs, 2 Proteins product : similar to integrin-linked kinase ILK pseudo : _no_value transcript_id : XR_033664.1

name	LOC100042547 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264344 GeneID:100042547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to crooked legs CG14938-PB pseudo : _no_value transcript_id : XR_033686.1

name	LOC434490 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264345 GeneID:434490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 4 Proteins product : similar to stomatin-like protein 2 pseudo : _no_value transcript_id : XR_033696.1

name	LOC622204 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264395 GeneID:622204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 123 ESTs, 23 Proteins product : similar to hCG1793591 pseudo : _no_value transcript_id : XR_034124.1

clone name	MSMg01-542P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-333D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-370K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-156E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-055P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173O18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-250D10.b	B6Ng01-250D10.g
ACC	GA057823	GA057824
length	1,245	1,172
definition	B6Ng01-250D10.b	B6Ng01-250D10.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcatattggagagaaaccgtatgaacgtaaccaatgtggtaaagcc tttgcaagtgacaatcatctccaaatacataaaagaacaaatactggaga gaaaccttatgaatgtaatcaatgtggtaaagccttttcacaagggagta ctctccaatatcatattagaagacataatggagagaaaccctataaatgt aatcagtgtggtaaagcctatggacatcacagtagtctgcaatatcataa aagaacacatactggagagaaaccttatcaatgtaatcaatgtgataaag cattttcacaacacagtagtcttgaatatcataaaataacacatactgga gagaaaccttatgagtgtgatcaatgtggtaaagcctttgcatggcagtc tagtctcaatatacataaaagaacacattctggagaaaaacctcatgagt gtaatcaatgtggtaaagcctttgtacatcacaatagtctccaatgtcat aaaagaacgcatactggagagaaaccttatcagtgtgatcagtgtggtaa agcatttacacatcaaaataatctacagtgtcataaaagaacacatactg gagagaaaccttatgaatgcaatcaatgtggtaaagcatttgcaagacac agtcatctccaagtacatgaaagaacacattttagaaaaacaccttagaa tgcaatcactgttgtaaagactttggatgtaagactaatctccaaagaca taaaagaacatatactggacagaaaccttatgaatgtaatcaatgtggta aagcctttgcaactcacagtcatctacaatgacataaaagaacacagagg agagaaacctggttattgtttacatatggacataaaggagatacaagtat gtatcaaattgacaagggatggattgtgattgctgctcttggttttcaat ataagatctaaagtgggaaagcataggtccaggcatggtggtacatgccc ttgaaccctagagatgagcatcaagcagatctctgagttcaagtccatcc tgaaacagaagcaagttaaagtgaagaaattcttaagtcttaggcctggt ggaatacagagcctggcagaatttcttgagttcaagttcaaatatattaa agcagttcaggacacgccaagcttgagagtaggaatggaaaccgaaactg ggtgataatgttaatagaagagaggcccacttttctccacgggac	gaattctttgatgctgggtaaggcttgaagaccagttaaaagctttgcca cattctgggcatttatagggtttctcaccagtgtgaattctctgatgctt atacaggtgagaagaacagttaaaagcctgaccacactgttcacatttgt agggtttctctccagtgtgaattctttgatgtggggtaaggcttgaagaa cagctaaaagctttgccacattgttcacatttgtagggtttctctcctgt atgaactctctgatgttgaataaggagtgacttccgaacaaaggtcttgt tacattctttatatttatagggttttgttcctgttgaataaatggtaagg tattaataaaaattataatctttatatttgtaataattatcattaacata gatatttttattccattacatttcatataaaaatttaccctcacatcaac cagaaaatacaaacatatttctacagcccaaatcactatggcattattca gaaagtaacacaggcagaaataacctaaacttccattgcactgaaacggt gaagacaatatggaatatacaaataatattcaaccagtaagaggtaatca tatattatctgccatgaggataattcttaaaggataaatgaaataaaaca caaagatatattatatgacttgaattacttgaagattctatagtaataaa acttgtggggctggagggatgtctcagtggttaagagtactgactgctct tccagaggtcctgagttcaattcccagcaaccacacggtggctcacaacc atctctaatgggatctgatgtctcttctggtgtgtctgaagacagctaca gtgtacttatcatatacataaaataaaatcattttaaacaaacttgtaaa acttacagtagaatggtaaatggaatagtttacatggagaacaaaagtat acaatttctttcataaatatagttagtttcaaagaaaaattatttttcta aaaatatagtgtatagatttgaatataattactgaataggtgtactcaaa atactgatatacctttaaattaatttttatacaattaaaatagtttaatt tatcaaatttattgtaataatttatctgtagattcacagaaggtttccag tagccaatgtatccataatatt
quality values	Open. Hide. 52 28 33 38 62 31 20 62 52 62 62 62 62 62 62 62 62 54 62 51 47 54 62 62 62 59 62 62 62 59 43 50 34 28 38 46 24 33 43 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 54 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 49 54 54 59 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 36 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 58 58 58 58 58 58 46 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 54 58 58 48 39 58 58 58 58 58 58 58 58 58 58 52 54 58 51 58 52 58 58 58 53 58 58 51 49 58 58 51 51 51 47 58 58 58 53 50 51 49 58 34 50 53 51 50 58 58 50 58 58 51 41 51 39 53 51 51 52 52 50 58 58 58 58 58 50 58 37 48 52 53 50 46 58 58 53 53 36 58 58 58 58 50 50 50 48 58 58 47 50 28 58 43 37 51 39 36 41 50 53 42 47 50 58 53 53 53 40 53 58 58 39 49 40 40 58 51 51 50 33 32 53 50 41 49 37 46 16 50 32 51 51 51 52 53 26 17 54 33 32 53 42 39 53 26 54 54 49 23 54 19 31 30 44 45 53 42 53 52 51 35 41 32 37 32 49 54 39 34 39 42 42 45 37 40 41 31 33 54 33 26 51 45 40 34 33 42 53 40 53 54 34 38 54 53 40 42 53 29 54 33 37 44 24 32 37 39 32 37 32 32 30 29 45 29 41 39 37 27 40 19 47 32 53 35 41 29 53 52 52 53 43 35 51 33 32 28 32 28 35 34 19 37 34 18 46 20 34 51 32 31 29 30 29 29 16 29 27 23 33 33 22 46 32 26 34 21 43 26 37 30 42 27 25 23 29 6 46 12 31 29 30 31 30 28 29 33 31 31 31 31 21 31 43 34 30 36 32 28 46 22 22 31 31 31 33 25 11 26 46 27 19 25 26 33 22 27 18 42 24 37 12 10 27 31 30 31 31 31 36 34 25 25 29 31 27 47 47 24 26 26 25 29 25 35 30 25 10 31 24 27 34 37 48 26 23 11 13 46 11 34 48 34 33 27 16 18 20 25 20 21 27 16 18 23 21 18 27 30 31 31 6 31 33 20 22 28 21 31 28 27 38 27 8 19 26 16 14 18 44 32 32 9 9 5 5 20 22 15 32 12 30 27 34 17 8 18 31 25 30 10 32 28 10 16 14 9 10 24 10 25 21 27 16 23 25 32 19 24 27 32 17 19 10 17 22 7 6 11 13 5 5 17 7 15 17 21 28 21 18 9 30 7 4 3 5 15 7 17 24 33 21 8 16 23 12 27 8 6 23 4 6 5 5 5 8 11 13 8 7 11 6 12 8 8 3 4 7 7 10 5 5 10 5 12 6 7 6 9 16 7 6 21 13 21 32 19 10 11 20 13 23 5 9 15 5 9 6 17 5 9 16 11 21 8 17 5 5 11 7 12 4 3 5 4 3 3 3 2 5 5 3 3 4 6 6 5 4 14 12 15 3 11 4 3 5 10 6 9 6 16 7 9 3 2 3 4 3 2 1 10 5 3 2 6 4 5 20 28 22 14 4 8 17 20 10 7 2 4 13 7 4 7 4 3 7 6 4 4 6 3 2 3 6 4 7 7 25 7 22 6 7 4 7 21 29 11 4 3 6 12 7 4 3 4 6 4 11	Open. Hide. 62 47 56 47 62 62 62 62 62 45 43 27 24 28 28 32 32 32 34 45 54 62 59 59 62 62 62 59 62 62 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 59 59 59 46 36 56 62 59 62 62 59 54 54 62 62 62 62 62 62 62 62 62 59 59 62 54 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 54 48 58 58 58 58 58 58 58 58 58 58 54 58 58 48 58 58 58 54 58 58 58 58 58 58 46 58 58 58 49 58 58 58 58 58 58 54 58 52 58 54 54 58 49 58 54 54 58 58 58 52 58 58 58 58 51 45 41 58 58 51 38 58 45 32 51 51 49 58 51 58 54 54 58 50 58 58 51 46 53 58 51 58 58 58 58 50 53 53 58 58 58 54 54 58 48 58 58 43 41 42 50 54 53 58 53 53 52 51 51 58 58 50 58 58 58 51 48 35 49 52 53 53 58 54 58 58 39 33 25 52 53 39 49 52 53 50 39 52 53 49 41 58 58 40 52 52 58 58 50 58 58 58 54 39 52 37 51 52 34 58 43 39 26 54 45 53 49 45 39 26 25 51 42 41 39 32 51 34 54 20 35 32 39 52 52 49 42 42 54 32 49 42 49 37 42 49 29 34 53 15 51 33 33 52 40 53 44 27 54 37 37 30 37 45 46 30 49 45 32 32 53 40 34 37 47 33 52 30 47 37 51 21 37 46 31 34 32 31 34 30 28 20 27 24 53 32 32 52 31 28 31 22 41 49 47 30 31 34 32 45 32 28 52 33 32 32 32 32 29 32 27 31 32 33 45 38 43 31 33 34 31 31 33 32 26 19 31 31 31 32 22 31 17 30 33 38 20 31 39 30 31 31 37 35 35 38 31 32 30 31 19 33 31 48 48 31 31 29 46 48 31 31 34 31 31 48 48 43 32 47 23 18 33 46 18 28 22 43 31 28 46 46 46 30 24 32 30 31 33 32 32 31 36 20 32 29 21 32 44 17 31 47 27 24 31 27 33 33 30 31 23 33 46 26 32 33 18 31 25 25 31 11 16 6 8 25 44 44 25 25 22 19 31 24 31 20 23 34 48 37 31 23 48 33 25 16 22 21 48 16 11 15 23 13 27 37 33 27 21 31 44 21 30 22 40 28 14 28 48 48 48 25 19 27 32 14 48 48 48 13 15 21 31 48 39 40 13 13 15 20 27 28 22 32 11 17 18 30 9 7 4 29 20 32 32 19 8 8 26 11 17 6 7 16 28 20 25 16 22 24 8 3 3 3 8 8 16 13 14 10 4 40 47 30 10 12 8 3 5 3 3 3 3 9 18 18 12 34 15 7 5 3 4 16 11 20 10 34 34 38 28 8 9 3 3 5 13 11 15 21 33 34 7 6 13 7 17 26 9 22 21 9 28 13 20 18 11 7 26 16 14 28 11 11 24 9 11 22 15 7 8 20 13 5 3 4 6 12 18 16 6 3 6 4 23 6 9 20 10 16 16 10 9 24 5 5 16 12 18 6 10 5 4 6 3 3 3 5 11 9 4 6 5 4 19 4 12 5 15 21 4 3 4 4 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_74509946_74511121
seq2: B6Ng01-250D10.g_70_1241

seq1  GAATTCTTTGATGCTGGGTAAGGCTTGAAGACCAGTTAAAAGCTTTGCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGATGCTGGGTAAGGCTTGAAGACCAGTTAAAAGCTTTGCCA  50

seq1  CATTCTGGGCATTTATAGGGTTTCTCACCAGTGTGAATTCTCTGATGCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTGGGCATTTATAGGGTTTCTCACCAGTGTGAATTCTCTGATGCTT  100

seq1  ATACAGGTGAGAAGAACAGTTAAAAGCCTGACCACACTGTTCACATTTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACAGGTGAGAAGAACAGTTAAAAGCCTGACCACACTGTTCACATTTGT  150

seq1  AGGGTTTCTCTCCAGTGTGAATTCTTTGATGTGGGGTAAGGCTTGAAGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTTTCTCTCCAGTGTGAATTCTTTGATGTGGGGTAAGGCTTGAAGAA  200

seq1  CAGCTAAAAGCTTTGCCACATTGTTCACATTTGTAGGGTTTCTCTCCTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTAAAAGCTTTGCCACATTGTTCACATTTGTAGGGTTTCTCTCCTGT  250

seq1  ATGAACTCTCTGATGTTGAATAAGGAGTGACTTCCGAACAAAGGTCTTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAACTCTCTGATGTTGAATAAGGAGTGACTTCCGAACAAAGGTCTTGT  300

seq1  TACATTCTTTATATTTATAGGGTTTTGTTCCTGTTGAATAAATGGTAAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATTCTTTATATTTATAGGGTTTTGTTCCTGTTGAATAAATGGTAAGG  350

seq1  TATTAATAAAAATTATAATCTTTATATTTGTAATAATTATCATTAACATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTAATAAAAATTATAATCTTTATATTTGTAATAATTATCATTAACATA  400

seq1  GATATTTTTATTCCATTACATTTCATATAAAAATTTACCCTCACATCAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATTTTTATTCCATTACATTTCATATAAAAATTTACCCTCACATCAAC  450

seq1  CAGAAAATACAAACATATTTCTACAGCCCAAATCACTATGGCATTATTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAAATACAAACATATTTCTACAGCCCAAATCACTATGGCATTATTCA  500

seq1  GAAAGTAACACAGGCAGAAATAACCTAAACTTCCATTGCACTGAAACGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGTAACACAGGCAGAAATAACCTAAACTTCCATTGCACTGAAACGGT  550

seq1  GAAGACAATATGGAATATACAAATAATATTCAACCAGTAAGAGGTAATCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGACAATATGGAATATACAAATAATATTCAACCAGTAAGAGGTAATCA  600

seq1  TATATTATCTGCCATGAGGATAATTCTTAAAGGATAAATGAAATAAAACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATTATCTGCCATGAGGATAATTCTTAAAGGATAAATGAAATAAAACA  650

seq1  CAAAGATATATTATATGACTTGAATTACTTGAAGATTCTATAGTAATAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGATATATTATATGACTTGAATTACTTGAAGATTCTATAGTAATAAA  700

seq1  ACTTGTGGGGCTGGAGGGATGTCTCAGTGGTTAAGAGTACTGACTGCTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGTGGGGCTGGAGGGATGTCTCAGTGGTTAAGAGTACTGACTGCTCT  750

seq1  TCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACACGGTGGCTCACAACC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACACGGTGGCTCACAACC  800

seq1  ATCTCTAATGGGATCTGATGTCTCTTCTGGTGTGTCTGAAGACAGCTACA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTAATGGGATCTGATGTCTCTTCTGGTGTGTCTGAAGACAGCTACA  850

seq1  GTGTACTTATCATATACATAAAATAAAATCATTTTAAACAAACTTGTAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTACTTATCATATACATAAAATAAAATCATTTTAAACAAACTTGTAAA  900

seq1  ACTTACAGTAGAATGGTAAATGGAATAGTTTACATGGAG-ACAAAAGTAT  949
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ACTTACAGTAGAATGGTAAATGGAATAGTTTACATGGAGAACAAAAGTAT  950

seq1  ACAATTTCTTTCATAAATATAGTTAGTTTCAAAAGAAAAATTA-TTTTCT  998
      |||||||||||||||||||||||||||||| |||||||||||| ||||||
seq2  ACAATTTCTTTCATAAATATAGTTAGTTTC-AAAGAAAAATTATTTTTCT  999

seq1  AAAAATATAGTGTATAAGAATTTGAATATAATTACTGAATA-GTGTACTC  1047
      ||||||||||||||||   |||||||||||||||||||||| ||||||||
seq2  AAAAATATAGTGTATA--GATTTGAATATAATTACTGAATAGGTGTACTC  1047

seq1  AAAATACTTAATATACCTTTATA-TAATTTTTATACAATTAAAATAAGTT  1096
      ||||||| | ||||||||||| | ||||||||||||||||||||| ||||
seq2  AAAATAC-TGATATACCTTTAAATTAATTTTTATACAATTAAAAT-AGTT  1095

seq1  TAAATTTATCAAATTTATTGTTAATAAATTTATCTGTAGA-TCACAGAAG  1145
      | |||||||||||||||||| |||| |||||||||||||| |||||||||
seq2  T-AATTTATCAAATTTATTG-TAAT-AATTTATCTGTAGATTCACAGAAG  1142

seq1  --TTTCAGTAAAGGCAATGTATTCATAAATATT  1176
        || ||||  || |||||||| ||| ||||||
seq2  GTTTCCAGT--AGCCAATGTATCCAT-AATATT  1172

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information