MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-276C15
Chromosome	13 (Build37)
Map Location	27,162,564 - 27,163,666
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC666221, LOC100042180, LOC100042191, Hdgfl1, LOC100040939, LOC100040945, LOC100040957, Prl
Downstream gene	Prl3d1, Prl3d2, Prl3d3, Prl3c1, Prl3b1, Prl3a1, Prl6a1, Prl8a2, Prl2b1, Prl8a6, Prl8a8, Prl8a9, Prl8a1, Prl7b1, Prl7a1, Prl7a2, RP23-135A24.2-001, Prl7d1, Prl7c1, Prl2a1, OTTMUSG00000000651, LOC666321, LOC195243, LOC100041036, Prl4a1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1315 ESTs, 7 Proteins

name	LOC100042191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein pseudo : _no_value

name	Hdgfl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15192 MGI:1194493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Prl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19109 MGI:97762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18775 MGI:97606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215028 MGI:2660935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3d3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215029 MGI:2660938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27372 MGI:1351649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18776 MGI:97607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67000 MGI:1914250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19111 MGI:1206579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13529 MGI:894281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66392 MGI:1861444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19112 MGI:1332225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74188 MGI:1921438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67310 MGI:1914560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73244 MGI:1920494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75596 MGI:1922846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19113 MGI:1206572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19114 MGI:1206571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	RP23-135A24.2-001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:494218
definition	note : prolactin pseudogene pseudo : _no_value

name	Prl7d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18814 MGI:97619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67505 MGI:1914755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56635 MGI:1861446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666317 MGI:3649927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC195243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins pseudo : _no_value

name	LOC100041036 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Prl4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19110 MGI:1206587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042180 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263953 GeneID:100042180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1315 ESTs, 7 Proteins product : similar to ribosomal protein S8 transcript_id : XM_001477642.1

name	Hdgfl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345595 GeneID:15192 MGI:1194493
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatoma derived growth factor-like 1 transcript_id : NM_008232.2

name	Prl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755163 GeneID:19109 MGI:97762
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin transcript_id : NM_011164.1

name	Prl3d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627657 GeneID:18775 MGI:97606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily d, member 1 transcript_id : NM_008864.2

name	Prl3d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26024346 GeneID:215028 MGI:2660935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily d, member 1 transcript_id : NM_172155.1

name	Prl3d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130084 GeneID:215029 MGI:2660938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily d, member 3 transcript_id : NM_172156.2

name	Prl3c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305406 GeneID:27372 MGI:1351649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily c, member 1 transcript_id : NM_013766.1

name	Prl3b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350123 GeneID:18776 MGI:97607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily b, member 1 transcript_id : NM_008865.3

name	Prl3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373533 GeneID:67000 MGI:1914250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily a, member 1 transcript_id : NM_025896.2

name	Prl6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755167 GeneID:19111 MGI:1206579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 6, subfamily a, member 1 transcript_id : NM_011166.1

name	Prl8a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753689 GeneID:13529 MGI:894281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 2 transcript_id : NM_010088.1

name	Prl2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382490 GeneID:66392 MGI:1861444
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 2, subfamily b, member 1 transcript_id : NM_025532.2

name	Prl8a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892523 GeneID:19112 MGI:1332225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 6 transcript_id : NM_011167.2

name	Prl8a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377286 GeneID:74188 MGI:1921438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 81 transcript_id : NM_023741.2

name	Prl8a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802878 GeneID:67310 MGI:1914560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family8, subfamily a, member 9 transcript_id : NM_023332.3

name	Prl8a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343582 GeneID:73244 MGI:1920494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 1 transcript_id : NM_028477.2

name	Prl7b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370056 GeneID:75596 MGI:1922846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily b, member 1 transcript_id : NM_029355.2

name	Prl7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679470 GeneID:19113 MGI:1206572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily a, member 1 transcript_id : NM_008930.1

name	Prl7a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801384 GeneID:19114 MGI:1206571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily a, member 2 transcript_id : NM_011168.3

name	Prl7d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755101 GeneID:18814 MGI:97619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily d, member 1 transcript_id : NM_011120.1

name	Prl7c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801710 GeneID:67505 MGI:1914755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily c, member 1 transcript_id : NM_026206.2

name	Prl2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910513 GeneID:56635 MGI:1861446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 2, subfamily a, member 1 transcript_id : NM_019991.1

name	OTTMUSG00000000651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865900 GeneID:666317 MGI:3649927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000651 transcript_id : NM_001045532.1

name	LOC100041036 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263925 GeneID:100041036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to dynein, axonemal, heavy chain 9 transcript_id : XM_001475685.1

name	Prl4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364521 GeneID:19110 MGI:1206587
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 4, subfamily a, member 1 transcript_id : NM_011165.2

name	LOC100042180 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263954 GeneID:100042180
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477692.1

name	Hdgfl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680199 CCDS:CCDS26388.1 GeneID:15192 MGI:1194493
definition	codon_start : 1 exception : mismatches in translation note : hepatoma-derived growth factor, related protein 1; PWWP domain containing 1 product : hepatoma derived growth factor-like 1 protein_id : NP_032258.1

name	Prl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755164 CCDS:CCDS26389.1 GeneID:19109 MGI:97762
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0007595 - lactation [Evidence IEA]; GO:0046425 - regulation of JAK-STAT cascade [Evidence IDA]; GO:0007262 - STAT protein nuclear translocation [Evidence IDA] codon_start : 1 exception : mismatches in translation product : prolactin protein_id : NP_035294.1

name	Prl3d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109627658 GeneID:18775 MGI:97606
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : placental lactogen-I alpha; prolactin-like 2 product : chorionic somatomammotropin hormone 1 protein_id : NP_032890.2

name	Prl3d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024347 GeneID:215028 MGI:2660935
definition	GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : PL-1 beta; placental lactogen-I beta product : prolactin family 3, subfamily d, member 1 protein_id : NP_742167.1

name	Prl3d3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024349 CCDS:CCDS26391.1 GeneID:215029 MGI:2660938
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : PL-1 gamma; placental lactogen I gamma product : prolactin family 3, subfamily d, member 3 protein_id : NP_742168.1

name	Prl3c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305407 CCDS:CCDS26392.1 GeneID:27372 MGI:1351649
definition	codon_start : 1 note : PLP I; prolactin-like protein J product : prolactin-like protein I protein_id : NP_038794.1

name	Prl3b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679363 CCDS:CCDS26393.1 GeneID:18776 MGI:97607
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : placental lactogen 2; prolactin-like; chorionic somatomammotropin hormone 2 product : prolactin family 3, subfamily b, member 1 protein_id : NP_032891.1

name	Prl3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385390 CCDS:CCDS26394.1 GeneID:67000 MGI:1914250
definition	codon_start : 1 note : prolactin like protein I; prolactin-like protein I product : prolactin family 3, subfamily a, member 1 protein_id : NP_080172.1

name	Prl6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755168 CCDS:CCDS26395.1 GeneID:19111 MGI:1206579
definition	codon_start : 1 function : secreted glycoprotein hormone note : prolactin-like protein B product : prolactin family 6, subfamily a, member 1 protein_id : NP_035296.1

name	Prl8a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753690 CCDS:CCDS26396.1 GeneID:13529 MGI:894281
definition	codon_start : 1 function : secreted glycoprotein hormone note : decidual/trophoblast prolactin-related protein product : prolactin family 8, subfamily a, member 2 protein_id : NP_034218.1

name	Prl2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313486 CCDS:CCDS26397.1 GeneID:66392 MGI:1861444
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : prolactin like protein k product : placental prolactin-like protein K protein_id : NP_079808.1

name	Prl8a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755170 CCDS:CCDS26398.1 GeneID:19112 MGI:1332225
definition	GO_function : GO:0005102 - receptor binding [Evidence ISS] codon_start : 1 note : prolactin-like protein C; prolactin-like protein C 1 product : prolactin family 8, subfamily a, member 6 protein_id : NP_035297.1

name	Prl8a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699034 CCDS:CCDS26399.1 GeneID:74188 MGI:1921438
definition	codon_start : 1 note : PLP-C gamma2; prolactin-like protein C 3 product : prolactin family 8, subfamily a, member 81 protein_id : NP_076230.1

name	Prl8a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526757 CCDS:CCDS26400.1 GeneID:67310 MGI:1914560
definition	codon_start : 1 note : prolactin-like protein C 2 product : prolactin-like protein C beta precursor protein_id : NP_075821.1

name	Prl8a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312124 CCDS:CCDS26401.1 GeneID:73244 MGI:1920494
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : prolactin like protein C delta; prolactin-like protein C 4 product : placental prolactin-like protein C delta protein_id : NP_082753.1

name	Prl7b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037423 CCDS:CCDS26402.1 GeneID:75596 MGI:1922846
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : prolactin-like protein N product : placental prolactin-like protein N protein_id : NP_083631.1

name	Prl7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679471 CCDS:CCDS26403.1 GeneID:19113 MGI:1206572
definition	codon_start : 1 function : secreted glycoprotein hormone note : prolactin-like protein G; prolactin-like protein E product : prolactin family 7, subfamily a, member 1 protein_id : NP_032956.1

name	Prl7a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755172 CCDS:CCDS26404.1 GeneID:19114 MGI:1206571
definition	codon_start : 1 note : prolactin-like protein F product : prolactin family 7, subfamily a, member 2 protein_id : NP_035298.1

name	Prl7d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755102 CCDS:CCDS26405.1 GeneID:18814 MGI:97619
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : proliferin related protein product : prolactin family 7, subfamily d, member 1 protein_id : NP_035250.1

name	Prl7c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385714 CCDS:CCDS26406.1 GeneID:67505 MGI:1914755
definition	codon_start : 1 note : prolactin like protein O; prolactin-like protein O product : placental prolactin-like protein O protein_id : NP_080482.1

name	Prl2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910514 CCDS:CCDS26407.1 GeneID:56635 MGI:1861446
definition	codon_start : 1 note : prolactin-like protein M product : prolactin family 2, subfamily a, member 1 protein_id : NP_064375.1

name	OTTMUSG00000000651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865901 GeneID:666317 MGI:3649927
definition	codon_start : 1 note : mitogen regulated protein, proliferin 4-like product : hypothetical protein LOC666317 protein_id : NP_001038997.1

name	LOC100041036 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263926 GeneID:100041036
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475735.1

name	Prl4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755166 CCDS:CCDS26409.1 GeneID:19110 MGI:1206587
definition	GO_function : GO:0005148 - prolactin receptor binding [Evidence ISS] GO_process : GO:0001666 - response to hypoxia [Evidence IMP] codon_start : 1 function : secreted glycoprotein hormone product : prolactin-like protein A protein_id : NP_035295.1

name	LOC666221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666221
definition	number : 1 pseudo : _no_value

name	LOC666221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666221
definition	number : 2 pseudo : _no_value

name	LOC100040939 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040939
definition	number : 4 pseudo : _no_value

name	LOC100040939 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040939
definition	number : 3 pseudo : _no_value

name	LOC100040939 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040939
definition	number : 2 pseudo : _no_value

name	LOC100040939 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040939
definition	number : 1 pseudo : _no_value

name	LOC100040945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040945
definition	number : 3 pseudo : _no_value

name	LOC100040945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040945
definition	number : 2 pseudo : _no_value

name	LOC100040945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040945
definition	number : 1 pseudo : _no_value

name	LOC100040957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040957
definition	number : 2 pseudo : _no_value

name	LOC100040957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040957
definition	number : 1 pseudo : _no_value

name	LOC666321 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666321
definition	number : 1 pseudo : _no_value

name	LOC195243 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:195243
definition	number : 1 pseudo : _no_value

name	LOC100042191 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263955 GeneID:100042191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : hypothetical protein LOC100042191 pseudo : _no_value transcript_id : XR_033339.1

clone name	MSMg01-315O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-178B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350P11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-265N06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458O18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-211C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-456B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-276C15.b	B6Ng01-276C15.g
ACC	GA077012	GA077013
length	1,107	1,196
definition	B6Ng01-276C15.b	B6Ng01-276C15.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagtatatgtcctcaggatttgattcacataacatagatgccaat cctttaacacagtcaggtgtaagtggtcaaaataatttccacactaatga gtcaaactagtctcccatatattcacttgggacttatatgttatggcaga atatgaaaaccatcatattctgatagaaatacctttcaaaattgcatttt tctacatttgcatgactccagtaggacaaaaatgtgcaggagaagaacaa tggagagaattcctattaaacacaacataagtgaacattgcaatgaaatt ttgacctgcccaggtatgttcgataacagaatcatacataaagagattgc taattaaatatatttggcatgctatctctgaactaatttacgggttatga aaatgaagactatagaagaatctaattaccctatcaaaaatggataataa ggagtgagaaaaataagaccaggcaaataacaatgggaaaaggggttctc aagagaattaggcaaaaatgattaaaatggattacctgagataaacaaat ttggaccacattcttctttgccatgtagacaacacacatagttccacata cccttatgaaaccgaagttcataatctttctgtaactctttatgtgggag aattttttagaagtaaacatcagtgccatcacataatttttgaagggtct aaaaatgtatctctgtgatgttttcttttccttgttttcttcattcattc ccttcattgtcattatattttattaatgagactatcttttgtacaagtca tttttattagtaataaaggattaatgaaaaatagattatatatgtgaaat atgaacacatataacttttacagtaaattaaactctacttaacaaagaat gccaaggaaattagaaccctatacactagagctatggacacacacagacc taatcaaacacagagatcatcctgagaaacaagatacagtacgtggagga gcctcttatacatctgatttccccttatgatgtagaaaaggcagaccatt tgggggaaggctgccccacattaatggaagaaacctaatccaaaatttaa attaata	gaattctcacctgaggaatactgaatgagaggcacctgaaaaaaattcag catcattaatcatcagagaaatgcaaatccaaacaaccctgagattccac ctcacaccagtctgaatggctaagatcaaaaattcaggtgacagcagatg ctggcaaggatgtggggaaagaggaacactcctccattgttggtgggatt gcaagcttgtacaaccactctggaaatcagtctggcagttcctcagaaaa ttgagatcccgcaatacctctcctgggtatatatccagaagatgttgcaa ctggtaagaaggacacaaactccactattttcatagcagccttatttata gtagtcagaagctggaaagaacccagatgcccctcaacagaggaatggat acagaaaacgtggtacatttacacaatggagtactactcagctattaaaa agaatgaatttatgaaattcctaggcaaatggatggacctggagggcatc atcctgagtgaggtaacccaatcacaaaggaactcacacaatatgtactc actgataagtggatattagcccagaaacttaggatacccaaaatataaga tacaatttgctaaaagcatgaaactcaagaagaacgaagaccaaagtgtg gacactttgccccttcctagaaatgggaacaaaacacccatggaaggagt tacagcgacaaagtttggagctgagatgaaaggatggaccatctagatac tgccatatctggggatccatcccataatcagcctccaaacactgacgcca ttgcatacactagcaaaattttgctgaaaggaccctgatatagctgtctc ttgtgaggctattcttgggcctagcaaacacagaagtggatgctcacagt cagctattggatgcaacacagggcccccaatggagcagctagagaaagta cccaaggagttaaagggatctgcaccctataggtggaacacatatgaaac taactagtaccctccgggagctcgtgtctctagctgcatggtgtatcaga agaatgggctcagtcgcccattatgggaagagagggcccattgctcttgg ctaactttatattgcctagtaccaggggattgccagcttagagtaggaag cagtgcgcaatatctcacgaatgtaggcgagtatgcgatgtgtagc
quality values	Open. Hide. 58 31 17 25 58 34 30 62 62 42 43 50 47 49 62 62 62 62 47 31 62 62 26 26 62 62 62 47 44 62 44 34 32 24 27 25 24 21 23 36 34 28 29 28 38 56 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 51 56 46 32 32 48 59 59 59 62 54 54 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 42 45 62 62 62 62 62 62 62 62 62 62 62 58 54 41 58 54 58 58 58 58 58 58 45 45 58 58 58 58 58 58 58 42 48 49 54 58 58 58 58 58 58 58 58 58 58 58 58 38 58 54 54 58 58 58 58 58 58 58 54 58 58 58 58 45 54 58 58 54 58 52 54 54 30 58 58 54 58 58 58 54 58 58 58 58 58 58 51 50 58 53 58 51 49 58 49 58 58 54 51 58 58 58 58 48 58 51 58 58 40 58 54 51 52 53 41 49 51 58 52 58 50 51 58 58 50 51 58 50 58 52 58 58 49 53 50 58 51 58 58 43 58 27 58 40 39 58 58 58 58 41 53 46 58 58 40 50 51 58 58 51 50 51 51 53 53 51 51 50 54 27 51 50 50 53 52 51 50 50 50 58 49 58 58 40 28 24 38 58 58 27 53 53 42 49 36 58 51 41 58 32 49 54 58 53 53 52 58 51 51 53 49 54 37 54 54 50 49 41 54 54 40 42 54 49 44 54 27 33 36 40 52 37 52 45 37 54 53 45 28 53 40 44 36 49 44 52 42 32 39 38 54 35 39 37 45 42 45 43 52 38 54 54 37 51 34 40 46 32 44 52 53 42 33 31 39 42 45 52 37 54 54 54 54 33 37 40 23 49 34 33 32 40 45 53 49 49 46 32 32 31 24 10 23 28 52 45 32 49 38 33 47 33 30 42 28 33 35 53 40 49 49 51 32 35 45 31 31 31 42 31 31 32 31 31 29 37 32 45 45 47 43 33 30 29 30 51 31 32 29 42 28 45 32 45 32 31 30 30 46 46 30 32 36 23 31 27 42 48 35 32 30 41 46 44 31 43 43 36 34 43 34 31 27 25 35 32 48 38 31 33 32 34 43 29 31 29 31 31 35 31 48 31 32 31 30 26 32 26 29 41 29 37 31 31 29 31 24 31 27 30 20 31 11 26 31 29 38 38 37 21 26 19 31 13 31 26 31 23 27 27 26 31 34 25 31 31 34 32 41 26 22 14 21 31 22 29 24 26 35 35 33 26 25 30 31 31 37 20 21 44 26 10 6 17 31 28 23 23 20 19 24 22 32 34 25 15 13 26 10 16 8 32 10 23 21 14 10 11 28 9 9 13 29 23 34 21 14 22 33 12 47 34 7 25 31 8 22 14 21 23 17 20 9 22 15 17 5 18 34 34 15 12 20 16 14 10 30 11 10 19 14 40 21 9 27 28 28 17 6 10 6 8 10 7 11 9 13 18 14 10 12 6 13 13 8 13 6 12 7 38 19 11 28 31 18 7 16 6 18 8 3 3 4 12 28 40 11 18 47 11 24 27 12 2 4 11 14 4 5	Open. Hide. 62 47 42 42 62 62 62 47 42 62 51 51 44 15 19 38 29 28 43 51 59 49 62 59 62 62 62 62 62 59 62 59 62 59 59 62 62 59 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 59 54 54 54 56 62 59 62 62 54 54 54 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 54 54 62 59 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 39 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 54 62 62 62 62 62 54 62 62 44 62 62 62 62 62 49 54 62 62 52 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 58 58 54 45 58 58 58 58 54 58 58 58 58 58 48 58 58 54 58 58 58 58 58 45 54 58 58 54 42 58 58 58 58 54 45 58 58 54 54 58 58 54 58 58 58 58 58 58 54 58 58 54 30 58 52 58 54 54 58 54 47 58 58 58 52 58 52 58 54 45 58 58 58 52 54 58 50 54 52 58 42 58 58 58 58 58 54 58 54 58 58 52 58 58 58 45 52 58 58 51 54 58 58 51 42 53 41 58 58 52 58 58 58 53 53 58 58 49 50 49 58 48 35 58 46 40 46 38 58 49 48 58 58 49 52 53 53 53 58 48 58 34 52 49 43 58 48 58 58 58 49 39 31 58 58 58 46 52 46 58 51 39 58 58 52 51 46 50 53 46 58 58 36 58 43 42 52 54 58 35 41 23 44 40 58 54 52 53 53 42 58 51 39 32 35 49 49 58 47 43 44 43 43 42 50 44 30 50 41 52 52 53 58 35 35 58 38 44 50 50 41 19 54 54 47 49 40 46 33 27 26 41 49 54 54 35 14 46 52 29 50 49 26 49 32 38 51 37 33 49 14 54 44 22 50 54 51 54 40 47 18 52 52 37 46 21 34 31 39 40 54 37 32 47 37 34 54 47 36 27 42 37 53 37 41 52 33 37 33 33 35 38 45 26 29 24 52 45 45 38 31 41 52 53 45 25 31 32 47 21 40 31 47 40 29 52 36 42 45 40 32 29 40 41 53 37 43 41 53 37 34 31 40 32 41 32 31 29 45 33 30 33 41 32 32 30 41 31 36 31 31 31 31 20 31 31 46 51 31 31 51 51 31 30 31 31 31 35 51 32 30 41 31 11 37 32 31 32 27 25 25 38 32 30 31 42 42 30 30 33 42 37 31 42 31 34 41 21 26 19 43 32 30 18 31 28 32 32 46 31 31 31 30 24 17 32 26 48 38 32 29 30 16 31 33 31 30 46 37 26 27 24 31 31 37 32 16 32 31 36 34 31 24 36 31 32 27 19 18 31 29 28 21 33 27 14 17 31 19 19 11 25 44 21 35 41 28 36 25 8 17 19 26 25 14 19 32 31 17 32 32 23 18 20 13 23 48 34 12 19 24 32 37 22 11 20 25 19 25 16 15 18 19 43 13 17 48 19 9 18 18 27 32 8 11 10 43 20 12 10 15 10 27 7 11 9 21 18 10 7 18 5 5 3 15 28 27 16 33 9 27 27 21 13 28 20 13 18 28 13 21 34 20 26 20 28 16 27 6 7 4 6 12 8 5 4 6 9 12 8 11 25 10 7 28 26 24 26 8 5 4 7 12 6 8 7 17 11 10 7 24 25 5 16 23 7 13 27 8 19 4 5 19 5 8 6 3 2 6 9 4 7 7 4 2 5 11 11 16 23 5 6 4 11 8 10 11 5 7 12 5 7 7 8 12 15 13 18 8 5 9 13 4 10 14 8 12 28 18 7 7 5 7 16 4 8 5 6 20 4 7 9 8 4 5 14 28 7 1 3 5 5 6 3 9 1 3 2 1 4 2 2 3 2 2 3 6 7 4 6 3 1 1 3 1 5 3 5 1 2 4 4 4 4 5 5 1 2 3 3 3 5 7 8 1 1 2 2 3 8 4 4 4 5 9 5 4 6 5 6 6 8 3 2 5 13 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_27162564_27163666
seq2: B6Ng01-276C15.b_46_1152 (reverse)

seq1  TATTAATTTTAAATTTTGATTA-GTTTCTT-CATT-ATGT-GTGCAGCCT  46
      ||||||||| || ||| ||||| ||||||| |||| |||| | |||||||
seq2  TATTAATTTAAATTTTGGATTAGGTTTCTTCCATTAATGTGGGGCAGCCT  50

seq1  T-CCCCAAATGGTCTGCCTTTTCTTACATCATAAGGGAAAATCAGATGTA  95
      | ||||||||||||||||||||| ||||||||||||| ||||||||||||
seq2  TCCCCCAAATGGTCTGCCTTTTC-TACATCATAAGGGGAAATCAGATGTA  99

seq1  TAAGAGGCTCCTCCACGTACTGTATCTTGTTTCTCAGGATGATCTCTGTG  145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAGGCTCCTCCACGTACTGTATCTTGTTTCTCAGGATGATCTCTGTG  149

seq1  TTTGATTAGGTCTGTGTGTGTCCATAGCTCTAGTGTATAGGGTTCTAATT  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATTAGGTCTGTGTGTGTCCATAGCTCTAGTGTATAGGGTTCTAATT  199

seq1  TCCTTGGCATTCTTTGTTAAGTAGAGTTTAATTTACTGTAAAAGTTATAT  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGGCATTCTTTGTTAAGTAGAGTTTAATTTACTGTAAAAGTTATAT  249

seq1  GTGTTCATATTTCACATATATAATCTATTTTTCATTAATCCTTTATTACT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTCATATTTCACATATATAATCTATTTTTCATTAATCCTTTATTACT  299

seq1  AATAAAAATGACTTGTACAAAAGATAGTCTCATTAATAAAATATAATGAC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAAAATGACTTGTACAAAAGATAGTCTCATTAATAAAATATAATGAC  349

seq1  AATGAAGGGAATGAATGAAGAAAACAAGGAAAAGAAAACATCACAGAGAT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGGGAATGAATGAAGAAAACAAGGAAAAGAAAACATCACAGAGAT  399

seq1  ACATTTTTAGACCCTTCAAAAATTATGTGATGGCACTGATGTTTACTTCT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTTTAGACCCTTCAAAAATTATGTGATGGCACTGATGTTTACTTCT  449

seq1  AAAAAATTCTCCCACATAAAGAGTTACAGAAAGATTATGAACTTCGGTTT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAATTCTCCCACATAAAGAGTTACAGAAAGATTATGAACTTCGGTTT  499

seq1  CATAAGGGTATGTGGAACTATGTGTGTTGTCTACATGGCAAAGAAGAATG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAAGGGTATGTGGAACTATGTGTGTTGTCTACATGGCAAAGAAGAATG  549

seq1  TGGTCCAAATTTGTTTATCTCAGGTAATCCATTTTAATCATTTTTGCCTA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCCAAATTTGTTTATCTCAGGTAATCCATTTTAATCATTTTTGCCTA  599

seq1  ATTCTCTTGAGAACCCCTTTTCCCATTGTTATTTGCCTGGTCTTATTTTT  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTCTTGAGAACCCCTTTTCCCATTGTTATTTGCCTGGTCTTATTTTT  649

seq1  CTCACTCCTTATTATCCATTTTTGATAGGGTAATTAGATTCTTCTATAGT  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTCCTTATTATCCATTTTTGATAGGGTAATTAGATTCTTCTATAGT  699

seq1  CTTCATTTTCATAACCCGTAAATTAGTTCAGAGATAGCATGCCAAATATA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCATTTTCATAACCCGTAAATTAGTTCAGAGATAGCATGCCAAATATA  749

seq1  TTTAATTAGCAATCTCTTTATGTATGATTCTGTTATCGAACATACCTGGG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATTAGCAATCTCTTTATGTATGATTCTGTTATCGAACATACCTGGG  799

seq1  CAGGTCAAAATTTCATTGCAATGTTCACTTATGTTGTGTTTAATAGGAAT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTCAAAATTTCATTGCAATGTTCACTTATGTTGTGTTTAATAGGAAT  849

seq1  TCTCTCCATTGTTCTTCTCCTGCACATTTTTGTCCTACTGGAGTCATGCA  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCCATTGTTCTTCTCCTGCACATTTTTGTCCTACTGGAGTCATGCA  899

seq1  AATGTAGAAAAATGCAATTTTGAAAGGTATTTCTATCAGAATATGATGGT  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAGAAAAATGCAATTTTGAAAGGTATTTCTATCAGAATATGATGGT  949

seq1  TTTCATATTCTGCCATAACATATAAGTCCCAAGTGAATATATGGGAGACT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATATTCTGCCATAACATATAAGTCCCAAGTGAATATATGGGAGACT  999

seq1  AGTTTGACTCATTAGTGTGGAAATTATTTTGACCACTTACACCTGACTGT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGACTCATTAGTGTGGAAATTATTTTGACCACTTACACCTGACTGT  1049

seq1  GTTAAAGGATTGGCATCTATGTTATGTGAATCAAATCCTGAGGACATATA  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAAGGATTGGCATCTATGTTATGTGAATCAAATCCTGAGGACATATA  1099

seq1  CTGAATTC  1103
      ||||||||
seq2  CTGAATTC  1107

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information