MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-302L17
Chromosome	13 (Build37)
Map Location	23,652,877 - 23,769,782
singlet/doublet	doublet
Overlap gene	Hist1h3e, Hist1h2ae, Hist1h2bg, Hist1h2bf, Hist1h2ad, Hist1h3d, Hist1h4d, Hist1h2be, Hist1h1e
Upstream gene	V1rh8, V1rh7, LOC382740, LOC432735, V1rh9, OTTMUSG00000000514, V1rh10, V1rh20, V1rh18, V1rh6, V1rh5, V1ri2, V1ri10, V1rh14, LOC100040639, V1ri5, V1rh13, V1rh12, V1rh16, OTTMUSG00000000541, Zfp322a, Abt1, Btn1a1, Btn2a2, Hist1h4h, Hist1h2af, Hist1h3g, Hist1h2bh, Hist1h3f, Hist1h4f, Hist1h1d
Downstream gene	Hist1h2ac, Hist1h2bc, Hist1h1t, Hist1h4c, Hfe, Hist1h1c, Hist1h3c, Hist1h2bb, Hist1h2ab, Hist1h3b, Hist1h4b, Hist1h4a, Hist1h3a, Hist1h1a, Trim38, Slc17a2, Slc17a3, Slc17a1, Slc17a4, Snrp1c-ps2, Hist1h2ba, Hist1h2aa, Scgn, Lrrc16, LOC100042017, Cmah, 5830431A10Rik, 6330500D04Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	V1rh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171251 MGI:2159667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171250 MGI:2159665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC432735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	V1rh9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171252 MGI:2159668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000514 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432736 MGI:3650395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171269 MGI:2159673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171277 MGI:2159685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171275 MGI:2159683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171249 MGI:2159664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171248 MGI:2159663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171253 MGI:2159687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171279 MGI:2159696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171273 MGI:2159677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1ri5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171256 MGI:2159691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171272 MGI:2159676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171271 MGI:2159675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171274 MGI:2159679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100036518 MGI:3649245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp322a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218100 MGI:2442566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30946 MGI:1353636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btn1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12231 MGI:103118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btn2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238555 MGI:3606486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69386 MGI:2448427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2af (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319173 MGI:2448309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97908 MGI:2145541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319182 MGI:2448387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260423 MGI:2448329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319157 MGI:2448425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14957 MGI:107502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319151 MGI:2448326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319166 MGI:2448290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319181 MGI:2448386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319180 MGI:2448383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319165 MGI:2448289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319149 MGI:2448322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319156 MGI:2448423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2be (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319179 MGI:2448380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50709 MGI:1931527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ac (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319164 MGI:2448287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68024 MGI:1915274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h1t (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107970 MGI:1888530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319155 MGI:2448421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hfe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15216 MGI:109191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50708 MGI:1931526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319148 MGI:2448320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319178 MGI:2448377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319172 MGI:2448306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319150 MGI:2448319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:326620 MGI:2448420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:326619 MGI:2448419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360198 MGI:2668828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80838 MGI:1931523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214158 MGI:2684869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc17a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218103 MGI:2443098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc17a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105355 MGI:2389216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc17a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20504 MGI:103209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc17a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319848 MGI:2442850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrp1c-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20632 MGI:109487
definition	gene_synonym : mC-[y]22 note : U1 small nuclear ribonucleoprotein 1C, pseudogene 2 pseudo : _no_value

name	Hist1h2ba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319177 MGI:2448375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2aa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319163 MGI:2448285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214189 MGI:2384873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68732 MGI:1915982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cmah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12763 MGI:103227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830431A10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76024 MGI:1923274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins

name	6330500D04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193385 MGI:2444879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	V1rh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717750 GeneID:171251 MGI:2159667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H8 transcript_id : NM_134217.1

name	V1rh7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717740 GeneID:171250 MGI:2159665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H7 transcript_id : NM_134216.1

name	LOC432735 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263909 GeneID:432735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to vomeronasal receptor V1RH7 transcript_id : XM_001474932.1

name	V1rh9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717744 GeneID:171252 MGI:2159668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H9 transcript_id : NM_134218.1

name	OTTMUSG00000000514 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000661 GeneID:432736 MGI:3650395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000514 transcript_id : NM_001013787.1

name	V1rh10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717786 GeneID:171269 MGI:2159673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H10 transcript_id : NM_134235.1

name	V1rh20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717794 GeneID:171277 MGI:2159685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H20 transcript_id : NM_134243.1

name	V1rh18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717784 GeneID:171275 MGI:2159683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H18 transcript_id : NM_134241.1

name	V1rh6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372163 GeneID:171249 MGI:2159664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H6 transcript_id : NM_134215.1

name	V1rh5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955273 GeneID:171248 MGI:2159663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H5 transcript_id : NM_134214.1

name	V1ri2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717754 GeneID:171253 MGI:2159687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I2 transcript_id : NM_134219.1

name	V1ri10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717788 GeneID:171279 MGI:2159696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I10 transcript_id : NM_134245.1

name	V1rh14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717780 GeneID:171273 MGI:2159677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H14 transcript_id : NM_134239.1

name	V1ri5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717752 GeneID:171256 MGI:2159691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I5 transcript_id : NM_134222.1

name	V1rh13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955265 GeneID:171272 MGI:2159676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H13 transcript_id : NM_134238.1

name	V1rh12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955269 GeneID:171271 MGI:2159675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H12 transcript_id : NM_134237.1

name	V1rh16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717790 GeneID:171274 MGI:2159679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H16 transcript_id : NM_134240.1

name	OTTMUSG00000000541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032006 GeneID:100036518 MGI:3649245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000541 transcript_id : NM_001083311.1

name	Zfp322a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982559 GeneID:218100 MGI:2442566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 322a transcript_id : NM_172586.2

name	Abt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352609 GeneID:30946 MGI:1353636
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activator of basal transcription transcript_id : NM_013924.2

name	Btn1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253943 GeneID:12231 MGI:103118
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin, subfamily 1, member A1 transcript_id : NM_013483.2

name	Btn2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953892 GeneID:238555 MGI:3606486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin, subfamily 2, member A2 transcript_id : NM_175938.3

name	Hist1h4h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802886 GeneID:69386 MGI:2448427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4h transcript_id : NM_153173.2

name	Hist1h2af (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061378 GeneID:319173 MGI:2448309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2af transcript_id : NM_175661.1

name	Hist1h3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991703 GeneID:97908 MGI:2145541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3g transcript_id : NM_145073.2

name	Hist1h2bh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061386 GeneID:319182 MGI:2448387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bh transcript_id : NM_178197.1

name	Hist1h3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30102949 GeneID:260423 MGI:2448329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3f transcript_id : NM_013548.2

name	Hist1h4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061354 GeneID:319157 MGI:2448425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4f transcript_id : NM_175655.1

name	Hist1h1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328364 GeneID:14957 MGI:107502
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1d transcript_id : NM_145713.2

name	Hist1h3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061340 GeneID:319151 MGI:2448326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3e transcript_id : NM_178205.1

name	Hist1h2ae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803099 GeneID:319166 MGI:2448290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ae transcript_id : NM_178187.3

name	Hist1h2bg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254304 GeneID:319181 MGI:2448386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bg transcript_id : NM_178196.2

name	Hist1h2bf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061382 GeneID:319180 MGI:2448383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bf transcript_id : NM_178195.1

name	Hist1h2ad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972409 GeneID:319165 MGI:2448289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ad transcript_id : NM_178188.3

name	Hist1h3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061336 GeneID:319149 MGI:2448322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3d transcript_id : NM_178204.1

name	Hist1h4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089713 GeneID:319156 MGI:2448423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4d transcript_id : NM_175654.1

name	Hist1h2be (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377782 GeneID:319179 MGI:2448380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2be transcript_id : NM_178194.3

name	Hist1h1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60097927 GeneID:50709 MGI:1931527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1e transcript_id : NM_015787.2

name	Hist1h2ac (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381322 GeneID:319164 MGI:2448287
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ac transcript_id : NM_178189.3

name	Hist1h2bc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381596 GeneID:68024 MGI:1915274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bc transcript_id : NM_023422.3

name	Hist1h1t (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807206 GeneID:107970 MGI:1888530
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1t transcript_id : NM_010377.2

name	Hist1h4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061348 GeneID:319155 MGI:2448421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4c transcript_id : NM_178208.1

name	Hfe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385447 GeneID:15216 MGI:109191
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemochromatosis transcript_id : NM_010424.3

name	Hist1h1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845256 GeneID:50708 MGI:1931526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1c transcript_id : NM_015786.1

name	Hist1h3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089711 GeneID:319148 MGI:2448320
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3c transcript_id : NM_175653.1

name	Hist1h2bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506291 GeneID:319178 MGI:2448377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bb transcript_id : NM_175664.2

name	Hist1h2ab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299610 GeneID:319172 MGI:2448306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ab transcript_id : NM_175660.2

name	Hist1h3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061338 GeneID:319150 MGI:2448319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3b transcript_id : NM_178203.1

name	Hist1h4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061404 GeneID:326620 MGI:2448420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4b transcript_id : NM_178193.1

name	Hist1h4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061402 GeneID:326619 MGI:2448419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4a transcript_id : NM_178192.1

name	Hist1h3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374465 GeneID:360198 MGI:2668828
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3a transcript_id : NM_013550.4

name	Hist1h1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426822 GeneID:80838 MGI:1931523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1a transcript_id : NM_030609.1

name	Trim38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480133 GeneID:214158 MGI:2684869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 38 transcript_id : NM_001029935.1

name	Slc17a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909325 GeneID:218103 MGI:2443098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 17 (sodium phosphate), member 2 transcript_id : NM_144836.2

name	Slc17a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542098 GeneID:105355 MGI:2389216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 17 (sodium phosphate), member 3 transcript_id : NM_134069.2

name	Slc17a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982007 GeneID:20504 MGI:103209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 17 (sodium phosphate), member 1 transcript_id : NM_009198.2

name	Slc17a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299612 GeneID:319848 MGI:2442850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 17 (sodium phosphate), member 4 transcript_id : NM_177016.3

name	Hist1h2ba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28316749 GeneID:319177 MGI:2448375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ba transcript_id : NM_175663.1

name	Hist1h2aa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28316755 GeneID:319163 MGI:2448285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2aa transcript_id : NM_175658.1

name	Scgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703797 GeneID:214189 MGI:2384873
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretagogin, EF-hand calcium binding protein transcript_id : NM_145399.1

name	Lrrc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57864121 GeneID:68732 MGI:1915982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 16 transcript_id : NM_026825.2

name	Cmah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802573 GeneID:12763 MGI:103227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytidine monophospho-N-acetylneuraminic acid hydroxylase transcript_id : NM_007717.3

name	6330500D04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123314453 GeneID:193385 MGI:2444879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330500D04 gene transcript_id : NM_178658.4

name	6330500D04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123314463 GeneID:193385 MGI:2444879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330500D04 gene transcript_id : NM_029679.1

name	6330500D04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123314461 GeneID:193385 MGI:2444879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330500D04 gene transcript_id : NM_001080381.1

name	V1rh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717751 CCDS:CCDS26322.1 GeneID:171251 MGI:2159667
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H8 protein_id : NP_598978.1

name	V1rh7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717741 CCDS:CCDS26323.1 GeneID:171250 MGI:2159665
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H7 protein_id : NP_598977.1

name	LOC432735 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263910 GeneID:432735
definition	codon_start : 1 product : similar to vomeronasal receptor V1RH7 protein_id : XP_001474982.1

name	V1rh9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717745 GeneID:171252 MGI:2159668
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H9 protein_id : NP_598979.1

name	OTTMUSG00000000514 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000662 GeneID:432736 MGI:3650395
definition	codon_start : 1 product : hypothetical protein LOC432736 protein_id : NP_001013809.1

name	V1rh10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717787 CCDS:CCDS26325.1 GeneID:171269 MGI:2159673
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H10 protein_id : NP_598996.1

name	V1rh20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717795 CCDS:CCDS26326.1 GeneID:171277 MGI:2159685
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H20 protein_id : NP_599004.1

name	V1rh18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717785 CCDS:CCDS26327.1 GeneID:171275 MGI:2159683
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H18 protein_id : NP_599002.1

name	V1rh6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372164 CCDS:CCDS26328.1 GeneID:171249 MGI:2159664
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H6 protein_id : NP_598976.1

name	V1rh5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955274 CCDS:CCDS26329.1 GeneID:171248 MGI:2159663
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H5 protein_id : NP_598975.1

name	V1ri2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717755 CCDS:CCDS26330.1 GeneID:171253 MGI:2159687
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I2 protein_id : NP_598980.1

name	V1ri10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717789 CCDS:CCDS26331.1 GeneID:171279 MGI:2159696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I10 protein_id : NP_599006.1

name	V1rh14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717781 CCDS:CCDS26332.1 GeneID:171273 MGI:2159677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H14 protein_id : NP_599000.1

name	V1ri5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717753 CCDS:CCDS26333.1 GeneID:171256 MGI:2159691
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I5 protein_id : NP_598983.1

name	V1rh13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955266 CCDS:CCDS26334.1 GeneID:171272 MGI:2159676
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H13 protein_id : NP_598999.1

name	V1rh12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955270 CCDS:CCDS26335.1 GeneID:171271 MGI:2159675
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H12 protein_id : NP_598998.1

name	V1rh16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717791 CCDS:CCDS26336.1 GeneID:171274 MGI:2159679
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H16 protein_id : NP_599001.1

name	OTTMUSG00000000541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032007 GeneID:100036518 MGI:3649245
definition	codon_start : 1 note : vomeronasal 1 receptor I (V1ri) family member product : predicted gene, OTTMUSG00000000541 protein_id : NP_001076780.1

name	Zfp322a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369830 CCDS:CCDS26337.1 GeneID:218100 MGI:2442566
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 322a protein_id : NP_766174.1

name	Abt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468953 CCDS:CCDS26338.1 GeneID:30946 MGI:1353636
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016251 - general RNA polymerase II transcription factor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : activator of basal transcription protein_id : NP_038952.1

name	Btn1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304935 CCDS:CCDS26339.1 GeneID:12231 MGI:103118
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : butyrophilin, subfamily 1, member A1 protein_id : NP_038511.1

name	Btn2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953893 GeneID:238555 MGI:3606486
definition	codon_start : 1 product : butyrophilin 2 protein_id : NP_787952.2

name	Hist1h4h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943922 CCDS:CCDS26340.1 GeneID:69386 MGI:2448427
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence ISS] [Evidence IEA] codon_start : 1 note : H4 histone family, member A product : histone 1, H4h protein_id : NP_694813.1

name	Hist1h2af (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061379 CCDS:CCDS26341.1 GeneID:319173 MGI:2448309
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone H2a (aa 92-128) product : histone 1, H2af protein_id : NP_783592.1

name	Hist1h3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489955 CCDS:CCDS26342.1 GeneID:97908 MGI:2145541
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3g protein_id : NP_659539.1

name	Hist1h2bh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061387 CCDS:CCDS26343.1 GeneID:319182 MGI:2448387
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bh protein_id : NP_835504.1

name	Hist1h3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305139 CCDS:CCDS26344.1 GeneID:260423 MGI:2448329
definition	codon_start : 1 note : histone H3; histone gene complex 1 product : histone 1, H3f protein_id : NP_038576.1

name	Hist1h4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061355 CCDS:CCDS26345.1 GeneID:319157 MGI:2448425
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4f protein_id : NP_783586.1

name	Hist1h1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328365 CCDS:CCDS26346.1 GeneID:14957 MGI:107502
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0016584 - nucleosome spacing [Evidence IMP] codon_start : 1 exception : mismatches in translation note : histone 1, family 3; H1 histone family, member 3 product : histone 1, H1d protein_id : NP_663759.2

name	Hist1h3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061341 CCDS:CCDS26347.1 GeneID:319151 MGI:2448326
definition	codon_start : 1 product : histone 1, H3e protein_id : NP_835512.1

name	Hist1h2ae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061367 CCDS:CCDS26348.1 GeneID:319166 MGI:2448290
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ae protein_id : NP_835494.1

name	Hist1h2bg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061377 CCDS:CCDS26349.1 GeneID:319181 MGI:2448386
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bg protein_id : NP_835503.1

name	Hist1h2bf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061383 CCDS:CCDS26350.1 GeneID:319180 MGI:2448383
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bf protein_id : NP_835502.1

name	Hist1h2ad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061357 CCDS:CCDS26351.1 GeneID:319165 MGI:2448289
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ad protein_id : NP_835495.1

name	Hist1h3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061337 CCDS:CCDS26352.1 GeneID:319149 MGI:2448322
definition	codon_start : 1 product : histone1, H3d protein_id : NP_835511.1

name	Hist1h4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089714 CCDS:CCDS26353.1 GeneID:319156 MGI:2448423
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4d protein_id : NP_783585.1

name	Hist1h2be (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089706 CCDS:CCDS26354.1 GeneID:319179 MGI:2448380
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2be protein_id : NP_835501.1

name	Hist1h1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13430890 CCDS:CCDS26355.1 GeneID:50709 MGI:1931527
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0016584 - nucleosome spacing [Evidence IMP] codon_start : 1 note : histone H1e; H1 histone family, member 4 product : histone 1, H1e protein_id : NP_056602.1

name	Hist1h2ac (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061363 CCDS:CCDS26356.1 GeneID:319164 MGI:2448287
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ac protein_id : NP_835496.1

name	Hist1h2bc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68131547 CCDS:CCDS26357.1 GeneID:68024 MGI:1915274
definition	codon_start : 1 note : H2B histone family, member S product : histone 1, H2bc protein_id : NP_075911.2

name	Hist1h1t (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807207 CCDS:CCDS26358.1 GeneID:107970 MGI:1888530
definition	GO_function : GO:0003677 - DNA binding [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : H1 histone family, member T (testis-specific) product : histone 1, H1t protein_id : NP_034507.2

name	Hist1h4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061349 CCDS:CCDS26359.1 GeneID:319155 MGI:2448421
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : germinal histone H4 product : histone 1, H4c protein_id : NP_835515.1

name	Hfe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981697 CCDS:CCDS26360.1 GeneID:15216 MGI:109191
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0019883 - antigen processing and presentation of endogenous antigen [Evidence IEA]; GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : hemochromatosis protein_id : NP_034554.2

name	Hist1h1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845257 CCDS:CCDS26361.1 GeneID:50708 MGI:1931526
definition	GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0016584 - nucleosome spacing [Evidence IMP] codon_start : 1 note : histone H1; H1 histone family, member 2 product : histone 1, H1c protein_id : NP_056601.1

name	Hist1h3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089712 CCDS:CCDS26362.1 GeneID:319148 MGI:2448320
definition	codon_start : 1 product : histone1, H3c protein_id : NP_783584.1

name	Hist1h2bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316760 CCDS:CCDS26363.1 GeneID:319178 MGI:2448377
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bb protein_id : NP_783595.1

name	Hist1h2ab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299611 CCDS:CCDS26364.1 GeneID:319172 MGI:2448306
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ab protein_id : NP_783591.2

name	Hist1h3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061339 CCDS:CCDS26365.1 GeneID:319150 MGI:2448319
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3b protein_id : NP_835510.1

name	Hist1h4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061405 CCDS:CCDS26366.1 GeneID:326620 MGI:2448420
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4b protein_id : NP_835500.1

name	Hist1h4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061403 CCDS:CCDS26367.1 GeneID:326619 MGI:2448419
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4a protein_id : NP_835499.1

name	Hist1h3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32880233 CCDS:CCDS26368.1 GeneID:360198 MGI:2668828
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3a protein_id : NP_038578.2

name	Hist1h1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426823 CCDS:CCDS26369.1 GeneID:80838 MGI:1931523
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : H1 histone family, member 1 product : histone 1, H1a protein_id : NP_085112.1

name	Trim38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480134 CCDS:CCDS26370.1 GeneID:214158 MGI:2684869
definition	codon_start : 1 note : RING finger protein 15; zinc finger protein RoRet product : tripartite motif-containing 38 protein_id : NP_001025106.1

name	Slc17a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450227 GeneID:218103 MGI:2443098
definition	GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 product : solute carrier family 17 (sodium phosphate), member 2 protein_id : NP_659085.1

name	Slc17a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527290 CCDS:CCDS26371.1 GeneID:105355 MGI:2389216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 17 (sodium phosphate), member 3 protein_id : NP_598830.1

name	Slc17a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982008 CCDS:CCDS26372.1 GeneID:20504 MGI:103209
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0015114 - phosphate transporter activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : solute carrier family 17 (sodium/hydrogen exchanger), member 1; solute carrier family 17 vesicular glutamate transporter), member 1; sodium/phosphate type I cotransporter; sodium-dependent phosphate/anion cotransporter product : solute carrier family 17 (sodium phosphate), member 1 protein_id : NP_033224.2

name	Slc17a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299613 GeneID:319848 MGI:2442850
definition	codon_start : 1 product : hypothetical protein LOC319848 protein_id : NP_795990.2

name	Hist1h2ba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316750 CCDS:CCDS26373.1 GeneID:319177 MGI:2448375
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ba protein_id : NP_783594.1

name	Hist1h2aa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316756 CCDS:CCDS26374.1 GeneID:319163 MGI:2448285
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2aa protein_id : NP_783589.1

name	Scgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703798 CCDS:CCDS26375.1 GeneID:214189 MGI:2384873
definition	codon_start : 1 product : secretagogin, EF-hand calcium binding protein protein_id : NP_663374.1

name	Lrrc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57864122 GeneID:68732 MGI:1915982
definition	GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine rich repeat containing 16 protein_id : NP_081101.2

name	Cmah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677424 CCDS:CCDS26376.1 GeneID:12763 MGI:103227
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045285 - ubiquinol-cytochrome-c reductase complex [Evidence IEA] GO_function : GO:0051537 - 2 iron, 2 sulfur cluster binding [Evidence IEA]; GO:0030338 - CMP-N-acetylneuraminate monooxygenase activity [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0046381 - CMP-N-acetylneuraminate metabolism [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CMP-NeuAc hydroxylase product : cytidine monophospho-N-acetylneuraminic acid hydroxylase protein_id : NP_031743.2

name	6330500D04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123314454 CCDS:CCDS26377.1 GeneID:193385 MGI:2444879
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : hypothetical protein LOC193385 isoform 3 protein_id : NP_848773.3

name	6330500D04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123314464 GeneID:193385 MGI:2444879
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC193385 isoform 1 protein_id : NP_083955.1

name	6330500D04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123314462 GeneID:193385 MGI:2444879
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC193385 isoform 2 protein_id : NP_001073850.1

name	LOC100040639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040639
definition	number : 1 pseudo : _no_value

name	LOC100040639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040639
definition	number : 2 pseudo : _no_value

name	LOC100040639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040639
definition	number : 3 pseudo : _no_value

name	LOC100042017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042017
definition	number : 1 pseudo : _no_value

name	LOC382740 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94394739 GeneID:382740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to ribosomal protein L5 pseudo : _no_value transcript_id : XR_001787.1

name	5830431A10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94394746 GeneID:76024 MGI:1923274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : RIKEN cDNA 5830431A10 gene transcript_id : XR_002313.1

clone name	MSMg01-290P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317O18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-521A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-215G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-489H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062E09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-057N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052G06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025D13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-302L17.b	B6Ng01-302L17.g
ACC	GA096706	GA096707
length	1,106	1,137
definition	B6Ng01-302L17.b	B6Ng01-302L17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(23,768,695 - 23,769,782)	(23,652,877 - 23,654,011)
sequence	gaattctcatttacaggtctccctactggccaagtatcatattttctgca tactggagcccacatagtatttactaaatatgataagggtcctcacagta aggaactctttcttaggatctgatgtagataaggctgagtattggtcagg acaatggtcttcaggagagaagagcttgcaaaggcattaagaaaagaact cttggatcataacaaagctatcagcttccatgatcttgatctgactttct ctgaacacccccaacagaccatctgtacctaacatagcactacatatgac actaataaaggattgtgttacctaaagttaaaataatgaagagcgtggtt tgacttaatggcatgaaggaggaactataaaacaacaaaaatgtctttaa actaggttagctatgcgctttgccatgtatttccagttacctgtactctg tgagctatcttacacttaaaagggtggaaatggaactctgaaagaagcca cgataatgatgtcaattcttaattcagtaaagtacaaatatggtttcatt gtttttaatcctgactgattgtgttttgggatatcttacatattagttta accaaaacacagcagtacttaaggtataaaaaattatgaatgttgttatt agaggttgatgacttttgaataatttgaataagatttaactctagctaga ataaatgtttaattaaaacctggatttttttatccaataatacttaatag tgaatataaatatacatactgtcttagttaggtttctattgctgtcagca aatactgtgaccaaaaatcaggttgggaaggaaatatatatatatatata tatatatatatatatatatacacatatatatacacacatatacatatgca tatatatgtgggaaaaatgctttgaattcattttaaacatgaaaacaagt tttaaaataaggtacatgtttgggtataagcaaacaatcacagtaagaaa aagctgaataatgaaatattcttcattttgttaacttcattaaaaccaag attaagtattaatatctaataataagatctaataatatttaattaatata tgttta	gaattccctccactccttttacagctgcttgccaatgccagtggctgaac ctgctttctgagacactaattaaaagggcagggctattttcttcctagta tcaattgcttcctctgatatcagttaagatttacaaactctactatctat ttttaattattatttccttgttaaactctaaaaaaatggttgaactttct tgagtctttttatagatttttttttcctttttctttttttaagcaaggat tttgctatgtaacttgctacaataggttggttagctcagagatctgtctc ccagatgttgggattataggtgtaaaacaccgcaccctactgaattcttt aaaaccaggaaatcaacggtagtttaatctttatgttaaaccgtccaata ctattaaactcggctaggtagcagcactggcttgtaataccatctcagtg gtatactcaattaaatgataaactgagccaggcacagacctttttaatcc cagataaggaaaacggaaaccatagacaaggagaatcgtgctttaaaaac aaaactaaccaaaataaggtaaaaataattgaaatgccaacaatgtaaca agtttgaatggtgaaacaaagtaaaacgttaactctgttggacttttact gtgtggattgtaacacaatcccaaactgaagtgcgtacctgtttctggct taaaatggctaccccaactctagttgaaagcatacaagatgaaatgatat cctgaaagccttgtttccaaaaacaggcagctcagactgcttcgtcgggt ggtgctcatcattgtcaagaaaggctatatataataggaaaccctggaac actctacaaacttgtactacagcatctttggtggataatggaggtggctc ttaaaagagccgttttggtttacgtgccagtgtagaatgcgtgcctatta agcccgctcgccgcggatacggcgggccagctgggatgtccttgggcatg atggtgacacgctttggcgtgatggcgccacagatggtgttcctcaaaca gacccacgagttaggcttcgctcggccttctgcagagccatgacgtcgga ctctggaagccaggtcgatcctgaagtcctggcgcga
quality values	Open. Hide. 49 31 28 41 58 58 58 42 42 54 62 47 52 47 26 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 44 32 51 44 29 45 59 44 28 56 51 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 59 62 62 62 49 54 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 46 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 54 54 58 58 58 52 58 58 58 58 58 58 54 58 54 58 58 46 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 49 54 50 58 58 58 58 58 58 45 40 58 58 51 46 58 58 53 58 53 58 58 58 58 58 58 51 41 50 49 54 58 58 58 58 47 58 58 58 54 51 53 58 58 47 51 51 44 41 37 58 58 58 58 53 58 53 54 58 58 52 58 46 58 58 58 51 48 32 51 37 53 52 51 58 58 58 58 38 29 51 51 39 46 58 41 46 46 39 58 58 49 58 53 41 53 54 53 58 52 51 39 58 58 53 33 54 49 33 58 58 58 58 51 48 42 39 49 51 49 54 54 51 53 54 52 53 54 45 39 21 54 40 35 49 50 51 52 52 52 39 54 49 49 34 54 47 49 42 54 39 37 51 39 54 50 30 40 42 54 39 54 54 52 36 44 45 51 40 23 18 54 54 54 54 54 42 37 40 33 52 29 40 34 29 33 52 45 40 51 47 37 42 52 53 40 52 53 53 53 32 35 52 45 53 47 32 53 42 32 52 31 53 32 51 32 53 34 53 34 39 53 24 53 33 32 21 30 26 49 35 37 35 42 29 43 37 31 31 51 31 43 35 32 43 35 51 31 42 31 31 31 51 31 45 27 16 21 20 51 51 46 24 31 36 32 15 28 15 26 30 51 46 32 43 35 36 30 47 32 30 31 42 31 46 43 46 31 46 31 46 46 46 41 41 41 40 31 46 42 41 31 46 31 46 33 46 31 46 31 38 18 41 29 29 15 29 9 25 11 39 24 46 16 46 29 39 24 46 16 46 21 46 22 46 24 37 16 44 8 46 18 32 23 23 19 31 29 30 30 39 20 28 38 30 25 41 12 35 44 41 41 26 25 31 15 7 24 22 31 23 24 7 10 13 14 16 44 44 17 38 38 12 7 5 5 22 26 43 44 35 21 11 25 20 31 48 48 33 14 39 39 6 8 14 6 4 9 12 30 24 20 23 28 31 43 31 11 48 23 32 29 30 21 25 12 25 25 34 31 11 7 7 21 32 22 31 9 10 34 19 16 10 29 47 47 47 24 25 28 23 19 20 21 19 13 9 21 22 23 40 27 12 6 13 7 9 20 28 27 20 24 34 28 14 27 11 8 7 6 19 16 24 16 14 23 20 20 40 40 7 22 17 7 11 15 20 11 27 10 24 7 4 7 16 28 18 12 8 19 11 20 9 12 6 11 10 8 8 8 4 4 20 13 16 4 9 21 6 14 10 8 14 15 24 15 6 7 22 16 21 10 4 6 7 7 4 6 2 9 14 3	Open. Hide. 62 35 32 39 62 62 62 43 62 62 39 42 44 38 49 46 49 62 62 59 59 51 44 62 62 62 62 62 62 62 62 62 59 47 62 62 62 62 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 49 54 59 59 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 43 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 58 49 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 52 54 58 41 41 58 58 58 54 54 58 58 58 47 58 54 52 58 54 58 58 58 58 54 58 58 58 58 58 58 58 54 41 33 41 52 58 58 53 58 49 58 54 51 58 51 47 58 48 41 58 50 50 58 47 54 51 58 51 58 58 58 58 54 47 58 58 58 58 58 41 58 58 49 53 53 58 50 54 50 58 58 58 50 58 58 58 58 48 51 52 51 58 58 58 51 58 58 51 54 39 49 30 54 51 50 51 58 58 50 51 46 49 50 51 58 52 58 58 58 54 44 40 58 58 50 58 51 58 52 52 42 58 58 50 44 41 41 49 51 47 41 51 50 49 47 51 58 53 53 58 53 54 49 41 47 32 41 54 54 50 39 40 40 54 49 51 53 54 53 40 32 44 54 28 37 49 51 32 52 42 46 52 51 35 42 26 54 44 44 52 54 54 49 37 44 46 38 45 53 32 42 28 41 54 27 54 30 40 37 47 51 30 39 47 37 54 54 38 31 54 45 38 42 33 41 35 35 44 26 51 44 49 38 47 37 45 39 53 42 52 53 53 32 34 31 40 30 32 33 46 37 40 26 45 53 53 34 35 45 33 31 30 40 25 51 34 35 35 51 41 32 25 32 30 32 45 30 46 31 25 29 21 51 46 51 31 33 27 29 51 30 31 31 42 41 35 39 19 45 24 30 45 31 42 31 30 27 30 37 26 47 51 26 42 31 22 31 31 31 35 32 31 34 26 20 43 31 31 36 37 31 32 42 48 31 31 46 15 30 31 31 28 32 31 31 27 30 31 31 31 31 31 41 32 15 32 38 43 31 19 19 21 25 23 31 41 32 34 34 31 33 41 30 24 29 29 34 25 31 31 37 34 43 31 23 31 31 43 41 48 48 37 34 38 27 25 30 29 13 17 29 24 35 26 38 26 20 16 29 29 22 33 24 26 19 30 44 44 25 12 38 22 29 28 8 25 41 43 20 15 22 20 43 28 10 22 24 32 20 13 7 12 12 21 23 14 23 15 31 17 4 9 22 32 31 33 23 22 21 31 28 33 11 17 32 30 30 19 16 22 15 21 32 13 18 15 20 12 13 18 23 13 11 21 6 6 21 34 13 7 6 26 23 27 20 13 38 7 28 26 14 22 10 15 7 5 13 34 22 24 24 28 19 22 18 30 28 18 20 28 17 15 19 19 22 10 33 6 25 13 19 18 14 5 3 4 9 21 11 7 6 17 14 9 4 3 2 3 7 9 7 16 6 6 5 3 6 4 3 5 4 3 2 5 9 8 22 18 5 6 5 19 13 4 7 7 15 11 3 3 14 5 9 5 8 5 9 5 21 18 5 5 10 3 5 8 5 3 18 4 3 7 10 13 10 12 6 5 1 8 5 4 5 2 5 10 9 11 13 1 7 5 5 5 7 7 17 6 6 3 1 3 7 6 22 6 14 13 5 6 11 20 5 11 6 13 4 6 4 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_23768695_23769782
seq2: B6Ng01-302L17.b_47_1152 (reverse)

seq1  TAAACATATAT--AATAAATAT--ATAGATC-TAT--ATAGATA-TAATA  42
      |||||||||||  | |||||||   |||||| |||   |||||| |||||
seq2  TAAACATATATTAATTAAATATTATTAGATCTTATTATTAGATATTAATA  50

seq1  C-TAATCTTGGTTTTAATGAAGTTA--CAAATGAAG-ATATTTCATTATT  88
      | |||||||||||||||||||||||   |||||||| |||||||||||||
seq2  CTTAATCTTGGTTTTAATGAAGTTAACAAAATGAAGAATATTTCATTATT  100

seq1  CAGCTTTTTCTTACTGTGATTGTTTGCTTATA-CCAAACATGTACCTTA-  136
      |||||||||||||||||||||||||||||||| |||||||||||||||| 
seq2  CAGCTTTTTCTTACTGTGATTGTTTGCTTATACCCAAACATGTACCTTAT  150

seq1  TTTAAAACTTGTTTTCATGTTT-AAATG-ATTC-AAGCATTTTT-CCACA  182
      |||||||||||||||||||||| ||||| |||| |||||||||| |||||
seq2  TTTAAAACTTGTTTTCATGTTTAAAATGAATTCAAAGCATTTTTCCCACA  200

seq1  TATATATGCATATGTATATGTGTGTATATATATGTGTATATATATATATA  232
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATATGCATATGTATATGTGTGTATATATATGTGTATATATATATATA  250

seq1  TATATATATATATATATATATATTTCCTTCCCAACCTGATTTTTGGTCAC  282
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATATATATATATATATATATTTCCTTCCCAACCTGATTTTTGGTCAC  300

seq1  AGTATTTGCTGACAGCAATAGAAACCTAACTAAGACAGTATGTATATTTA  332
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATTTGCTGACAGCAATAGAAACCTAACTAAGACAGTATGTATATTTA  350

seq1  TATTCACTATTAAGTATTATTGGATAAAAAAATCCAGGTTTTAATTAAAC  382
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCACTATTAAGTATTATTGGATAAAAAAATCCAGGTTTTAATTAAAC  400

seq1  ATTTATTCTAGCTAGAGTTAAATCTTATTCAAATTATTCAAAAGTCATCA  432
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATTCTAGCTAGAGTTAAATCTTATTCAAATTATTCAAAAGTCATCA  450

seq1  ACCTCTAATAACAACATTCATAATTTTTTATACCTTAAGTACTGCTGTGT  482
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCTAATAACAACATTCATAATTTTTTATACCTTAAGTACTGCTGTGT  500

seq1  TTTGGTTAAACTAATATGTAAGATATCCCAAAACACAATCAGTCAGGATT  532
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGTTAAACTAATATGTAAGATATCCCAAAACACAATCAGTCAGGATT  550

seq1  AAAAACAATGAAACCATATTTGTACTTTACTGAATTAAGAATTGACATCA  582
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACAATGAAACCATATTTGTACTTTACTGAATTAAGAATTGACATCA  600

seq1  TTATCGTGGCTTCTTTCAGAGTTCCATTTCCACCCTTTTAAGTGTAAGAT  632
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCGTGGCTTCTTTCAGAGTTCCATTTCCACCCTTTTAAGTGTAAGAT  650

seq1  AGCTCACAGAGTACAGGTAACTGGAAATACATGGCAAAGCGCATAGCTAA  682
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCACAGAGTACAGGTAACTGGAAATACATGGCAAAGCGCATAGCTAA  700

seq1  CCTAGTTTAAAGACATTTTTGTTGTTTTATAGTTCCTCCTTCATGCCATT  732
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGTTTAAAGACATTTTTGTTGTTTTATAGTTCCTCCTTCATGCCATT  750

seq1  AAGTCAAACCACGCTCTTCATTATTTTAACTTTAGGTAACACAATCCTTT  782
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCAAACCACGCTCTTCATTATTTTAACTTTAGGTAACACAATCCTTT  800

seq1  ATTAGTGTCATATGTAGTGCTATGTTAGGTACAGATGGTCTGTTGGGGGT  832
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTGTCATATGTAGTGCTATGTTAGGTACAGATGGTCTGTTGGGGGT  850

seq1  GTTCAGAGAAAGTCAGATCAAGATCATGGAAGCTGATAGCTTTGTTATGA  882
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAGAGAAAGTCAGATCAAGATCATGGAAGCTGATAGCTTTGTTATGA  900

seq1  TCCAAGAGTTCTTTTCTTAATGCCTTTGCAAGCTCTTCTCTCCTGAAGAC  932
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAGAGTTCTTTTCTTAATGCCTTTGCAAGCTCTTCTCTCCTGAAGAC  950

seq1  CATTGTCCTGACCAATACTCAGCCTTATCTACATCAGATCCTAAGAAAGA  982
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGTCCTGACCAATACTCAGCCTTATCTACATCAGATCCTAAGAAAGA  1000

seq1  GTTCCTTACTGTGAGGACCCTTATCATATTTAGTAAATACTATGTGGGCT  1032
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCTTACTGTGAGGACCCTTATCATATTTAGTAAATACTATGTGGGCT  1050

seq1  CCAGTATGCAGAAAATATGATACTTGGCCAGTAGGGAGACCTGTAAATGA  1082
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTATGCAGAAAATATGATACTTGGCCAGTAGGGAGACCTGTAAATGA  1100

seq1  GAATTC  1088
      ||||||
seq2  GAATTC  1106

seq1: chr13_23652877_23654011
seq2: B6Ng01-302L17.g_67_1203

seq1  GAATTCCCTCCACTCCTTTTACAGCTGCTTGCCAATGCCAGTGGCTGAAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTCCACTCCTTTTACAGCTGCTTGCCAATGCCAGTGGCTGAAC  50

seq1  CTGCTTTCTGAGACACTAATTAAAAGGGCAGGGCTATTTTCTTCCTAGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTTTCTGAGACACTAATTAAAAGGGCAGGGCTATTTTCTTCCTAGTA  100

seq1  TCAATTGCTTCCTCTGATATCAGTTAAGATTTACAAACTCTACTATCTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATTGCTTCCTCTGATATCAGTTAAGATTTACAAACTCTACTATCTAT  150

seq1  TTTTAATTATTATTTCCTTGTTAAACTCTAAAAAAATGGTTGAACTTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAATTATTATTTCCTTGTTAAACTCTAAAAAAATGGTTGAACTTTCT  200

seq1  TGAGTCTTTTTATAGATTTTTTTTTCCTTTTTCTTTTTTTAAGCAAGGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTCTTTTTATAGATTTTTTTTTCCTTTTTCTTTTTTTAAGCAAGGAT  250

seq1  TTTGCTATGTAACTTGCTACAATAGGTTGGTTAGCTCAGAGATCTGTCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCTATGTAACTTGCTACAATAGGTTGGTTAGCTCAGAGATCTGTCTC  300

seq1  CCAGATGTTGGGATTATAGGTGTAAAACACCGCACCCTACTGAATTCTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGATGTTGGGATTATAGGTGTAAAACACCGCACCCTACTGAATTCTTT  350

seq1  AAAACCAGGAAATCAACGGTAGTTTAATCTTTATGTTAAACCGTCCAATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACCAGGAAATCAACGGTAGTTTAATCTTTATGTTAAACCGTCCAATA  400

seq1  CTATTAAACTCGGCTAGGTAGCAGCACTGGCTTGTAATACCATCTCAGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTAAACTCGGCTAGGTAGCAGCACTGGCTTGTAATACCATCTCAGTG  450

seq1  GTATACTCAATTAAATGATAAACTGAGCCAGGCACAGACCTTTTTAATCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATACTCAATTAAATGATAAACTGAGCCAGGCACAGACCTTTTTAATCC  500

seq1  CAGATAAGGAAAACGGAAACCATAGACAAGGAGAATCGTGCTTTAAAAAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATAAGGAAAACGGAAACCATAGACAAGGAGAATCGTGCTTTAAAAAC  550

seq1  AAAACTAACCAAAATAAGGTAAAAATAATTGAAATGCCAACAATGTAACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTAACCAAAATAAGGTAAAAATAATTGAAATGCCAACAATGTAACA  600

seq1  AGTTTGAATGGTGAAACAAAGTAAAACGTTAACTCTGTTGGACTTTTACT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGAATGGTGAAACAAAGTAAAACGTTAACTCTGTTGGACTTTTACT  650

seq1  GTGTGGATTGTAACACAATCCCAAACTGAAGTGCGTACCTGTTTCTGGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGGATTGTAACACAATCCCAAACTGAAGTGCGTACCTGTTTCTGGCT  700

seq1  TAAAATGGCTACCCCAACTCTAGTTGAAAGCATACAAGATGAAATGATAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATGGCTACCCCAACTCTAGTTGAAAGCATACAAGATGAAATGATAT  750

seq1  CCTGAAAGCCTTGTTTCCAAAAACAGGCAGCTCAGACTGCTTCGTCGGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAAAGCCTTGTTTCCAAAAACAGGCAGCTCAGACTGCTTCGTCGGGT  800

seq1  GGTGCTCATCATTGTCAAGAAAGGCTATATATAATAGGAAACCCTGGAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCTCATCATTGTCAAGAAAGGCTATATATAATAGGAAACCCTGGAAC  850

seq1  ACTCTACAAACTTGTACTACAGCATCTTTGGTGGATAATGGAGGTGGCTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTACAAACTTGTACTACAGCATCTTTGGTGGATAATGGAGGTGGCTC  900

seq1  TTAAAAGAGCCGTTTTGGTTTACGTGCCAGTGTAGAAGGCGTGCCTATTA  950
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TTAAAAGAGCCGTTTTGGTTTACGTGCCAGTGTAGAATGCGTGCCTATTA  950

seq1  AGCCCGCTCGCCGCGGATACGGCGGGCCAGCT-GGATGTCCTTGGGCATG  999
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  AGCCCGCTCGCCGCGGATACGGCGGGCCAGCTGGGATGTCCTTGGGCATG  1000

seq1  ATGGTGACACGC-TTGGCGTGGATGGCG-CACAGGTTGGTG-TCCTCAAA  1046
      |||||||||||| ||||||| ||||||| |||| | ||||| ||||||||
seq2  ATGGTGACACGCTTTGGCGT-GATGGCGCCACA-GATGGTGTTCCTCAAA  1048

seq1  CAGACCCACGAGGTAGGCCTCGCTC-GCCTCCTGCAGAGCCATGACGGCC  1095
      |||||||||||| ||||| |||||| |||| |||||||||||||||| | 
seq2  CAGACCCACGAGTTAGGCTTCGCTCGGCCTTCTGCAGAGCCATGACGTCG  1098

seq1  GAGCTCTGGAAGCGCAGGTCGGTCTTGAAGTCCT-GCGCGA  1135
      || |||||||||| ||||||| || ||||||||| ||||||
seq2  GA-CTCTGGAAGC-CAGGTCGATCCTGAAGTCCTGGCGCGA  1137

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information