MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-317D11
Chromosome	13 (Build37)
Map Location	50,184,356 - 50,323,310
singlet/doublet	doublet
Overlap gene	LOC667546, LOC667552, LOC100040085, LOC100040159, LOC100040176
Upstream gene	Wnk2, Ninj1, 1110007C09Rik, Susd3, Fgd3, Bicd2, Ippk, Cenpp, Tes3-ps, Ecm2, Aspn, Omd, Ogn, Nol8, Iars, LOC667488, LOC670357, EG638833, Gm272, EG667503, EG667507, LOC100040099, LOC625110, LOC676907
Downstream gene	LOC100040118, Gm906, 2310081J21Rik, LOC676954, LOC667625, LOC667632, EG667637, Fbxw17, Gm806, EG639044, Gm904, LOC100040315, EG667693, LOC100040161, LOC100040190, EG667712, LOC676997, EG667717, Spin1, 4930519N16Rik, EG667728, LOC667733
Link	Open Mouse BAC browser

Click to get alignment info.

name	Wnk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75607 MGI:1922857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ninj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18081 MGI:1196617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110007C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68480 MGI:1915730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Susd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66329 MGI:1913579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30938 MGI:1353657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bicd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ippk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75678 MGI:1922928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66336 MGI:1913586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tes3-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54339 MGI:3582925
definition	note : testis derived transcript 3, pseudogene pseudo : _no_value

name	Ecm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407800 MGI:3039578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aspn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66695 MGI:1913945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Omd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27047 MGI:1350918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18295 MGI:109278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70930 MGI:1918180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105148 MGI:2145219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 99 Proteins

name	LOC670357 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins pseudo : _no_value

name	EG638833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638833 MGI:3646144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 231 ESTs, 25 Proteins

name	Gm272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218244 MGI:2685118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 Proteins pseudo : _no_value

name	EG667503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667503 MGI:3643443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG667507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667507 MGI:3645762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins

name	LOC625110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins pseudo : _no_value

name	LOC676907 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	LOC100040085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100040159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein

name	LOC100040176 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Gm906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380882 MGI:2685752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310081J21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69211 MGI:1916461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC676954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC667632 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667632
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG667637 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667637 MGI:3644780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Fbxw17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109082 MGI:1923584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm806 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328250 MGI:2685652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG639044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639044 MGI:3648502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gm904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380845 MGI:2685750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040315 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG667693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667693 MGI:3704126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein

name	LOC100040161 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins pseudo : _no_value

name	EG667712 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667712 MGI:3643286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC676997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG667717 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667717 MGI:3643288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 5 Proteins pseudo : _no_value

name	Spin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20729 MGI:109242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4930519N16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75124 MGI:1922374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667728 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667728 MGI:3646032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 20 Proteins

name	LOC667733 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667733
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 8 Proteins pseudo : _no_value

name	Wnk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383423 GeneID:75607 MGI:1922857
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WNK lysine deficient protein kinase 2 transcript_id : NM_029361.2

name	Ninj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129888 GeneID:18081 MGI:1196617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ninjurin 1 transcript_id : NM_013610.2

name	1110007C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344140 GeneID:68480 MGI:1915730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110007C09 gene transcript_id : NM_026738.2

name	Susd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130318 GeneID:66329 MGI:1913579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi domain containing 3 transcript_id : NM_025491.3

name	Fgd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719308 GeneID:30938 MGI:1353657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 3 transcript_id : NM_015759.2

name	Bicd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702354 GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bicaudal D homolog 2 (Drosophila) transcript_id : NM_001039179.1

name	Bicd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702357 GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bicaudal D homolog 2 (Drosophila) transcript_id : NM_029791.3

name	Bicd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702358 GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bicaudal D homolog 2 (Drosophila) transcript_id : NM_001039180.1

name	Ippk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892241 GeneID:75678 MGI:1922928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,3,4,5,6-pentakisphosphate 2-kinase transcript_id : NM_199056.2

name	Cenpp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343891 GeneID:66336 MGI:1913586
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein P transcript_id : NM_025495.2

name	Ecm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802059 GeneID:407800 MGI:3039578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extracellular matrix protein 2, female organ and adipocyte specific transcript_id : NM_001012324.2

name	Aspn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754117 GeneID:66695 MGI:1913945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asporin transcript_id : NM_025711.2

name	Omd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754933 GeneID:27047 MGI:1350918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : osteomodulin transcript_id : NM_012050.1

name	Ogn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802339 GeneID:18295 MGI:109278
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : osteoglycin transcript_id : NM_008760.3

name	Nol8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486812 GeneID:70930 MGI:1918180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 8 transcript_id : NM_001081350.1

name	Iars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802528 GeneID:105148 MGI:2145219
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isoleucine-tRNA synthetase transcript_id : NM_172015.2

name	LOC667488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264216 GeneID:667488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 99 Proteins product : hypothetical LOC667488 transcript_id : XM_990847.2

name	EG638833 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264219 GeneID:638833 MGI:3646144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 231 ESTs, 25 Proteins product : predicted gene, EG638833 transcript_id : XM_990888.2

name	EG667503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395091 GeneID:667503 MGI:3643443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG667503 transcript_id : XM_990932.1

name	EG667507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395093 GeneID:667507 MGI:3645762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG667507 transcript_id : XM_990959.1

name	LOC100040099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264224 GeneID:100040099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : similar to immediate early response 3 interacting protein 1 transcript_id : XM_001474265.1

name	LOC667552 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94395101 GeneID:667552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical LOC667552 transcript_id : XM_991187.1

name	LOC100040085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264222 GeneID:100040085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100040085 transcript_id : XM_001474059.1

name	LOC100040159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264228 GeneID:100040159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : hypothetical protein LOC100040159 transcript_id : XM_001474305.1

name	Gm906 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802418 GeneID:380882 MGI:2685752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 906, (NCBI) transcript_id : NM_001033438.2

name	2310081J21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395109 GeneID:69211 MGI:1916461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 2310081J21 gene transcript_id : XM_991450.1

name	Fbxw17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723091 GeneID:109082 MGI:1923584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 17 transcript_id : NM_175401.3

name	Gm806 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374348 GeneID:328250 MGI:2685652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 806, (NCBI) transcript_id : NM_001033400.2

name	Gm904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702080 GeneID:380845 MGI:2685750
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 904, (NCBI) transcript_id : NM_001033770.1

name	LOC100040315 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264233 GeneID:100040315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100040315 transcript_id : XM_001474512.1

name	EG667693 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395126 GeneID:667693 MGI:3704126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 1 Protein product : predicted gene, EG667693 transcript_id : XM_991919.1

name	EG667712 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395132 GeneID:667712 MGI:3643286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667712 transcript_id : XM_991993.1

name	Spin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802917 GeneID:20729 MGI:109242
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spindlin 1 transcript_id : NM_146043.2

name	Spin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709810 GeneID:20729 MGI:109242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spindlin 1 transcript_id : NM_011462.2

name	4930519N16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803151 GeneID:75124 MGI:1922374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519N16 gene transcript_id : NM_029173.2

name	Wnk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94536870 GeneID:75607 MGI:1922857
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : WNK lysine deficient protein kinase 2 protein_id : NP_083637.1

name	Ninj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305315 CCDS:CCDS26497.1 GeneID:18081 MGI:1196617
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0042246 - tissue regeneration [Evidence IEA] codon_start : 1 product : ninjurin 1 protein_id : NP_038638.1

name	1110007C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312030 GeneID:68480 MGI:1915730
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : RIKEN cDNA 1110007C09 protein_id : NP_081014.1

name	Susd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21702740 CCDS:CCDS26498.1 GeneID:66329 MGI:1913579
definition	codon_start : 1 product : sushi domain containing 3 protein_id : NP_079767.2

name	Fgd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719309 CCDS:CCDS26499.1 GeneID:30938 MGI:1353657
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0046847 - filopodium formation [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : faciogenital dysplasia homolog 3; Fgd1 family, member 3 product : FYVE, RhoGEF and PH domain containing 3 protein_id : NP_056574.2

name	Bicd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18139547 GeneID:76895 MGI:1924145
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : bicaudal D homolog 2 isoform 2 protein_id : NP_084067.1

name	Bicd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702355 GeneID:76895 MGI:1924145
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : bicaudal D homolog 2 isoform 1 protein_id : NP_001034268.1

name	Bicd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702359 GeneID:76895 MGI:1924145
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : bicaudal D homolog 2 isoform 3 protein_id : NP_001034269.1

name	Ippk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979616 CCDS:CCDS26500.1 GeneID:75678 MGI:1922928
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0035299 - inositol pentakisphosphate 2-kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046853 - inositol and derivative phosphorylation [Evidence ISS] codon_start : 1 product : inositol 1,3,4,5,6-pentakisphosphate 2-kinase protein_id : NP_951011.1

name	Cenpp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789150 CCDS:CCDS26501.1 GeneID:66336 MGI:1913586
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : centromere protein P protein_id : NP_079771.1

name	Ecm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858563 CCDS:CCDS26502.1 GeneID:407800 MGI:3039578
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : extracellular matrix protein 2 protein_id : NP_001012324.1

name	Aspn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754118 CCDS:CCDS26503.1 GeneID:66695 MGI:1913945
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : asporin protein_id : NP_079987.2

name	Omd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754934 CCDS:CCDS26504.1 GeneID:27047 MGI:1350918
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : osteoadherin product : osteomodulin protein_id : NP_036180.1

name	Ogn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679166 CCDS:CCDS26505.1 GeneID:18295 MGI:109278
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : osteoglycin protein_id : NP_032786.1

name	Nol8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486813 GeneID:70930 MGI:1918180
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : nucleolar protein 8 protein_id : NP_001074819.1

name	Iars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789383 GeneID:105148 MGI:2145219
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004822 - isoleucine-tRNA ligase activity [Evidence ISS] [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006428 - isoleucyl-tRNA aminoacylation [Evidence IEA] [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : isoleucyl-tRNA synthetase protein_id : NP_742012.1

name	LOC667488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264217 GeneID:667488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995941.2

name	EG638833 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264220 GeneID:638833 MGI:3646144
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995982.2

name	EG667503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395092 GeneID:667503 MGI:3643443
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996026.1

name	EG667507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395094 GeneID:667507 MGI:3645762
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996053.1

name	LOC100040099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264225 GeneID:100040099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474315.1

name	LOC667552 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94395102 GeneID:667552
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996281.1

name	LOC100040085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264223 GeneID:100040085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474109.1

name	LOC100040159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264229 GeneID:100040159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474355.1

name	Gm906 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701949 GeneID:380882 MGI:2685752
definition	GO_process : GO:0006520 - amino acid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC380882 protein_id : NP_001028610.1

name	2310081J21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395110 GeneID:69211 MGI:1916461
definition	codon_start : 1 product : hypothetical protein LOC69211 protein_id : XP_996544.1

name	Fbxw17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723092 GeneID:109082 MGI:1923584
definition	codon_start : 1 product : F-box and WD-40 domain protein 17 protein_id : NP_780610.2

name	Gm806 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701903 CCDS:CCDS26507.1 GeneID:328250 MGI:2685652
definition	codon_start : 1 product : hypothetical protein LOC328250 protein_id : NP_001028572.1

name	Gm904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702081 GeneID:380845 MGI:2685750
definition	codon_start : 1 product : hypothetical protein LOC380845 protein_id : NP_001028942.1

name	LOC100040315 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264234 GeneID:100040315
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474562.1

name	EG667693 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395127 GeneID:667693 MGI:3704126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997013.1

name	EG667712 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395133 GeneID:667712 MGI:3643286
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997087.1

name	Spin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165378 CCDS:CCDS26510.1 GeneID:20729 MGI:109242
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007143 - female meiosis [Evidence IC]; GO:0007276 - gametogenesis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; spindlin product : spindlin isoform 2 protein_id : NP_666155.1

name	Spin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755620 GeneID:20729 MGI:109242
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007143 - female meiosis [Evidence IC]; GO:0007276 - gametogenesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; spindlin product : spindlin isoform 1 protein_id : NP_035592.1

name	4930519N16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165362 CCDS:CCDS26511.1 GeneID:75124 MGI:1922374
definition	codon_start : 1 product : nucleoredoxin protein_id : NP_083449.1

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 1 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 2 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 3 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 4 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 5 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 6 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 7 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 7 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 6 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 5 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 4 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 3 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 2 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 1 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 10 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 9 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 8 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 7 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 6 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 5 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 4 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 3 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 2 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 1 pseudo : _no_value

name	LOC100040176 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040176
definition	number : 2 pseudo : _no_value

name	LOC100040176 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040176
definition	number : 1 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 7 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 6 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 5 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 4 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 3 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 2 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 1 pseudo : _no_value

name	LOC667632 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667632
definition	number : 1 pseudo : _no_value

name	EG667637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667637
definition	number : 4 pseudo : _no_value

name	EG667637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667637
definition	number : 3 pseudo : _no_value

name	EG667637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667637
definition	number : 2 pseudo : _no_value

name	EG667637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667637
definition	number : 1 pseudo : _no_value

name	EG639044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639044
definition	number : 1 pseudo : _no_value

name	EG639044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639044
definition	number : 2 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 1 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 2 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 3 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 4 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 5 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 6 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 7 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 8 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 9 pseudo : _no_value

name	LOC100040161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040161
definition	number : 10 pseudo : _no_value

name	LOC676997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676997
definition	number : 6 pseudo : _no_value

name	LOC676997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676997
definition	number : 5 pseudo : _no_value

name	LOC676997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676997
definition	number : 4 pseudo : _no_value

name	LOC676997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676997
definition	number : 3 pseudo : _no_value

name	LOC676997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676997
definition	number : 2 pseudo : _no_value

name	LOC676997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676997
definition	number : 1 pseudo : _no_value

name	LOC670357 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264218 GeneID:670357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : hypothetical LOC670357 pseudo : _no_value transcript_id : XR_031421.1

name	LOC625110 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264221 GeneID:625110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to mKIAA1897 protein pseudo : _no_value transcript_id : XR_031471.1

name	LOC100040118 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264226 GeneID:100040118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical protein LOC100040118 pseudo : _no_value transcript_id : XR_031576.1

name	LOC667625 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264227 GeneID:667625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : hypothetical LOC667625 pseudo : _no_value transcript_id : XR_035664.1

name	LOC100040190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264230 GeneID:100040190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : similar to mKIAA1897 protein pseudo : _no_value transcript_id : XR_031664.1

name	EG667717 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94395134 GeneID:667717 MGI:3643288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 5 Proteins product : predicted gene, EG667717 pseudo : _no_value transcript_id : XR_002063.1

name	EG667728 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264231 GeneID:667728 MGI:3646032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 20 Proteins product : predicted gene, EG667728 transcript_id : XR_035232.1

name	LOC667733 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264232 GeneID:667733
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 8 Proteins product : similar to cortactin pseudo : _no_value transcript_id : XR_031720.1

clone name	MSMg01-397L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-405L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-082P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-279D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-162F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-056M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055E12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426F16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458A01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-109K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-109J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-175P19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-184P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327C21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-317D11.b	B6Ng01-317D11.g
ACC	GA107418	GA107419
length	1,165	1,087
definition	B6Ng01-317D11.b	B6Ng01-317D11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(50,322,119 - 50,323,310)	(50,184,356 - 50,185,139)
sequence	gaattcagaaatctgccttcttctgccttccaagtgctgggattaaaggc ctgggccacacttcctggcaaggtagatgattcttaaaagaatctccacg aaagcaggttccataaactgagctcacatgtccaggaagccagctgttta aggattgcaggggaaatacagctgaccccaccactgaaaactggtgtttg caaaaatgcacaaaagagctcacactttcaaaaacattatctagagaaaa ttgctaactacccccatactgcccctgcaaaacccctttcccaattaatg aacattagctgcaaaactcctgctttgtgtgcaggctaaatcatctcagt cttatgtgccctgccatcttgtagcagcatatactatcctaagcatccac acgccgcacccacagaatttattaggaatcaggacctaatacacacacca ctgggggcagccagcagccaggtgtttcatcagactctcatggacacctc catatcagtaccacgtactgacatgcctccatggcacagacacagactct taacagtgtagtaaaacagtgccaggctgatggcatccaggagggcctgt tacatagcagtatatgattgatgtgctgccttgagtatgaaacatatcag gctcagcttgtcccccctgcaatccaaaaaaaaaaaaaaaagctggatat agagtattgttacagacctcacacctcacataagcatctagctatcagac cctctggtcttctacacattctgcagacactgctgatgaacagccctggt ataaccacattgcttttgaaaacactcgacaggcactgatgcttggcaag ccaaccctgagccttcactcactgataattgctgaacttcttcacagaac tatcactggactctcaaacctctagctactgaataatgacacagaaacct atatttgttatgtagcttgggccttagctgctacccccacacagcatgta taccttcataacccatttattctatcacatttctcacatgtatcatacct catgtcagtacatctgactctgcaatttctgtctaaaatcctccaactct gattcttcccagagtctctctcatcatagtcaccttcgtattcgcagatt acgcttgcagctctt	gaattcctcacttccatctcttatattctgttggtgatacttgcatatgt agtttctctttcttccctttcttcccaagctccatgattcactcagttgt ttttctttattgcttctgtttccattttcagagcttgaccaattttatgc attttttcacatgcttgattttgcttttttatatttcataattgatttat gaatttcttctctaaagacctgtatcccctttataaatttagatttaaag tcatctctttgttctttggctcttagtggataagaatgcagagagcagcc atccttgtctcactgcaaatttcaagggacatactctcagttttgctgtg tttgatataatgtaggcacaatgtctaccatataaagcctttatttcatc caacaatgttctgtcaattcagaatttgttaggaattctcatcatttaat catgttgaactatgtgtgtttatgtggctgtgtgagtatgtatgtgtgtg ggggaacacacagagtctagaagggataactggtgtccttcctgctggaa tcacaggcaattgagagctgtttgacctgggtgatagaatctgggtgtta tgcaagaacaggaagtgtaagtcgacttaaccaatgaaatatctctccag tctttttcttttttatcagacaggatttcattgtggaacattggaggact gtttggtttggaactcactatgtaaccgggatctggtcacattcacagag actggccttgtttgcatccgaactactactgatatttaaggcatgtccac cattcttgtttcctaattatttttgatatgtcatagtggattttctattt attccacattctcaagtttttttcctatatgtgtcttcaacaaatcctca ccaccaataaatcctctagatttcattcagatctgttataacatcctgtc cctatcatccctaattttgtgctctgggactctacatctttgattacttt gagtagagttttccactctatttattttccaaagaactacctatgtttag ctaaaggttatagcatctcatttagtatctatgacat
quality values	Open. Hide. 62 47 34 33 62 41 25 47 62 62 51 47 62 54 47 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 49 36 59 43 34 49 34 48 59 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 54 42 58 58 54 58 58 58 54 58 41 41 36 31 58 58 54 58 58 58 51 54 54 52 54 58 58 54 58 58 50 54 47 42 51 51 58 58 50 58 58 58 51 58 50 58 58 58 58 48 58 58 58 45 45 50 52 53 41 58 58 49 58 53 52 58 49 51 53 53 37 58 51 58 54 53 40 58 58 47 58 50 51 58 58 58 58 58 51 58 53 47 49 48 58 39 32 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 50 50 50 58 58 49 27 51 49 51 35 58 50 39 50 50 52 53 42 50 35 50 28 40 46 33 51 53 53 42 52 40 46 51 51 39 42 45 41 49 42 54 44 51 38 35 53 52 44 40 51 41 37 49 42 42 18 49 37 51 54 33 39 43 53 53 32 41 33 33 42 32 40 40 29 42 32 51 37 39 37 53 42 52 28 53 25 32 35 37 53 40 43 45 41 29 39 52 47 32 31 40 40 49 40 33 52 52 33 31 23 25 26 32 34 30 45 25 28 31 52 35 31 53 52 32 28 36 47 46 30 28 31 31 43 39 28 31 32 34 28 51 25 30 31 25 31 31 35 43 31 40 23 32 51 29 37 33 31 20 27 29 19 28 37 30 31 31 42 16 37 31 21 27 31 33 34 43 38 31 35 27 33 34 28 21 17 18 32 35 31 34 34 27 29 31 33 33 31 32 32 34 21 21 25 32 38 31 29 34 25 29 31 35 32 34 36 38 32 25 31 32 32 36 32 46 27 15 21 20 30 32 31 23 34 34 32 31 31 38 25 26 22 19 22 26 32 26 25 15 31 33 18 33 41 30 8 13 24 5 13 20 25 48 18 24 34 16 11 17 8 12 32 17 32 24 14 32 48 28 11 23 19 21 21 10 20 29 14 18 21 21 23 48 39 40 5 11 8 14 9 30 16 23 31 19 28 19 19 25 27 5 13 27 21 27 8 23 5 9 22 38 28 13 20 34 15 15 21 27 27 5 11 3 5 5 11 11 21 47 12 15 10 10 13 11 19 20 28 13 24 24 21 14 8 25 13 15 20 28 14 10 9 22 6 12 16 13 5 11 4 7 17 9 20 23 5 7 3 1 10 8 8 5 21 25 9 15 10 18 4 9 2 2 1 13 11 5 7 6 10 15 21 6 5 15 4 8 13 15 14 10 6 6 4 20 6 26 11 6 4 14 4 3 3 4 5 5 5 8 8 7 6 3 2 4 13 3 3 3 3 4 5 2 3 5 8 4 8 14 5 5 5 2 4 6 9 4 4 2 1 3 8 6 5 17 13 16 5 10 4 6 1 2	Open. Hide. 62 47 51 47 62 62 62 62 54 56 47 56 49 56 59 20 62 62 62 62 62 59 62 62 62 62 62 62 56 62 54 49 54 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 42 54 54 49 49 54 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 54 62 62 62 62 59 62 62 59 62 42 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 54 49 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 56 54 54 54 62 62 62 56 62 62 56 62 62 38 42 62 62 54 62 62 62 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 56 56 56 62 56 62 62 62 62 62 62 52 62 52 62 62 62 41 62 62 62 54 39 62 62 62 54 62 62 62 62 33 62 35 62 48 52 62 52 62 62 62 54 62 54 38 46 52 52 48 40 58 52 58 58 54 35 40 41 52 52 52 53 58 54 58 58 48 52 49 52 54 30 58 41 39 52 35 42 29 51 54 54 54 52 54 52 39 41 52 52 54 52 54 43 27 42 54 52 31 58 58 58 35 46 42 58 58 58 58 52 42 53 54 35 33 52 52 52 50 41 22 22 52 42 50 30 52 54 54 39 58 42 45 48 33 36 30 58 47 47 58 27 47 38 28 46 51 46 51 52 51 33 23 20 40 49 36 49 46 39 52 38 41 37 26 50 32 50 50 49 50 46 49 31 51 50 43 26 50 33 51 38 40 40 39 32 40 49 50 37 26 53 24 46 49 13 39 29 22 35 26 19 34 50 47 50 33 48 49 35 40 24 37 32 35 15 54 41 35 37 34 42 32 40 24 29 46 39 32 33 38 32 18 22 12 8 20 16 32 36 31 34 11 34 22 28 26 9 33 50 32 34 9 22 49 28 11 13 47 24 21 25 23 54 35 22 45 42 49 8 15 32 31 18 16 33 32 24 18 41 38 15 13 44 40 32 10 52 37 26 20 24 33 34 53 49 18 28 31 40 51 25 25 20 38 7 30 28 40 21 31 22 37 54 54 46 54 53 14 13 28 16 37 16 32 23 29 18 28 37 27 32 13 26 13 31 26 31 32 22 39 45 31 30 31 31 26 31 23 29 32 20 33 12 18 23 11 20 32 41 32 34 35 27 8 27 25 47 21 24 19 17 15 9 9 6 33 24 30 18 45 29 12 12 32 35 31 28 22 33 9 14 11 33 32 23 41 7 11 9 21 18 19 18 19 9 23 21 18 17 35 33 51 20 17 22 11 6 6 14 6 38 30 22 34 26 22 26 9 7 16 18 20 14 12 18 28 16 13 12 10 13 12 12 25 21 21 37 12 9 18 10 18 18 9 9 29 25 11 7 17 6 10 41 24 10 6 46 30 21 22 31 21 8 17 19 27 31 30 7 16 21 19 31 32 8 6 10 6 30 31 29 23 6 7 6 12 26 20 31 8 5 5 6 27 31 11 9 31 11 15 24 8 15 8 9 9 20 9 8 8 4 5 7 10 8 13 17 10 17 14 16 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_50322119_50323310
seq2: B6Ng01-317D11.b_49_1213 (reverse)

seq1  AAGAGCTGCAAGCCTATATCTGTGCAGAATACAGAAGGTGGAACTTATGG  50
      ||||||||||||| || |||||    |||||| |||||||  || |||  
seq2  AAGAGCTGCAAGCGTA-ATCTG---CGAATAC-GAAGGTG--AC-TAT--  40

seq1  GATGAGAGAGGAACTCTGGGAAGAAATCAGAGGTGGGAGGGATTTTCCAG  100
      ||||||||||  ||||||||||| |||||||| |||   |||||||  ||
seq2  GATGAGAGAG--ACTCTGGGAAG-AATCAGAGTTGG--AGGATTTT--AG  83

seq1  ACAGAAA-TGCAGGAAGTCAGATGTACTGAACATGAGGTTATGATACATG  149
      ||||||| |||||  |||||||||||||| |||||||| |||||||||||
seq2  ACAGAAATTGCAG--AGTCAGATGTACTG-ACATGAGG-TATGATACATG  129

seq1  TGAGAAATGTGAATTAGAATAAATGGGTTAATGAAGTTATACATGCTTGT  199
      ||||||||||||  ||||||||||||||| |||||| ||||||||| |||
seq2  TGAGAAATGTGA--TAGAATAAATGGGTT-ATGAAGGTATACATGC-TGT  175

seq1  TGTGGGGTAGCAAGCTAAGGCCCAAGCTACAATAAACAAATATAAGTTTC  249
         |||||||| |||||||||||||||||||   |||||||||| |||||
seq2  GTGGGGGTAGC-AGCTAAGGCCCAAGCTACA--TAACAAATATAGGTTTC  222

seq1  TGTGTCATTATTCAGTAGCTAGAGGTTTGAGAGTCCAGTGATAGTTCTGT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCATTATTCAGTAGCTAGAGGTTTGAGAGTCCAGTGATAGTTCTGT  272

seq1  GAAGAAGTTCAGCAATTATCAGTGAGTGAAGGCTCAGGGTTGGCTTGCCA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAGTTCAGCAATTATCAGTGAGTGAAGGCTCAGGGTTGGCTTGCCA  322

seq1  AGCATCAGTGCCTGTCGAGTGTTTTCAAAAGCAATGTGGTTATACCAGGG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATCAGTGCCTGTCGAGTGTTTTCAAAAGCAATGTGGTTATACCAGGG  372

seq1  CTGTTCATCAGCAGTGTCTGCAGAATGTGTAGAAGACCAGAGGGTCTGAT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTCATCAGCAGTGTCTGCAGAATGTGTAGAAGACCAGAGGGTCTGAT  422

seq1  AGCTAGATGCTTATGTGAGGTGTGAGGTCTGTAACAATACTCTATATCCA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAGATGCTTATGTGAGGTGTGAGGTCTGTAACAATACTCTATATCCA  472

seq1  GCTTTTTTTTTTTTTTTTGGATTGCAGGGGGGACAAGCTGAGCCTGATAT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTTTTTTTTTTTTTTGGATTGCAGGGGGGACAAGCTGAGCCTGATAT  522

seq1  GTTTCATACTCAAGGCAGCACATCAATCATATACTGCTATGTAACAGGCC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCATACTCAAGGCAGCACATCAATCATATACTGCTATGTAACAGGCC  572

seq1  CTCCTGGATGCCATCAGCCTGGCACTGTTTTACTACACTGTTAAGAGTCT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGGATGCCATCAGCCTGGCACTGTTTTACTACACTGTTAAGAGTCT  622

seq1  GTGTCTGTGCCATGGAGGCATGTCAGTACGTGGTACTGATATGGAGGTGT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTGTGCCATGGAGGCATGTCAGTACGTGGTACTGATATGGAGGTGT  672

seq1  CCATGAGAGTCTGATGAAACACCTGGCTGCTGGCTGCCCCCAGTGGTGTG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGAGAGTCTGATGAAACACCTGGCTGCTGGCTGCCCCCAGTGGTGTG  722

seq1  TGTATTAGGTCCTGATTCCTAATAAATTCTGTGGGTGCGGCGTGTGGATG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTAGGTCCTGATTCCTAATAAATTCTGTGGGTGCGGCGTGTGGATG  772

seq1  CTTAGGATAGTATATGCTGCTACAAGATGGCAGGGCACATAAGACTGAGA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGGATAGTATATGCTGCTACAAGATGGCAGGGCACATAAGACTGAGA  822

seq1  TGATTTAGCCTGCACACAAAGCAGGAGTTTTGCAGCTAATGTTCATTAAT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTAGCCTGCACACAAAGCAGGAGTTTTGCAGCTAATGTTCATTAAT  872

seq1  TGGGAAAGGGGTTTTGCAGGGGCAGTATGGGGGTAGTTAGCAATTTTCTC  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAAAGGGGTTTTGCAGGGGCAGTATGGGGGTAGTTAGCAATTTTCTC  922

seq1  TAGATAATGTTTTTGAAAGTGTGAGCTCTTTTGTGCATTTTTGCAAACAC  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATAATGTTTTTGAAAGTGTGAGCTCTTTTGTGCATTTTTGCAAACAC  972

seq1  CAGTTTTCAGTGGTGGGGTCAGCTGTATTTCCCCTGCAATCCTTAAACAG  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTTTCAGTGGTGGGGTCAGCTGTATTTCCCCTGCAATCCTTAAACAG  1022

seq1  CTGGCTTCCTGGACATGTGAGCTCAGTTTATGGAACCTGCTTTCGTGGAG  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTTCCTGGACATGTGAGCTCAGTTTATGGAACCTGCTTTCGTGGAG  1072

seq1  ATTCTTTTAAGAATCATCTACCTTGCCAGGAAGTGTGGCCCAGGCCTTTA  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTTTTAAGAATCATCTACCTTGCCAGGAAGTGTGGCCCAGGCCTTTA  1122

seq1  ATCCCAGCACTTGGAAGGCAGAAGAAGGCAGATTTCTGAATTC  1192
      |||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCAGCACTTGGAAGGCAGAAGAAGGCAGATTTCTGAATTC  1165

seq1: chr13_50184356_50185139
seq2: B6Ng01-317D11.g_368_1151

seq1  CTTGTCTCACTGCAAATTTCAAGGGACATACTCTCAGTTTTGCTGTGTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTCTCACTGCAAATTTCAAGGGACATACTCTCAGTTTTGCTGTGTTT  50

seq1  GATATAATGTAGGCACAATGTCTACCATATAAAGCCTTTATTTCATCCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATAATGTAGGCACAATGTCTACCATATAAAGCCTTTATTTCATCCAA  100

seq1  CAATGTTCTGTCAATTCAGAATTTGTTAGGAATTCTCATCATTTAATCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGTTCTGTCAATTCAGAATTTGTTAGGAATTCTCATCATTTAATCAT  150

seq1  GTTGAACTATGTGTGTTTATGTGGCTGTGTGAGTATGTATGTGTGTGGGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGAACTATGTGTGTTTATGTGGCTGTGTGAGTATGTATGTGTGTGGGG  200

seq1  GAACACACAGAGTCTAGAAGGGATAACTGGTGTCCTTCCTGCTGGAATCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACACACAGAGTCTAGAAGGGATAACTGGTGTCCTTCCTGCTGGAATCA  250

seq1  CAGGCAATTGAGAGCTGTTTGACCTGGGTGATAGAATCTGGGTGTTATGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCAATTGAGAGCTGTTTGACCTGGGTGATAGAATCTGGGTGTTATGC  300

seq1  AAGAACAGGAAGTGTAAGTCGACTTAACCAATGAAATATCTCTCCAGTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACAGGAAGTGTAAGTCGACTTAACCAATGAAATATCTCTCCAGTCT  350

seq1  TTTTCTTTTTTATCAGACAGGATTTCATTGTGGAACATTGGAGGACTGTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTTTTTTATCAGACAGGATTTCATTGTGGAACATTGGAGGACTGTT  400

seq1  TGGTTTGGAACTCACTATGTAACCGGGATCTGGTCACATTCACAGAGACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTTGGAACTCACTATGTAACCGGGATCTGGTCACATTCACAGAGACT  450

seq1  GGCCTTGTTTGCATCCGAACTACTACTGATATTTAAGGCATGTTCCACCA  500
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GGCCTTGTTTGCATCCGAACTACTACTGATATTTAAGGCATG-TCCACCA  499

seq1  TTCTTGTTTCCTAATTA-TTTTGATATGTCATAGTGGATTTTCTATTTAT  549
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  TTCTTGTTTCCTAATTATTTTTGATATGTCATAGTGGATTTTCTATTTAT  549

seq1  TCCACATTCTCAAGTTTTTTTCCTATATGTGTCTTCAACAAATCCTCACC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACATTCTCAAGTTTTTTTCCTATATGTGTCTTCAACAAATCCTCACC  599

seq1  ACCAAT-AATCCTCTAGATTTCA-TCAGAATCTGTTATAACAT-CTGT-C  645
      |||||| |||||||||||||||| |||| |||||||||||||| |||| |
seq2  ACCAATAAATCCTCTAGATTTCATTCAG-ATCTGTTATAACATCCTGTCC  648

seq1  CTATCATCTCTAATTTTGTTGTCTGGGACTCTACATCTTTGATTACTTTG  695
      |||||||| ||||||||||  |||||||||||||||||||||||||||||
seq2  CTATCATCCCTAATTTTGTGCTCTGGGACTCTACATCTTTGATTACTTTG  698

seq1  AGTAGGAGGTTTTCAATCCTATTTATTTTCCAAAGAACTAACTATTGTTT  745
      |||||   |||||| |  |||||||||||||||||||||| ||| |||||
seq2  AGTAG--AGTTTTCCACTCTATTTATTTTCCAAAGAACTACCTA-TGTTT  745

seq1  AGCTTAATGTTTATAGTAT-TCATTTAGTATCTATTACAT  784
      ||| ||| | |||||| || ||||||||||||||| ||||
seq2  AGC-TAAAGGTTATAGCATCTCATTTAGTATCTATGACAT  784

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information