MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-320I24
Chromosome	13 (Build37)
Map Location	61,963,366 - 61,964,544
singlet/doublet	singlet
Overlap gene	EG638502
Upstream gene	4930486L24Rik, Tpbpb, Ctla2a, Tpbpa, Ctsj, Ctsq, Ctsr, Cts6, Cts8, Cts8-ps, LOC435362, Cts7, Cts7-ps, EG624056, LOC665717, Ctsm, Cts3, EG665401, LOC624140, EG623505, LOC665415, LOC673332, BC052688
Downstream gene	LOC100041382, EG633250, EG624180, LOC100041420, LOC665444, EG630579, EG630594, LOC665455, LOC100041430, LOC100041962, LOC100041437, LOC100041979, LOC100041986, 8430426H19Rik, LOC100041455, 6720457D02Rik, EG665503, LOC100041493, LOC630857, EG630978, EG435366, LOC380850, LOC630951, Fbp2
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930486L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214639 MGI:1922258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpbpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116913 MGI:2151721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctla2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13024 MGI:88554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpbpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21984 MGI:98795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26898 MGI:1349426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104002 MGI:2137385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56835 MGI:1861723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58518 MGI:1889619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56094 MGI:1860275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts8-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116911 MGI:2151708
definition	gene_synonym : Cts2-ps note : cathepsin 8, pseudogene pseudo : _no_value

name	LOC435362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cts7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56092 MGI:1860262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116909 MGI:2151716
definition	gene_synonym : Cts1; Cts1-ps note : cathepsin 7, pseudogene pseudo : _no_value

name	EG624056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624056 MGI:3643776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	LOC665717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 39 ESTs, 7 Proteins pseudo : _no_value

name	Ctsm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64139 MGI:1927229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cts3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117066 MGI:2151929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665401 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665401 MGI:3647115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs, 6 Proteins pseudo : _no_value

name	LOC624140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	EG623505 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623505 MGI:3644667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 95 ESTs, 5 Proteins

name	LOC665415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 82 ESTs, 1 Protein pseudo : _no_value

name	LOC673332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC052688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432812 MGI:3583898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 48 ESTs

name	EG638502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638502 MGI:3643235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG633250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633250 MGI:3649075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	EG624180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624180 MGI:3647766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 93 ESTs, 7 Proteins

name	LOC100041420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	LOC665444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 2 Proteins pseudo : _no_value

name	EG630579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630579 MGI:3704127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630594 MGI:3649149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 75 ESTs, 5 Proteins pseudo : _no_value

name	LOC665455 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 41 ESTs pseudo : _no_value

name	LOC100041430 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100041962 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs

name	LOC100041437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041979 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	LOC100041986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs

name	8430426H19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71508 MGI:1918758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041455 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	6720457D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77117 MGI:1924367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665503 MGI:3645656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 101 ESTs, 7 Proteins

name	LOC100041493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC630857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG630978 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630978 MGI:3646616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG435366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435366 MGI:3645613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC380850 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC630951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 75 ESTs, 19 Proteins pseudo : _no_value

name	Fbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14120 MGI:95491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930486L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342510 GeneID:214639 MGI:1922258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930486L24 gene transcript_id : NM_178098.2

name	Tpbpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345208 GeneID:116913 MGI:2151721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophoblast specific protein beta transcript_id : NM_026429.2

name	Ctla2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681076 GeneID:13024 MGI:88554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytotoxic T lymphocyte-associated protein 2 alpha transcript_id : NM_007796.1

name	Tpbpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386437 GeneID:21984 MGI:98795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophoblast specific protein alpha transcript_id : NM_009411.3

name	Ctsj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7770061 GeneID:26898 MGI:1349426
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin J transcript_id : NM_012007.1

name	Ctsq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892435 GeneID:104002 MGI:2137385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin Q transcript_id : NM_029636.3

name	Ctsr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9931985 GeneID:56835 MGI:1861723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin R transcript_id : NM_020284.1

name	Cts6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946819 GeneID:58518 MGI:1889619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 6 transcript_id : NM_021445.1

name	Cts8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358367 GeneID:56094 MGI:1860275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 8 transcript_id : NM_019541.2

name	Cts7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130674 GeneID:56092 MGI:1860262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 7 transcript_id : NM_019539.3

name	EG624056 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63642993 GeneID:624056 MGI:3643776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : predicted gene, EG624056 transcript_id : XM_621334.1

name	Ctsm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981228 GeneID:64139 MGI:1927229
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin M transcript_id : NM_022326.2

name	Cts3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19424143 GeneID:117066 MGI:2151929
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin 3 transcript_id : NM_026906.2

name	EG623505 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395163 GeneID:623505 MGI:3644667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 95 ESTs, 5 Proteins product : predicted gene, EG623505 transcript_id : XM_887972.2

name	LOC673332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264255 GeneID:673332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CDNA sequence BC012278 transcript_id : XM_001476261.1

name	BC052688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395164 GeneID:432812 MGI:3583898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs product : cDNA sequence BC052688, transcript variant 1 transcript_id : XM_888474.2

name	EG633250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264257 GeneID:633250 MGI:3649075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : predicted gene, EG633250 transcript_id : XM_976926.2

name	EG624180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395177 GeneID:624180 MGI:3647766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 93 ESTs, 5 Proteins product : predicted gene, EG624180, transcript variant 1 transcript_id : XM_892559.2

name	EG624180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395178 GeneID:624180 MGI:3647766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 78 ESTs, 4 Proteins product : predicted gene, EG624180, transcript variant 2 transcript_id : XM_900173.2

name	EG630579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815831 GeneID:630579 MGI:3704127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG630579 transcript_id : NM_001039239.2

name	LOC100041430 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264260 GeneID:100041430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001476372.1

name	LOC100041962 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264283 GeneID:100041962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs product : similar to gag protein transcript_id : XM_001477652.1

name	LOC100041979 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264286 GeneID:100041979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to crooked legs CG14938-PB transcript_id : XM_001477671.1

name	LOC100041986 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264288 GeneID:100041986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs product : similar to 6720457D02Rik protein transcript_id : XM_001477695.1

name	8430426H19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665715 GeneID:71508 MGI:1918758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430426H19 gene transcript_id : NM_178875.3

name	6720457D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354343 GeneID:77117 MGI:1924367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6720457D02 gene transcript_id : NM_175252.3

name	EG665503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264290 GeneID:665503 MGI:3645656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 101 ESTs, 5 Proteins product : predicted gene, EG665503, transcript variant 2 transcript_id : XM_981603.2

name	EG665503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264291 GeneID:665503 MGI:3645656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 86 ESTs, 4 Proteins product : predicted gene, EG665503, transcript variant 1 transcript_id : XM_981561.2

name	EG435366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215552 GeneID:435366 MGI:3645613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG435366 transcript_id : NM_001013825.2

name	LOC380850 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264292 GeneID:380850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC380850 transcript_id : XM_001477745.1

name	Fbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371961 GeneID:14120 MGI:95491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fructose bisphosphatase 2 transcript_id : NM_007994.3

name	Tpbpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385926 GeneID:116913 MGI:2151721
definition	codon_start : 1 product : trophoblast specific protein beta protein_id : NP_080705.1

name	Ctla2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681077 GeneID:13024 MGI:88554
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cytotoxic T lymphocyte-associated protein 2 alpha protein_id : NP_031822.1

name	Tpbpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560633 GeneID:21984 MGI:98795
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : clone 4311 product : trophoblast specific protein alpha protein_id : NP_033437.2

name	Ctsj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7770062 GeneID:26898 MGI:1349426
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : cathepsin P; rat gene/Cathepsin L-related protein; Cat P product : cathepsin J protein_id : NP_036137.1

name	Ctsq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532972 CCDS:CCDS26584.1 GeneID:104002 MGI:2137385
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : cathepsin Q protein_id : NP_083912.2

name	Ctsr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9931986 CCDS:CCDS26585.1 GeneID:56835 MGI:1861723
definition	GO_component : GO:0005764 - lysosome [Evidence ISS] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : lysosomal cysteine protease product : cathepsin R protein_id : NP_064680.1

name	Cts6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946820 CCDS:CCDS26586.1 GeneID:58518 MGI:1889619
definition	codon_start : 1 product : cathepsin 6 protein_id : NP_067420.1

name	Cts8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358368 CCDS:CCDS26587.1 GeneID:56094 MGI:1860275
definition	GO_function : GO:0004217 - cathepsin L activity [Evidence ISS] codon_start : 1 exception : mismatches in translation note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 68 product : cathepsin 8 protein_id : NP_062414.2

name	Cts7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956098 CCDS:CCDS26588.1 GeneID:56092 MGI:1860262
definition	GO_function : GO:0004217 - cathepsin L activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 24 product : cathepsin 7 protein_id : NP_062412.1

name	EG624056 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63642994 GeneID:624056 MGI:3643776
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621334.1

name	Ctsm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981229 GeneID:64139 MGI:1927229
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : Cat M product : cathepsin M protein_id : NP_071721.2

name	Cts3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424144 GeneID:117066 MGI:2151929
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin 3 precursor protein_id : NP_081182.2

name	EG623505 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952669 GeneID:623505 MGI:3644667
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_893065.1

name	LOC673332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264256 GeneID:673332
definition	codon_start : 1 product : similar to CDNA sequence BC012278 protein_id : XP_001476311.1

name	BC052688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952763 GeneID:432812 MGI:3583898
definition	codon_start : 1 product : similar to RIKEN cDNA 8430426H19 gene isoform 1 protein_id : XP_893567.1

name	EG633250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264258 GeneID:633250 MGI:3649075
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982020.2

name	EG624180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950648 GeneID:624180 MGI:3647766
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 1 protein_id : XP_897652.1

name	EG624180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950650 GeneID:624180 MGI:3647766
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 2 protein_id : XP_905266.1

name	EG630579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815832 GeneID:630579 MGI:3704127
definition	codon_start : 1 product : hypothetical protein LOC630579 protein_id : NP_001034328.2

name	LOC100041430 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264261 GeneID:100041430
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476422.1

name	LOC100041962 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264284 GeneID:100041962
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001477702.1

name	LOC100041979 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264287 GeneID:100041979
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477721.1

name	LOC100041986 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264289 GeneID:100041986
definition	codon_start : 1 product : similar to 6720457D02Rik protein protein_id : XP_001477745.1

name	8430426H19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665716 GeneID:71508 MGI:1918758
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB zinc finger protein product : hypothetical protein LOC71508 protein_id : NP_849206.2

name	6720457D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424892 GeneID:77117 MGI:1924367
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC77117 protein_id : NP_780461.1

name	EG665503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395189 GeneID:665503 MGI:3645656
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 1 protein_id : XP_986655.1

name	EG665503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395187 GeneID:665503 MGI:3645656
definition	codon_start : 1 product : similar to RIKEN cDNA 4933434E20 gene isoform 2 protein_id : XP_986697.1

name	EG435366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126215553 GeneID:435366 MGI:3645613
definition	codon_start : 1 product : hypothetical protein LOC435366 protein_id : NP_001013847.2

name	LOC380850 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264293 GeneID:380850
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477795.1

name	Fbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937183 GeneID:14120 MGI:95491
definition	EC_number : 3.1.3.11 GO_function : GO:0042132 - fructose-bisphosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0042578 - phosphoric ester hydrolase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence IEA] codon_start : 1 note : FBPase muscle; D-fructose-1,6-bisphosphate 1-phosphohydrolase 2; fructose-1,6-bisphosphatase isozyme 2; FBPase 2 product : fructose bisphosphatase 2 protein_id : NP_032020.2

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 8 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 7 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 6 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 5 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 4 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 3 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 2 pseudo : _no_value

name	LOC435362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435362
definition	number : 1 pseudo : _no_value

name	EG638502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638502
definition	number : 1 pseudo : _no_value

name	EG638502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638502
definition	number : 2 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 1 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 2 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 3 pseudo : _no_value

name	LOC100041382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041382
definition	number : 4 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 4 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 3 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 2 pseudo : _no_value

name	LOC100041455 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041455
definition	number : 1 pseudo : _no_value

name	LOC100041493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041493
definition	number : 6 pseudo : _no_value

name	LOC100041493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041493
definition	number : 5 pseudo : _no_value

name	LOC100041493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041493
definition	number : 4 pseudo : _no_value

name	LOC100041493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041493
definition	number : 3 pseudo : _no_value

name	LOC100041493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041493
definition	number : 2 pseudo : _no_value

name	LOC100041493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041493
definition	number : 1 pseudo : _no_value

name	LOC630857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630857
definition	number : 2 pseudo : _no_value

name	LOC630857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630857
definition	number : 1 pseudo : _no_value

name	EG630978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630978
definition	number : 6 pseudo : _no_value

name	EG630978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630978
definition	number : 5 pseudo : _no_value

name	EG630978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630978
definition	number : 4 pseudo : _no_value

name	EG630978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630978
definition	number : 3 pseudo : _no_value

name	EG630978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630978
definition	number : 2 pseudo : _no_value

name	EG630978 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630978
definition	number : 1 pseudo : _no_value

name	LOC665717 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264273 GeneID:665717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 39 ESTs, 7 Proteins product : similar to protein-tyrosine-phosphatase pseudo : _no_value transcript_id : XR_001777.2

name	EG665401 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264274 GeneID:665401 MGI:3647115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs, 6 Proteins product : predicted gene, EG665401 pseudo : _no_value transcript_id : XR_033251.1

name	LOC624140 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264254 GeneID:624140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to Proteasome subunit alpha type 2 (Proteasome component C3) (Macropain subunit C3) (Multicatalytic endopeptidase complex subunit C3) pseudo : _no_value transcript_id : XR_032627.1

name	LOC665415 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264276 GeneID:665415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 82 ESTs, 1 Protein product : similar to RIKEN cDNA 4933434E20 gene pseudo : _no_value transcript_id : XR_033259.1

name	LOC100041420 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264259 GeneID:100041420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to crooked legs CG14938-PB pseudo : _no_value transcript_id : XR_032690.1

name	LOC665444 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264277 GeneID:665444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 2 Proteins product : similar to RIKEN cDNA 8430426H19 gene pseudo : _no_value transcript_id : XR_033290.1

name	EG630594 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264281 GeneID:630594 MGI:3649149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 75 ESTs, 5 Proteins product : predicted gene, EG630594 pseudo : _no_value transcript_id : XR_001823.2

name	LOC665455 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264282 GeneID:665455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 41 ESTs product : similar to Proteasome subunit alpha type 2 (Proteasome component C3) (Macropain subunit C3) (Multicatalytic endopeptidase complex subunit C3) pseudo : _no_value transcript_id : XR_033329.1

name	LOC100041437 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264263 GeneID:100041437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins product : similar to high mobility group nucleosomal binding domain 2 pseudo : _no_value transcript_id : XR_032711.1

name	LOC630951 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264266 GeneID:630951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 75 ESTs, 19 Proteins product : similar to Mod1 protein pseudo : _no_value transcript_id : XR_032791.1

clone name	MSMg01-532N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-275G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382I13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-530O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-064N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435P07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339K13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361O23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393E12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301F16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114H21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-320I24.b	B6Ng01-320I24.g
ACC	GA109899	GA109900
length	1,201	1,153
definition	B6Ng01-320I24.b	B6Ng01-320I24.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcataaaagaagacactgaagagagaaactgtgtgtgaataatgtg gtaaggcctttgcagttgacattgacattgatctcatcatgtataaatta acacagacttgtaagaaacctcataaaaataaggaatgtggtaaaagctt gtgtttaaaaccagtcgttttttttttttttcttgagaaaaatccatgct gcaggttaaccctgtaaatggagccactgtggaaacattttgtatgtcac agtatctgtatgcgagagtaaaacatttagcatgtactggatcactttaa gtttgcatgtcacaataatctttcaggactttaaagaactcaaaaataag gtagtctatgactctgatggacatggttccatcttgtgccaacctagtta cattaatttacacattattcattcttgagaaaacctttagcaaatgtcaa ctatctgctcaagcatgatgatgtctctattttgttcatacatggaaact cataaggacaataatgaaccctgtgaggttcattgataaggtaactgatt taaaattcacagtttactttaagtccgtgaaataactcgttcagttgtga aacactgttggtgagtataagtgccttttctgttgttgtgataaaatgtc taaggtattgtagaaaactgaagtaccaaacgaaggtttccaccccagcc ttggccatttcttttccaggtaaaacacacacaacgtttatttttttttt ttttgagtatctttattatcttgattgttacatttatttttttttccatt tttattaggtatttagctcattcacattttccgatgctataccaaaagtc ccccatacccacccactccccctctttggccctgggcgttcccctatact ggggcataataaagtttgcaagtcacacaacacaacgtttatattttcta ataaaccttaatcaacactcgatattgggtcctattcctctaatgcttat cttgtctattttccaggccagtaaatttggtcatattattttgctttatt tcttctgggtttatgctaactccattattttaatgtgagctactttaaag gctgctttttcctctgtctactttccttctcctgggggatctcccactgg aattccaagtccaggattgctgattccctgtccattgtgtctgttcctgc c	gaattccacataaaaccagacacactgaaacctatagaggagaaagtggg aaagagccttgaagatatgggcatcgggcaagaattcctgaacagaacag caatgtcttctgctctaagatcaagaatcaacaaatgggacctcataaaa ttgcaaagcttctgtaaggcaaaggacactatcaataagaccaaaaagca accaagagattgggaaaagatctttaccaatcctaaatccaacacagggc taatatccaatatatacaaagaactcaataagtaagactccagaaaacca aataacactattaaaaaatggggtacagagataaacaaagaatactgagt ggctgagaaaaacctaaaaaaatattcaacacccttaatcatcatggaaa tgcaaatcaaaacaaccttgagattccatctcataccagtcagaataccc aagataaaaaacacaggtgacagtagatgctggtgaggatgtggagaaag agaaacacttctcaattgctggtgggattgaaagctggtacaaccactct agatatcactttggcagttcttcagaaaattggacatagtactactggaa gatcatgcaataccactcctgggcatatacccagaatatgctccaacttg taataagaacacaggctccactatgttcatagcagccttatttataatag ccagaagctgaaaagaaccaggatgtccctcaacagaggaatggatacag aaaatgtggtacatttacagaatggaatacacagctattaaaaacaagaa attatgaaattgttagacaaatggactgatctggaggatattatcctgag tgaggtaacccaatgacaaaagcacacacatgctatgcactcactgataa gtggatattagcccagaagttcagaatacccaagatttaatttgcaaaac acatgaaactcaagagacaaagacccaaagtgtgatacttcgatccttat tagaagggtaaaatgcccatgagatacaagacatattcagagcagaactg agatgaccatccagagcctaccactggggatccattccgcaacacatcat accgaaccatattgcgagttaccaagtgttttgtcctgaacagggagagc ccg
quality values	Open. Hide. 58 29 26 29 58 35 25 58 54 58 62 62 62 62 62 62 47 42 62 54 62 49 47 62 62 62 62 62 62 62 62 51 47 50 38 32 56 46 45 62 62 49 62 62 62 62 59 59 62 62 54 62 62 62 62 59 62 62 62 49 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 56 56 48 48 48 48 34 56 56 50 62 62 62 56 59 56 54 54 49 49 54 62 59 59 62 56 59 62 62 62 62 62 54 59 59 59 62 62 59 62 59 62 50 59 59 49 59 50 54 31 46 51 62 62 62 62 59 62 62 56 56 56 50 50 59 56 56 51 51 59 59 49 43 50 50 50 50 56 48 56 59 56 56 34 56 34 43 38 43 59 62 62 62 59 59 62 62 62 62 50 56 59 59 62 51 51 59 59 62 56 59 62 59 56 59 62 62 62 62 62 56 62 62 62 62 59 59 62 54 56 59 56 59 59 59 59 56 56 56 56 56 59 62 59 49 56 62 59 59 62 59 62 51 51 50 43 59 56 51 59 59 56 56 62 62 54 62 62 62 59 62 59 59 56 59 59 59 59 59 59 59 51 56 50 56 50 59 56 62 59 62 59 59 62 62 62 56 62 62 56 43 51 56 45 50 59 51 59 59 62 59 62 62 62 62 62 44 62 62 62 62 59 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 56 56 56 56 56 50 56 46 25 56 56 56 62 62 56 56 56 62 62 56 62 56 56 62 56 62 56 56 56 56 56 56 56 56 56 56 56 56 56 56 56 56 62 56 56 56 62 62 56 56 47 54 62 56 56 56 56 56 56 62 62 62 62 62 62 62 62 43 62 62 62 52 62 62 62 62 62 62 62 54 54 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 54 54 54 52 54 44 44 45 54 58 54 54 54 54 58 58 58 54 54 54 58 58 49 52 54 44 54 54 54 54 58 58 54 54 58 58 54 54 58 58 50 58 54 54 52 52 41 54 54 54 54 45 58 58 54 52 54 54 50 50 51 54 54 53 50 48 48 49 51 49 49 54 58 49 49 50 58 58 54 52 54 58 58 58 48 52 47 58 58 52 54 58 41 42 50 54 50 50 49 40 49 58 50 50 49 40 44 48 43 58 51 53 53 51 47 58 51 47 58 49 37 58 58 37 48 58 58 51 38 49 51 51 52 51 54 39 49 40 40 39 58 58 40 58 35 41 27 41 41 30 50 50 58 50 32 52 32 39 44 33 44 49 50 27 54 41 35 54 32 50 39 32 47 27 38 54 54 44 32 32 41 44 41 31 47 38 31 44 32 49 54 42 36 40 54 54 34 30 34 29 34 54 29 28 54 54 39 37 40 45 40 40 30 47 37 53 45 37 46 54 33 42 34 54 54 54 49 49 54 49 54 54 39 39 46 46 29 42 39 32 32 36 45 47 33 32 33 36 33 25 33 41 33 14 32 31 40 15 14 14 25 30 36 33 32 51 32 34 27 49 49 47 51 52 53 51 33 31 29 28 31 46 46 46 32 24 16 30 45 17 38 30 31 26 51 27 33 26 33 33 31 31 24 29 31 21 31 26 33 45 51 24 17 51 25 38 22 31 29 36 32 31 31 15 13 16 46 46 42 32 38 17 33 32 40 27 18 29 29 31 40 30 20 29 46 30 19 31 15 25 40 40 40 33 23 21 21 46 29 31 31 12 40 27 20 32 39 10 7 21 22 30 20 41 41 28 26 29 25 32 28 22 43 46 48 31 19 22 19 7 9 16 27 39 28 10 14 46 22 34 28 28 32 31 31 19 14 9 7 17 15 18 13 9 6 11 25 17 15 28 44 21 10 5 7 17 43 44 10 10 18 14 13 12 16 38 18 5 5 22 9 12 10 27 17 26 8 11 16 21 32 35 28 34 11 5 9 31 18 44 23 16 18 11 10 7 5 12 18 32 9 4 7 9 12 8 21 7 6 6 9 21 21 9 30 30 7 7 5 14 10 37 39 9 22 19 10 12 8 30 20 24 18 9 32 36 11 28 40 31 7 23 17 21 6 5 4 4 7 23 25 48 48 19 32 27 20 40 18 14 9 34 19 22 17 16 19 12 28 34 17 13 21 8 9 7 11 15 6 3 5 11 7 14 18 10 15 12 18 8 30 10 13 6 6 15 4 4 3 15 10 26 16 18 4 6 29 9 16 22 6 21 15 14 10 13 19 18 47 21 22 10 12 4 9 5 7 13 16 16 6 6 8 10 27 7 7 4 11 7 10 8 10 16 11 7 5 8 5 3 1 3 3 6 8 11 10 5 9 4 3 7 6 16 10 10 13 21 7 14 4 5 7 23 5 8 4 2 4 3 1 5 2 1 3 3 5 11 17 17 3 10 4 5 5 3 4 5 7 4 5 12 12 4 13 5 5 5 8 5 2 3 2	Open. Hide. 62 47 43 41 62 62 47 33 62 47 51 42 42 38 34 50 44 32 41 44 62 62 62 62 62 59 59 35 49 62 62 62 43 62 62 62 62 43 62 62 49 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 54 62 59 59 62 59 59 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 45 54 58 45 39 58 58 58 58 58 52 58 58 58 54 58 53 58 58 54 54 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 58 58 45 35 58 58 58 58 58 54 58 58 58 58 58 49 58 54 58 58 58 54 58 58 58 54 58 50 49 48 51 58 58 51 58 58 58 47 46 44 49 58 51 58 58 58 58 58 50 54 50 58 58 58 43 49 58 58 54 49 50 49 58 54 50 49 49 44 51 50 58 58 58 58 58 51 52 41 31 50 51 58 58 58 49 58 58 51 54 44 43 58 58 58 58 51 58 58 58 49 51 54 50 54 50 46 43 43 50 53 58 51 52 52 49 58 51 51 51 37 32 50 50 54 51 53 50 50 54 50 43 44 41 58 51 40 52 54 53 39 54 50 54 39 44 40 47 38 49 49 54 52 47 39 42 53 52 44 49 53 42 52 51 44 41 52 47 54 42 42 50 34 54 50 51 42 44 44 31 47 54 53 31 51 52 51 54 36 36 51 38 54 41 31 44 35 32 44 35 37 54 41 32 46 47 53 40 33 34 46 38 30 35 17 40 28 31 32 47 40 27 32 32 52 29 32 53 53 52 25 30 53 32 46 47 32 31 34 35 53 49 51 31 52 31 45 51 34 31 51 37 42 35 45 31 31 28 41 31 37 43 45 25 42 31 30 51 51 46 46 33 31 38 33 51 51 31 31 42 30 30 30 45 51 31 28 41 24 14 23 31 31 42 27 35 46 21 27 33 41 29 26 30 31 29 37 30 31 36 31 29 24 30 31 20 28 34 37 31 38 18 28 30 37 37 24 31 32 31 31 41 20 24 28 21 32 15 13 27 27 31 31 27 30 46 48 37 31 31 26 31 31 35 31 32 24 34 36 36 31 24 21 33 31 31 31 42 34 32 33 26 29 28 25 25 26 31 26 31 31 17 8 12 19 32 32 27 37 44 38 33 31 36 31 19 24 24 16 31 22 29 18 22 19 25 37 9 7 24 23 20 17 47 31 21 23 16 47 26 11 25 32 48 48 32 24 10 7 11 32 19 22 43 19 25 32 19 16 15 16 17 4 6 5 10 47 25 9 17 8 28 6 15 20 10 21 20 27 11 3 3 5 24 27 9 18 17 16 28 28 11 17 17 9 28 17 21 18 20 24 21 22 40 22 13 20 47 47 14 8 28 20 28 18 8 14 4 5 5 3 3 2 8 11 17 11 13 7 22 11 12 12 25 20 8 10 23 9 18 5 5 2 5 11 11 8 14 3 3 5 11 22 8 17 12 22 8 14 10 8 19 5 13 9 7 7 24 15 5 3 2 11 17 17 18 7 13 7 14 8 7 6 10 8 9 4 25 15 8 8 3 3 6 14 3 2 1 7 12 4 5 11 9 14 4 11 5 6 11 6 7 3 5 5 2 3 15 5 4 7 22 11 4 11 4 6 29 9 10 6 14 7 6 7 15 9 12 3 2 2 1 1 2 4 1 3 3 5 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_61963366_61964544
seq2: B6Ng01-320I24.b_47_1247

seq1  GAATTCATAAAAGAAGACACTGAAGAGAGAAACTGTGTGTGAATAATGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATAAAAGAAGACACTGAAGAGAGAAACTGTGTGTGAATAATGTG  50

seq1  GTAAGGCCTTTGCAGTTGACATTGACATTGATCTCATCATGTATAAATTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGGCCTTTGCAGTTGACATTGACATTGATCTCATCATGTATAAATTA  100

seq1  ACACAGACTTGTAAGAAACCTCATAAAAATAAGGAATGTGGTAAAAGCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGACTTGTAAGAAACCTCATAAAAATAAGGAATGTGGTAAAAGCTT  150

seq1  GTGTTTAAAACCAGTCGTTTTTTTTTTTTTTCTTGAGAAAAATCCATGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTTAAAACCAGTCGTTTTTTTTTTTTTTCTTGAGAAAAATCCATGCT  200

seq1  GCAGGTTAACCCTGTAAATGGAGCCACTGTGGAAACATTTTGTATGTCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGTTAACCCTGTAAATGGAGCCACTGTGGAAACATTTTGTATGTCAC  250

seq1  AGTATCTGTATGCGAGAGTAAAACATTTAGCATGTACTGGATCACTTTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATCTGTATGCGAGAGTAAAACATTTAGCATGTACTGGATCACTTTAA  300

seq1  GTTTGCATGTCACAATAATCTTTCAGGACTTTAAAGAACTCAAAAATAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGCATGTCACAATAATCTTTCAGGACTTTAAAGAACTCAAAAATAAG  350

seq1  GTAGTCTATGACTCTGATGGACATGGTTCCATCTTGTGCCAACCTAGTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGTCTATGACTCTGATGGACATGGTTCCATCTTGTGCCAACCTAGTTA  400

seq1  CATTAATTTACACATTATTCATTCTTGAGAAAACCTTTAGCAAATGTCAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAATTTACACATTATTCATTCTTGAGAAAACCTTTAGCAAATGTCAA  450

seq1  CTATCTGCTCAAGCATGATGATGTCTCTATTTTGTTCATACATGGAAACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTGCTCAAGCATGATGATGTCTCTATTTTGTTCATACATGGAAACT  500

seq1  CATAAGGACAATAATGAACCCTGTGAGGTTCATTGATAAGGTAACTGATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAAGGACAATAATGAACCCTGTGAGGTTCATTGATAAGGTAACTGATT  550

seq1  TAAAATTCACAGTTTACTTTAAGTCCGTGAAATAACTCGTTCAGTTGTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATTCACAGTTTACTTTAAGTCCGTGAAATAACTCGTTCAGTTGTGA  600

seq1  AACACTGTTGGTGAGTATAAGTGCCTTTTCTGTTGTTGTGATAAAATGTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACTGTTGGTGAGTATAAGTGCCTTTTCTGTTGTTGTGATAAAATGTC  650

seq1  TAAGGTATTGTAGAAAACTGAAGTACCAAACGAAGGTTTCCACCCCAGCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGTATTGTAGAAAACTGAAGTACCAAACGAAGGTTTCCACCCCAGCC  700

seq1  TTGGCCATTTCTTTTCCAGGTAAAACACACACAACGTTTATTTTTTTTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCCATTTCTTTTCCAGGTAAAACACACACAACGTTTATTTTTTTTTT  750

seq1  TTTTGAGTATCTTTATTATCTTGATTGTTACATTTA-TTTTTTTTCCATT  799
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TTTTGAGTATCTTTATTATCTTGATTGTTACATTTATTTTTTTTTCCATT  800

seq1  TTTATTAGGTATTTAGCTCATTCACA-TTTCCGATGCTATACCAAAAGTC  848
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  TTTATTAGGTATTTAGCTCATTCACATTTTCCGATGCTATACCAAAAGTC  850

seq1  CCCCATACCCACCCACTCCCCCTCTTTGGCCCT-GGCGTTCCCCTATACT  897
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CCCCATACCCACCCACTCCCCCTCTTTGGCCCTGGGCGTTCCCCTATACT  900

seq1  GGGGCAT-ATAAAGTTTGCAAGTCACACAACACAACGTTTATA-TTTCTA  945
      ||||||| ||||||||||||||||||||||||||||||||||| ||||||
seq2  GGGGCATAATAAAGTTTGCAAGTCACACAACACAACGTTTATATTTTCTA  950

seq1  ATAAACCTTAATCAACACTCGATATTGG--TCTA-TCCTCT-ATGC-TAT  990
      ||||||||||||||||||||||||||||   ||| |||||| |||| |||
seq2  ATAAACCTTAATCAACACTCGATATTGGGTCCTATTCCTCTAATGCTTAT  1000

seq1  CTTGTCTATTTCCCA-GCCAGT-AATTTTGTCATATTATTTTGCTTTATT  1038
      ||||||||||| ||| |||||| ||||| |||||||||||||||||||||
seq2  CTTGTCTATTTTCCAGGCCAGTAAATTTGGTCATATTATTTTGCTTTATT  1050

seq1  TCTTCT-GGTTTATGCTTAACTCCATTATTTTATTGTTGAGCTAACTT-A  1086
      |||||| ||||||||| |||||||||||||||| || |||||||  || |
seq2  TCTTCTGGGTTTATGC-TAACTCCATTATTTTAATG-TGAGCTACTTTAA  1098

seq1  AGGCTGCTTTTT-CTCTGTCTACTTT-CTTCTCCTTGTGGTTCT-CCACT  1133
      |||||||||||| ||||||||||||| |||||||| | || ||| |||||
seq2  AGGCTGCTTTTTCCTCTGTCTACTTTCCTTCTCCTGGGGGATCTCCCACT  1148

seq1  G--ATCCCAAGTCCAGTATCCCT-AATCCCTGTC---TATGTCTGTT-CT  1176
      |  || |||||||||| ||  || | ||||||||   | |||||||| ||
seq2  GGAATTCCAAGTCCAGGATTGCTGATTCCCTGTCCATTGTGTCTGTTCCT  1198

seq1  GCC  1179
      |||
seq2  GCC  1201

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information