MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-321L24
Chromosome	13 (Build37)
Map Location	22,682,105 - 22,683,201
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Olfr1362, Olfr1363-ps1, Olfr11, Olfr1361, Olfr1360, Olfr1359, Hist1h2bl, Hist1h2ai, Hist1h3h, Hist1h2aj, Hist1h2bm, Hist1h4j, Hist1h4k, Hist1h2ak, Hist1h2bn, LOC100041150, Hist1h1b, Hist1h3i, Hist1h2an, Hist1h2bp, LOC665596, Rp23-480b19.10, LOC100041230, Hist1h4m, Hist1h2ao, LOC665622, LOC665634, Zfp184, Gm24, Prss16, Hist1h2ah, Hist1h2bk, Hist1h4i, Hist1h2ag, Hist1h2bj, LOC665690, V1rh17, V1rh2, V1ri8, LOC632534, V1ri1, V1ri9, OTTMUSG00000000480, V1ri6, LOC665726, V1rh21, V1ri3, V1rh4, V1rh3, V1rh1, LOC665749, V1ri4, V1ri7, V1rh11, OTTMUSG00000000494
Downstream gene	V1rh8, V1rh7, LOC382740, LOC432735, V1rh9, OTTMUSG00000000514, V1rh10, V1rh20, V1rh18, V1rh6, V1rh5, V1ri2, V1ri10, V1rh14, LOC100040639, V1ri5, V1rh13, V1rh12, V1rh16, OTTMUSG00000000541, Zfp322a, Abt1, Btn1a1, Btn2a2, Hist1h4h, Hist1h2af, Hist1h3g, Hist1h2bh, Hist1h3f, Hist1h4f, Hist1h1d, Hist1h3e, Hist1h2ae, Hist1h2bg, Hist1h2bf, Hist1h2ad, Hist1h3d, Hist1h4d, Hist1h2be
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1362 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258739 MGI:3031196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1363-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404503 MGI:3031197
definition	note : olfactory receptor 1363, pseudogene 1 pseudo : _no_value

name	Olfr11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218066 MGI:104715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258534 MGI:3031195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258536 MGI:3031194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258067 MGI:3031193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319185 MGI:2448403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ai (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319191 MGI:2448457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319152 MGI:2448349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2aj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319174 MGI:2448312
definition	gene_synonym : H2a-291b note : histone cluster 1, H2aj pseudo : _no_value

name	Hist1h2bm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319186 MGI:2448404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4j (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319159 MGI:2448436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319160 MGI:2448439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319169 MGI:2448297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319187 MGI:2448407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs

name	Hist1h1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56702 MGI:1861461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319153 MGI:2448350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2an (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319170 MGI:2448300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319188 MGI:2448409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rp23-480b19.10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 mRNAs, 176 ESTs, 54 Proteins

name	LOC100041230 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 12 ESTs, 12 Proteins

name	Hist1h4m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319161 MGI:2448441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ao (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319171 MGI:2448302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665622 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 9 Proteins pseudo : _no_value

name	LOC665634 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	Zfp184 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193452 MGI:1922244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195236 MGI:2684870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 2 Proteins

name	Prss16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54373 MGI:1859181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319168 MGI:2448295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319184 MGI:2448399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319158 MGI:2448432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319167 MGI:2448293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319183 MGI:2448388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665690 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	V1rh17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252912 MGI:2182259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252906 MGI:2182257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252908 MGI:2182261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	V1ri1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252907 MGI:2182260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171259 MGI:2159695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626299 MGI:3651596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171257 MGI:2159692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	V1rh21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171278 MGI:2159686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171254 MGI:2159689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171247 MGI:2159662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171246 MGI:2159660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171245 MGI:2159658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1ri4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171255 MGI:2159690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171258 MGI:2159693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171270 MGI:2159674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000494 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632793 MGI:3651399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171251 MGI:2159667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171250 MGI:2159665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC432735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	V1rh9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171252 MGI:2159668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000514 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432736 MGI:3650395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171269 MGI:2159673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171277 MGI:2159685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171275 MGI:2159683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171249 MGI:2159664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171248 MGI:2159663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171253 MGI:2159687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ri10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171279 MGI:2159696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171273 MGI:2159677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1ri5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171256 MGI:2159691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171272 MGI:2159676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171271 MGI:2159675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rh16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171274 MGI:2159679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100036518 MGI:3649245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp322a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218100 MGI:2442566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30946 MGI:1353636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btn1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12231 MGI:103118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btn2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238555 MGI:3606486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69386 MGI:2448427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2af (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319173 MGI:2448309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97908 MGI:2145541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319182 MGI:2448387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260423 MGI:2448329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319157 MGI:2448425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14957 MGI:107502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319151 MGI:2448326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319166 MGI:2448290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319181 MGI:2448386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2bf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319180 MGI:2448383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2ad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319165 MGI:2448289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319149 MGI:2448322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319156 MGI:2448423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hist1h2be (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319179 MGI:2448380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1362 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129356 GeneID:258739 MGI:3031196
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1362 transcript_id : NM_146744.1

name	Olfr11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575921 GeneID:218066 MGI:104715
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 11 transcript_id : NM_146542.1

name	Olfr1361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983491 GeneID:258534 MGI:3031195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1361 transcript_id : NM_146541.2

name	Olfr1360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203784 GeneID:258536 MGI:3031194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1360 transcript_id : NM_146543.1

name	Olfr1359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801403 GeneID:258067 MGI:3031193
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1359 transcript_id : NM_001011820.1

name	Hist1h2bl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061388 GeneID:319185 MGI:2448403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bl transcript_id : NM_178199.1

name	Hist1h2ai (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061392 GeneID:319191 MGI:2448457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ai transcript_id : NM_178182.1

name	Hist1h3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991705 GeneID:319152 MGI:2448349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3h transcript_id : NM_178206.2

name	Hist1h2bm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061384 GeneID:319186 MGI:2448404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bm transcript_id : NM_178200.1

name	Hist1h4j (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061350 GeneID:319159 MGI:2448436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4j transcript_id : NM_178210.1

name	Hist1h4k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061358 GeneID:319160 MGI:2448439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4k transcript_id : NM_178211.1

name	Hist1h2ak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061370 GeneID:319169 MGI:2448297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ak transcript_id : NM_178183.1

name	Hist1h2bn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061394 GeneID:319187 MGI:2448407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bn transcript_id : NM_178201.1

name	LOC100041150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263928 GeneID:100041150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs product : similar to gag protein transcript_id : XM_001475956.1

name	Hist1h1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426892 GeneID:56702 MGI:1861461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1b transcript_id : NM_020034.1

name	Hist1h3i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991704 GeneID:319153 MGI:2448350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3i transcript_id : NM_178207.2

name	Hist1h2an (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061364 GeneID:319170 MGI:2448300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2an transcript_id : NM_178184.1

name	Hist1h2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061390 GeneID:319188 MGI:2448409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bp transcript_id : NM_178202.1

name	LOC665596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263867 GeneID:665596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2b histone family, member A transcript_id : XM_798035.2

name	Rp23-480b19.10 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263930 GeneID:665433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 mRNAs, 176 ESTs, 54 Proteins product : similar to histone 2a, transcript variant 2 transcript_id : XM_978341.2

name	LOC100041230 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263931 GeneID:100041230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 12 ESTs, 12 Proteins product : similar to histone H4 transcript_id : XM_001476063.1

name	Hist1h4m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089707 GeneID:319161 MGI:2448441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4m transcript_id : NM_175657.1

name	Hist1h2ao (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061374 GeneID:319171 MGI:2448302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ao transcript_id : NM_178185.1

name	Zfp184 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942077 GeneID:193452 MGI:1922244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 184 (Kruppel-like) transcript_id : NM_183014.1

name	Prss16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893216 GeneID:54373 MGI:1859181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 16 (thymus) transcript_id : NM_019429.2

name	Hist1h2ah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061326 GeneID:319168 MGI:2448295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ah transcript_id : NM_175659.1

name	Hist1h2bk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089703 GeneID:319184 MGI:2448399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bk transcript_id : NM_175665.1

name	Hist1h4i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972651 GeneID:319158 MGI:2448432
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4i transcript_id : NM_175656.2

name	Hist1h2ag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972648 GeneID:319167 MGI:2448293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ag transcript_id : NM_178186.2

name	Hist1h2bj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061380 GeneID:319183 MGI:2448388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bj transcript_id : NM_178198.1

name	V1rh17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095332 GeneID:252912 MGI:2182259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H17 transcript_id : NM_145850.1

name	V1rh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238867 GeneID:252906 MGI:2182257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H2 transcript_id : NM_145844.1

name	V1ri8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003895 GeneID:252908 MGI:2182261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I8 transcript_id : NM_145846.1

name	V1ri1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003901 GeneID:252907 MGI:2182260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I1 transcript_id : NM_145845.1

name	V1ri9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717766 GeneID:171259 MGI:2159695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I9 transcript_id : NM_134225.1

name	OTTMUSG00000000480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430497 GeneID:626299 MGI:3651596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000480 transcript_id : NM_001080972.1

name	V1ri6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717762 GeneID:171257 MGI:2159692
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I6 transcript_id : NM_134223.1

name	V1rh21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58866044 GeneID:171278 MGI:2159686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H21 transcript_id : NM_134244.1

name	V1ri3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717748 GeneID:171254 MGI:2159689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I3 transcript_id : NM_134220.1

name	V1rh4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717746 GeneID:171247 MGI:2159662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H4 transcript_id : NM_134213.1

name	V1rh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717736 GeneID:171246 MGI:2159660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H3 transcript_id : NM_134212.1

name	V1rh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263868 GeneID:171245 MGI:2159658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H1 transcript_id : XM_001471795.1

name	V1ri4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717758 GeneID:171255 MGI:2159690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I4 transcript_id : NM_134221.1

name	V1ri7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717756 GeneID:171258 MGI:2159693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I7 transcript_id : NM_134224.1

name	V1rh11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955267 GeneID:171270 MGI:2159674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H11 transcript_id : NM_134236.1

name	OTTMUSG00000000494 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865926 GeneID:632793 MGI:3651399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000494 transcript_id : NM_001045544.1

name	V1rh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717750 GeneID:171251 MGI:2159667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H8 transcript_id : NM_134217.1

name	V1rh7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717740 GeneID:171250 MGI:2159665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H7 transcript_id : NM_134216.1

name	LOC432735 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263909 GeneID:432735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to vomeronasal receptor V1RH7 transcript_id : XM_001474932.1

name	V1rh9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717744 GeneID:171252 MGI:2159668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H9 transcript_id : NM_134218.1

name	OTTMUSG00000000514 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000661 GeneID:432736 MGI:3650395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000514 transcript_id : NM_001013787.1

name	V1rh10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717786 GeneID:171269 MGI:2159673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H10 transcript_id : NM_134235.1

name	V1rh20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717794 GeneID:171277 MGI:2159685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H20 transcript_id : NM_134243.1

name	V1rh18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717784 GeneID:171275 MGI:2159683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H18 transcript_id : NM_134241.1

name	V1rh6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372163 GeneID:171249 MGI:2159664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H6 transcript_id : NM_134215.1

name	V1rh5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955273 GeneID:171248 MGI:2159663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H5 transcript_id : NM_134214.1

name	V1ri2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717754 GeneID:171253 MGI:2159687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I2 transcript_id : NM_134219.1

name	V1ri10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717788 GeneID:171279 MGI:2159696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I10 transcript_id : NM_134245.1

name	V1rh14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717780 GeneID:171273 MGI:2159677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H14 transcript_id : NM_134239.1

name	V1ri5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717752 GeneID:171256 MGI:2159691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, I5 transcript_id : NM_134222.1

name	V1rh13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955265 GeneID:171272 MGI:2159676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H13 transcript_id : NM_134238.1

name	V1rh12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21955269 GeneID:171271 MGI:2159675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H12 transcript_id : NM_134237.1

name	V1rh16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717790 GeneID:171274 MGI:2159679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, H16 transcript_id : NM_134240.1

name	OTTMUSG00000000541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032006 GeneID:100036518 MGI:3649245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000541 transcript_id : NM_001083311.1

name	Zfp322a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982559 GeneID:218100 MGI:2442566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 322a transcript_id : NM_172586.2

name	Abt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352609 GeneID:30946 MGI:1353636
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activator of basal transcription transcript_id : NM_013924.2

name	Btn1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253943 GeneID:12231 MGI:103118
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin, subfamily 1, member A1 transcript_id : NM_013483.2

name	Btn2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953892 GeneID:238555 MGI:3606486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin, subfamily 2, member A2 transcript_id : NM_175938.3

name	Hist1h4h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802886 GeneID:69386 MGI:2448427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4h transcript_id : NM_153173.2

name	Hist1h2af (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061378 GeneID:319173 MGI:2448309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2af transcript_id : NM_175661.1

name	Hist1h3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75991703 GeneID:97908 MGI:2145541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3g transcript_id : NM_145073.2

name	Hist1h2bh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061386 GeneID:319182 MGI:2448387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bh transcript_id : NM_178197.1

name	Hist1h3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30102949 GeneID:260423 MGI:2448329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3f transcript_id : NM_013548.2

name	Hist1h4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061354 GeneID:319157 MGI:2448425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4f transcript_id : NM_175655.1

name	Hist1h1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328364 GeneID:14957 MGI:107502
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H1d transcript_id : NM_145713.2

name	Hist1h3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061340 GeneID:319151 MGI:2448326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3e transcript_id : NM_178205.1

name	Hist1h2ae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803099 GeneID:319166 MGI:2448290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ae transcript_id : NM_178187.3

name	Hist1h2bg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254304 GeneID:319181 MGI:2448386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bg transcript_id : NM_178196.2

name	Hist1h2bf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061382 GeneID:319180 MGI:2448383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2bf transcript_id : NM_178195.1

name	Hist1h2ad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972409 GeneID:319165 MGI:2448289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2ad transcript_id : NM_178188.3

name	Hist1h3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30061336 GeneID:319149 MGI:2448322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H3d transcript_id : NM_178204.1

name	Hist1h4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30089713 GeneID:319156 MGI:2448423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H4d transcript_id : NM_175654.1

name	Hist1h2be (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377782 GeneID:319179 MGI:2448380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cluster 1, H2be transcript_id : NM_178194.3

name	Olfr1362 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129357 CCDS:CCDS26282.1 GeneID:258739 MGI:3031196
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QHY8-11617756-11618682; olfactory receptor MOR256-8 product : olfactory receptor 1362 protein_id : NP_666955.1

name	Olfr11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575922 CCDS:CCDS26283.1 GeneID:218066 MGI:104715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2QHY8-11597382-11598323 product : olfactory receptor 11 protein_id : NP_666753.1

name	Olfr1361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238962 CCDS:CCDS26284.1 GeneID:258534 MGI:3031195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-11577590-11578528; olfactory receptor MOR256-12 product : olfactory receptor 1361 protein_id : NP_666752.1

name	Olfr1360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203785 GeneID:258536 MGI:3031194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2QHY8-11561962-11562903; olfactory receptor MOR256-10 product : olfactory receptor 1360 protein_id : NP_666754.1

name	Olfr1359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801404 CCDS:CCDS26286.1 GeneID:258067 MGI:3031193
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QHY8-11534186-11533245; olfactory receptor MOR256-35 product : olfactory receptor 1359 protein_id : NP_001011820.1

name	Hist1h2bl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061389 CCDS:CCDS26287.1 GeneID:319185 MGI:2448403
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bl protein_id : NP_835506.1

name	Hist1h2ai (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061393 CCDS:CCDS26288.1 GeneID:319191 MGI:2448457
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 2, H2ai product : histone 1, H2ai protein_id : NP_835489.1

name	Hist1h3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061343 CCDS:CCDS26289.1 GeneID:319152 MGI:2448349
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3h protein_id : NP_835513.1

name	Hist1h2bm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061385 CCDS:CCDS26290.1 GeneID:319186 MGI:2448404
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence ISS] [Evidence IEA] codon_start : 1 product : histone 1, H2bm protein_id : NP_835507.1

name	Hist1h4j (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061351 CCDS:CCDS26291.1 GeneID:319159 MGI:2448436
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 4 protein product : histone 1, H4j protein_id : NP_835582.1

name	Hist1h4k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061359 CCDS:CCDS26292.1 GeneID:319160 MGI:2448439
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4k protein_id : NP_835583.1

name	Hist1h2ak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061371 CCDS:CCDS26293.1 GeneID:319169 MGI:2448297
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ak protein_id : NP_835490.1

name	Hist1h2bn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061395 CCDS:CCDS26294.1 GeneID:319187 MGI:2448407
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bn protein_id : NP_835508.1

name	LOC100041150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263929 GeneID:100041150
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001476006.1

name	Hist1h1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426893 CCDS:CCDS26295.1 GeneID:56702 MGI:1861461
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007517 - muscle development [Evidence IPI]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone 1, family 5; H1 histone family, member 5 product : histone 1, H1b protein_id : NP_064418.1

name	Hist1h3i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061345 CCDS:CCDS26296.1 GeneID:319153 MGI:2448350
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3i protein_id : NP_835514.1

name	Hist1h2an (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061365 CCDS:CCDS26297.1 GeneID:319170 MGI:2448300
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2an protein_id : NP_835491.1

name	Hist1h2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061391 CCDS:CCDS26298.1 GeneID:319188 MGI:2448409
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bp protein_id : NP_835509.1

name	Rp23-480b19.10 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94394730 GeneID:665433
definition	codon_start : 1 product : similar to Chain K, 2.9 Angstrom X-Ray Structure Of Hybrid Macroh2a Nucleosomes isoform 2 protein_id : XP_983435.1

name	LOC100041230 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263932 GeneID:100041230
definition	codon_start : 1 product : similar to histone H4 protein_id : XP_001476113.1

name	Hist1h4m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089708 CCDS:CCDS26300.1 GeneID:319161 MGI:2448441
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4m protein_id : NP_783588.1

name	Hist1h2ao (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061375 CCDS:CCDS26301.1 GeneID:319171 MGI:2448302
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ao protein_id : NP_835492.1

name	Zfp184 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942078 CCDS:CCDS26302.1 GeneID:193452 MGI:1922244
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Zinc finger protein 184 (Kruppel-like) protein_id : NP_898835.1

name	Prss16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506995 CCDS:CCDS26303.1 GeneID:54373 MGI:1859181
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : protease, serine, 16 (thymus) protein_id : NP_062302.1

name	Hist1h2ah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061327 CCDS:CCDS26304.1 GeneID:319168 MGI:2448295
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ah protein_id : NP_783590.1

name	Hist1h2bk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089704 CCDS:CCDS26305.1 GeneID:319184 MGI:2448399
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bk protein_id : NP_783596.1

name	Hist1h4i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430493 CCDS:CCDS26306.1 GeneID:319158 MGI:2448432
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4i protein_id : NP_783587.1

name	Hist1h2ag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061361 CCDS:CCDS26307.1 GeneID:319167 MGI:2448293
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ag protein_id : NP_835493.1

name	Hist1h2bj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061381 CCDS:CCDS26308.1 GeneID:319183 MGI:2448388
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bj protein_id : NP_835505.1

name	V1rh17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095333 CCDS:CCDS26309.1 GeneID:252912 MGI:2182259
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H17 protein_id : NP_665849.1

name	V1rh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238868 CCDS:CCDS26310.1 GeneID:252906 MGI:2182257
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H2 protein_id : NP_665843.1

name	V1ri8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003896 GeneID:252908 MGI:2182261
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I8 protein_id : NP_665845.1

name	V1ri1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003902 CCDS:CCDS26311.1 GeneID:252907 MGI:2182260
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I1 protein_id : NP_665844.1

name	V1ri9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717767 CCDS:CCDS26312.1 GeneID:171259 MGI:2159695
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I9 protein_id : NP_598986.1

name	OTTMUSG00000000480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430498 GeneID:626299 MGI:3651596
definition	codon_start : 1 product : similar to vomeronasal 1 receptor, I4 protein_id : NP_001074441.1

name	V1ri6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717763 CCDS:CCDS26314.1 GeneID:171257 MGI:2159692
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, I6 protein_id : NP_598984.1

name	V1rh21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58866045 CCDS:CCDS26315.1 GeneID:171278 MGI:2159686
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H21 protein_id : NP_599005.1

name	V1ri3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717749 CCDS:CCDS26316.1 GeneID:171254 MGI:2159689
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I3 protein_id : NP_598981.1

name	V1rh4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717747 CCDS:CCDS26317.1 GeneID:171247 MGI:2159662
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H4 protein_id : NP_598974.1

name	V1rh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717737 CCDS:CCDS26318.1 GeneID:171246 MGI:2159660
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H3 protein_id : NP_598973.1

name	V1rh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263869 GeneID:171245 MGI:2159658
definition	codon_start : 1 product : vomeronasal 1 receptor, H1 protein_id : XP_001471845.1

name	V1ri4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717759 CCDS:CCDS26319.1 GeneID:171255 MGI:2159690
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I4 protein_id : NP_598982.1

name	V1ri7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717757 CCDS:CCDS26320.1 GeneID:171258 MGI:2159693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I7 protein_id : NP_598985.1

name	V1rh11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955268 CCDS:CCDS26321.1 GeneID:171270 MGI:2159674
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H11 protein_id : NP_598997.1

name	OTTMUSG00000000494 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865927 GeneID:632793 MGI:3651399
definition	codon_start : 1 product : hypothetical protein LOC632793 protein_id : NP_001039009.1

name	V1rh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717751 CCDS:CCDS26322.1 GeneID:171251 MGI:2159667
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H8 protein_id : NP_598978.1

name	V1rh7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717741 CCDS:CCDS26323.1 GeneID:171250 MGI:2159665
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H7 protein_id : NP_598977.1

name	LOC432735 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263910 GeneID:432735
definition	codon_start : 1 product : similar to vomeronasal receptor V1RH7 protein_id : XP_001474982.1

name	V1rh9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717745 GeneID:171252 MGI:2159668
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H9 protein_id : NP_598979.1

name	OTTMUSG00000000514 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000662 GeneID:432736 MGI:3650395
definition	codon_start : 1 product : hypothetical protein LOC432736 protein_id : NP_001013809.1

name	V1rh10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717787 CCDS:CCDS26325.1 GeneID:171269 MGI:2159673
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H10 protein_id : NP_598996.1

name	V1rh20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717795 CCDS:CCDS26326.1 GeneID:171277 MGI:2159685
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H20 protein_id : NP_599004.1

name	V1rh18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717785 CCDS:CCDS26327.1 GeneID:171275 MGI:2159683
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H18 protein_id : NP_599002.1

name	V1rh6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372164 CCDS:CCDS26328.1 GeneID:171249 MGI:2159664
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H6 protein_id : NP_598976.1

name	V1rh5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955274 CCDS:CCDS26329.1 GeneID:171248 MGI:2159663
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H5 protein_id : NP_598975.1

name	V1ri2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717755 CCDS:CCDS26330.1 GeneID:171253 MGI:2159687
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I2 protein_id : NP_598980.1

name	V1ri10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717789 CCDS:CCDS26331.1 GeneID:171279 MGI:2159696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I10 protein_id : NP_599006.1

name	V1rh14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717781 CCDS:CCDS26332.1 GeneID:171273 MGI:2159677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H14 protein_id : NP_599000.1

name	V1ri5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717753 CCDS:CCDS26333.1 GeneID:171256 MGI:2159691
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, I5 protein_id : NP_598983.1

name	V1rh13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955266 CCDS:CCDS26334.1 GeneID:171272 MGI:2159676
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H13 protein_id : NP_598999.1

name	V1rh12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21955270 CCDS:CCDS26335.1 GeneID:171271 MGI:2159675
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H12 protein_id : NP_598998.1

name	V1rh16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717791 CCDS:CCDS26336.1 GeneID:171274 MGI:2159679
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, H16 protein_id : NP_599001.1

name	OTTMUSG00000000541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032007 GeneID:100036518 MGI:3649245
definition	codon_start : 1 note : vomeronasal 1 receptor I (V1ri) family member product : predicted gene, OTTMUSG00000000541 protein_id : NP_001076780.1

name	Zfp322a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369830 CCDS:CCDS26337.1 GeneID:218100 MGI:2442566
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 322a protein_id : NP_766174.1

name	Abt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468953 CCDS:CCDS26338.1 GeneID:30946 MGI:1353636
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016251 - general RNA polymerase II transcription factor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : activator of basal transcription protein_id : NP_038952.1

name	Btn1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304935 CCDS:CCDS26339.1 GeneID:12231 MGI:103118
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : butyrophilin, subfamily 1, member A1 protein_id : NP_038511.1

name	Btn2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953893 GeneID:238555 MGI:3606486
definition	codon_start : 1 product : butyrophilin 2 protein_id : NP_787952.2

name	Hist1h4h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943922 CCDS:CCDS26340.1 GeneID:69386 MGI:2448427
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence ISS] [Evidence IEA] codon_start : 1 note : H4 histone family, member A product : histone 1, H4h protein_id : NP_694813.1

name	Hist1h2af (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061379 CCDS:CCDS26341.1 GeneID:319173 MGI:2448309
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : histone H2a (aa 92-128) product : histone 1, H2af protein_id : NP_783592.1

name	Hist1h3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489955 CCDS:CCDS26342.1 GeneID:97908 MGI:2145541
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H3g protein_id : NP_659539.1

name	Hist1h2bh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061387 CCDS:CCDS26343.1 GeneID:319182 MGI:2448387
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bh protein_id : NP_835504.1

name	Hist1h3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305139 CCDS:CCDS26344.1 GeneID:260423 MGI:2448329
definition	codon_start : 1 note : histone H3; histone gene complex 1 product : histone 1, H3f protein_id : NP_038576.1

name	Hist1h4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061355 CCDS:CCDS26345.1 GeneID:319157 MGI:2448425
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4f protein_id : NP_783586.1

name	Hist1h1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328365 CCDS:CCDS26346.1 GeneID:14957 MGI:107502
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0016584 - nucleosome spacing [Evidence IMP] codon_start : 1 exception : mismatches in translation note : histone 1, family 3; H1 histone family, member 3 product : histone 1, H1d protein_id : NP_663759.2

name	Hist1h3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061341 CCDS:CCDS26347.1 GeneID:319151 MGI:2448326
definition	codon_start : 1 product : histone 1, H3e protein_id : NP_835512.1

name	Hist1h2ae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061367 CCDS:CCDS26348.1 GeneID:319166 MGI:2448290
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ae protein_id : NP_835494.1

name	Hist1h2bg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061377 CCDS:CCDS26349.1 GeneID:319181 MGI:2448386
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bg protein_id : NP_835503.1

name	Hist1h2bf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061383 CCDS:CCDS26350.1 GeneID:319180 MGI:2448383
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2bf protein_id : NP_835502.1

name	Hist1h2ad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061357 CCDS:CCDS26351.1 GeneID:319165 MGI:2448289
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2ad protein_id : NP_835495.1

name	Hist1h3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30061337 CCDS:CCDS26352.1 GeneID:319149 MGI:2448322
definition	codon_start : 1 product : histone1, H3d protein_id : NP_835511.1

name	Hist1h4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089714 CCDS:CCDS26353.1 GeneID:319156 MGI:2448423
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H4d protein_id : NP_783585.1

name	Hist1h2be (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089706 CCDS:CCDS26354.1 GeneID:319179 MGI:2448380
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : histone 1, H2be protein_id : NP_835501.1

name	LOC632534 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632534
definition	number : 1 pseudo : _no_value

name	LOC665749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665749
definition	number : 1 pseudo : _no_value

name	LOC665749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665749
definition	number : 2 pseudo : _no_value

name	LOC665749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665749
definition	number : 3 pseudo : _no_value

name	LOC100040639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040639
definition	number : 1 pseudo : _no_value

name	LOC100040639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040639
definition	number : 2 pseudo : _no_value

name	LOC100040639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040639
definition	number : 3 pseudo : _no_value

name	LOC665622 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:133506694 GeneID:665622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 9 Proteins product : histone pseudogene pseudo : _no_value transcript_id : NR_003375.1

name	LOC665634 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263907 GeneID:665634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : hypothetical LOC665634 pseudo : _no_value transcript_id : XR_031906.1

name	Gm24 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263935 GeneID:195236 MGI:2684870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 2 Proteins product : gene model 24, (NCBI) transcript_id : XR_035300.1

name	LOC665690 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263936 GeneID:665690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to ribosomal protein L37a pseudo : _no_value transcript_id : XR_032696.1

name	LOC665726 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263939 GeneID:665726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to fatty acyl elongase pseudo : _no_value transcript_id : XR_032761.1

name	LOC382740 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94394739 GeneID:382740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to ribosomal protein L5 pseudo : _no_value transcript_id : XR_001787.1

clone name	MSMg01-486C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108G20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143L23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-143C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134L03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-260E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-425P21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-215G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-328N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-060I18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-381F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-279C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491O15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317O18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-521A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-215G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-489H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-321L24.b	B6Ng01-321L24.g
ACC	GA110775	GA110776
length	1,095	1,183
definition	B6Ng01-321L24.b	B6Ng01-321L24.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagtcaatagaagccaaatgtactagtcacagaacttgaatggcc cggatcacttcattggcattatatttgtgaaaattctttgcagttataaa gactagatatatgaaataaattagataacaaatacacagtacagtcttac attatactcaactgtagttactatgttgatttaaaagtgtgcatttgtct ttttcaaaataagtcaatgactacaattaaggccaagcaagcatgctttg tagctgccctttgttactgctcaggtgctctccatagctccgtgcagctc tgtagcaccaaggagcactgagaggatctgactctacatatatttaaatg aaaatttgctgcttatgtacttaaattggatacatacagtaagatagtga catgtttctaagaatctgatggacacattctgaaaaatacttatagttat aaatattgactgtgaaatggttgaatgattagaggtatgttttaccttat ttgaaacaatttttctgtcacttttgactggaaacactagaagtttcatg gctctactttacaatgatgagcacaatttataatttgcttggtggcacta tatacacaaatcaattcaagtaactggtgtgtactgtattgtgctacaga ttattaaatagcttattttctaattatatttatatgtatgtgtctgtgtg agtatatgtcacatttgtgtccttacaggcctgaggagagcatttggtct ccaggaactagagctacaagctgtcatgcatcctatgatgtgggtgtagg gtaaaggaaccagagtcctctgcaagacaagcaagtctcatcatcattcc cacatgaccttgtctgatgtaaatgtgacttgtccctaggtaacatccac tgcttctctttgtctcataactcttctgttagaccttttcttctagtacc tgtcacaaggaccagacacagacaaaccaagcacctgctaaatcagtcta tataagttgattcacagaagtgatgtaaaaacatggagatggagttgaga aagatgtgtttaatctgagtgatggaaaagttgttcagcatagga	gaattctcatctgaggaataccaaagggctgagaagcacgtgcaaaaatg ttcaacatccttaatcatcagggaaatgcaaaataaaacaaccttgaggt tccacctcacaccaatcagaatggctaggatcaaaaattcatgtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgctggtg ggattgcaagcttgtacaaccactgtggaattcagtctggtggttcctca gaaaagtgggcatagtactaccggtagatccagcaatacctctcctgggt atatacccagaagatgttccaacatgtaataaggacacatgctccactat gttcatagcagccctatttataatagccagaagctggaaagaacccagat gtccctcaacaaaggaatgggtacagaaaatgtggtacatttacacaatg gagtactactcagctattaaaaacaatggatttatgaaattcttgggcaa atggatgtatctgaaggatataatcctgagtgaggtaacccaatcacaaa ataagtcacttgatatgcactcagtgatcagtggatattgatccagaaac ctagaatatccaagatacaacttccaaaacacaagaaaatcaagaaggaa gaccaactcgtggatacttacttaattcctccctagaatagggaataaaa tatccagggaaggagttgcaaagagaaagtttggagctaagatgaaaaga cagaccatccagaaactgccccacatggtggtccatcccataatcagcca ccaaacacagacactattgcataatgccagaaagattttgctgaaaggac cctgatatagctgtctcctgtgaggcttttccagtgcctggcaaatacag aagtggatgctcacagtcataggatggaacacagggcctccaatttagga gctagagaagtacccaagagctgaacggtctgcaacccttatagtgacac agtataaactaaccagtaccacccagacttcatgtcctctagttgcatat tgtagcagaagatgcgtagtttgccatcatggtaagaagccccttgtcta gccaactttatagctacagttacagggtataggccagggttcaagacttg ggactgtagactggggtacgatgtgcatcctcg
quality values	Open. Hide. 49 31 42 35 58 39 27 62 62 47 46 62 62 54 62 49 62 62 62 41 42 62 62 62 62 62 62 62 54 47 62 62 59 45 62 47 45 43 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 54 54 62 54 62 62 54 42 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 38 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 54 58 58 58 58 58 58 54 54 54 58 54 54 58 54 58 49 58 58 58 58 54 58 58 54 58 52 58 47 58 58 58 58 54 58 58 58 54 58 54 54 52 54 54 58 58 54 58 41 52 54 54 58 54 58 54 54 54 58 54 54 46 58 58 58 54 54 58 58 49 49 46 58 58 58 49 51 58 58 58 49 48 58 58 58 53 46 51 54 58 49 49 49 54 58 53 51 58 54 50 48 50 46 45 34 49 53 41 49 54 58 49 52 51 50 58 58 39 51 41 58 58 53 58 50 58 54 41 51 50 50 51 52 58 58 51 53 58 54 58 52 53 53 58 53 58 48 48 54 58 51 58 50 51 53 34 50 32 53 42 51 58 53 53 50 43 50 51 58 54 51 53 58 52 40 44 40 53 39 49 32 37 44 22 31 42 50 32 11 50 46 24 47 35 38 22 33 51 50 50 49 35 35 53 32 50 37 45 38 36 39 39 40 29 34 53 37 49 35 26 50 28 28 41 39 42 53 37 37 32 39 45 32 37 45 40 51 37 53 37 39 41 37 53 45 52 54 52 42 52 31 40 29 54 42 24 17 54 16 33 24 35 38 15 39 37 31 41 18 35 37 43 45 30 32 45 36 28 22 27 33 15 31 42 32 32 29 32 31 32 32 42 26 31 34 40 36 31 29 31 51 27 33 51 42 29 28 18 35 28 24 18 46 32 31 45 18 29 29 33 37 21 38 29 30 51 39 34 40 19 29 32 32 29 46 51 36 37 40 25 22 34 8 31 26 38 31 31 16 18 16 30 31 31 31 42 31 26 42 31 31 31 32 46 31 42 14 12 17 23 28 30 29 27 27 31 31 37 34 26 31 41 21 20 33 21 35 24 32 38 46 48 34 19 10 39 31 26 31 19 25 29 21 19 21 25 22 23 13 21 36 22 5 14 31 18 22 22 10 31 6 5 17 13 18 23 9 7 29 22 27 14 9 20 21 36 32 17 10 6 4 6 21 23 39 24 33 31 27 18 12 18 15 18 20 13 21 12 23 26 23 12 13 20 32 15 26 7 15 10 6 5 28 7 8 7 23 31 17 20 26 34 31 48 10 11 5 15 18 18 7 6 30 4 7 5 6 6 20 8 11 27 19 21 25 11 6 27 24 23 5 6 17 25 24 13 14 10 18 5 6 13 10 11 11 21 14 21 5 6 10 10 6 26 6 9 4 7 7 11 7 5 5 7 30 15 14 7 18	Open. Hide. 49 47 54 59 62 62 62 59 44 59 59 46 49 49 29 49 37 54 59 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 46 46 34 28 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 58 58 58 58 58 58 58 54 41 54 54 58 58 58 58 58 58 58 58 54 58 58 58 54 58 54 58 58 49 46 58 54 58 58 54 49 58 52 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 54 54 58 58 58 58 58 58 54 52 58 54 54 45 54 58 58 58 58 58 58 58 41 51 54 58 58 58 58 58 45 38 51 58 58 49 58 58 54 51 40 58 51 49 50 58 41 42 41 51 51 58 49 48 44 48 58 58 58 58 52 53 37 58 58 58 51 52 52 53 58 52 58 58 58 58 50 39 40 58 50 58 15 15 58 53 58 44 37 22 49 50 42 58 58 53 51 30 44 58 46 50 36 51 47 39 39 51 58 49 39 36 50 39 50 49 50 49 43 44 46 50 26 38 51 41 35 33 58 50 58 52 38 33 54 54 40 45 43 43 37 54 52 54 22 24 44 25 18 54 50 18 54 41 44 44 46 49 54 41 54 39 54 54 24 33 51 54 54 53 52 51 25 45 53 31 53 20 31 25 40 49 54 54 47 42 32 27 32 37 42 32 28 32 52 52 41 24 38 54 54 36 52 37 53 32 40 40 40 26 32 34 32 36 34 20 42 36 15 30 52 32 53 33 52 47 31 47 31 45 42 31 32 31 40 38 31 33 32 45 45 51 32 27 30 42 31 51 31 31 42 31 30 45 25 32 34 19 42 30 19 32 42 27 30 21 28 41 51 30 30 21 11 46 46 21 31 38 31 29 43 46 9 14 26 34 11 46 27 18 18 27 28 31 31 31 29 29 32 31 31 31 31 22 24 20 30 20 22 37 21 27 16 37 48 46 39 29 38 32 21 31 32 23 12 13 10 27 9 29 48 41 31 19 30 29 31 31 33 24 31 25 28 27 23 32 21 23 31 23 31 31 31 15 32 21 23 15 13 7 25 21 21 14 25 12 15 11 16 17 25 43 23 18 15 38 35 38 20 16 38 48 21 12 18 9 33 17 32 32 21 14 32 13 17 11 18 17 18 32 31 24 6 26 15 27 15 20 33 24 16 9 4 9 10 4 17 27 25 27 12 18 20 24 26 11 21 15 19 15 7 5 5 3 5 3 9 6 7 13 28 14 13 29 21 20 6 6 15 19 15 13 27 27 6 8 5 11 10 40 13 6 9 18 7 7 15 24 16 20 14 11 6 5 5 6 16 7 6 22 21 19 24 16 24 6 6 6 9 15 19 8 23 7 5 17 22 6 6 7 16 4 5 6 16 4 14 16 6 11 3 10 12 22 16 9 12 4 3 1 3 2 5 5 11 11 6 25 28 14 2 3 2 1 2 17 11 4 7 4 15 6 5 11 27 9 6 9 17 7 10 7 8 16 5 6 4 4 4 9 4 14 28 9 1 3 3 14 9 7 11 14 6 7 17 14 6 6 21 10 6 1 5 1 1 5 5 6 4 2 1 2 3 4 8 4 3 1 3 19 15 17 8 10 5 5 13 4 4 7 3 6 8 8 2 3 6 8 4 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_22682105_22683201
seq2: B6Ng01-321L24.b_47_1141 (reverse)

seq1  TCCTAATGCTGAACAACCTCTCCATCACTCAGATTAAACACATCTTTCTT  50
      |||| |||||||||||| | ||||||||||||||||||||||||||||| 
seq2  TCCT-ATGCTGAACAACTTTTCCATCACTCAGATTAAACACATCTTTCTC  49

seq1  CACTCATTCTCCATGTTTTTACATCACTTCTTGTGAATCAACTTATATAG  100
       ||||  ||||||||||||||||||||||| |||||||||||||||||||
seq2  AACTCCATCTCCATGTTTTTACATCACTTC-TGTGAATCAACTTATATAG  98

seq1  ACTGATTTAGAAGGTGCTTGGTTTGTCTGTGTCTGGTCCTTTGTGACAGG  150
      |||||||||| |||||||||||||||||||||||||||| ||||||||||
seq2  ACTGATTTAGCAGGTGCTTGGTTTGTCTGTGTCTGGTCC-TTGTGACAGG  147

seq1  TACTAGAAGAAAAGGTCTAACAGAAGAGTTATGAGACAAAGAGAAGCAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTAGAAGAAAAGGTCTAACAGAAGAGTTATGAGACAAAGAGAAGCAGT  197

seq1  GGATGTTACCTAGGGACAAGTCACATTTACATCAGACAAGGTCATGTGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGTTACCTAGGGACAAGTCACATTTACATCAGACAAGGTCATGTGGG  247

seq1  AATGATGATGAGACTTGCTTGTCTTGCAGAGGACTCTGGTTCC-TTACCC  299
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  AATGATGATGAGACTTGCTTGTCTTGCAGAGGACTCTGGTTCCTTTACCC  297

seq1  TACACCCACATCATAGGATGCATGACAGCTTGTAGCTCTAGTTCCTGGAG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACCCACATCATAGGATGCATGACAGCTTGTAGCTCTAGTTCCTGGAG  347

seq1  ACCAAATGCTCTCCTCAGGCCTGTAAGGACACAAATGTGACATATACTCA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAATGCTCTCCTCAGGCCTGTAAGGACACAAATGTGACATATACTCA  397

seq1  CACAGACACATACATATAAATATAATTAGAAAATAAGCTATTTAATAATC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGACACATACATATAAATATAATTAGAAAATAAGCTATTTAATAATC  447

seq1  TGTAGCACAATACAGTACACACCAGTTACTTGAATTGATTTGTGTATATA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGCACAATACAGTACACACCAGTTACTTGAATTGATTTGTGTATATA  497

seq1  GTGCCACCAAGCAAATTATAAATTGTGCTCATCATTGTAAAGTAGAGCCA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCCACCAAGCAAATTATAAATTGTGCTCATCATTGTAAAGTAGAGCCA  547

seq1  TGAAACTTCTAGTGTTTCCAGTCAAAAGTGACAGAAAAATTGTTTCAAAT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAACTTCTAGTGTTTCCAGTCAAAAGTGACAGAAAAATTGTTTCAAAT  597

seq1  AAGGTAAAACATACCTCTAATCATTCAACCATTTCACAGTCAATATTTAT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTAAAACATACCTCTAATCATTCAACCATTTCACAGTCAATATTTAT  647

seq1  AACTATAAGTATTTTTCAGAATGTGTCCATCAGATTCTTAGAAACATGTC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTATAAGTATTTTTCAGAATGTGTCCATCAGATTCTTAGAAACATGTC  697

seq1  ACTATCTTACTGTATGTATCCAATTTAAGTACATAAGCAGCAAATTTTCA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATCTTACTGTATGTATCCAATTTAAGTACATAAGCAGCAAATTTTCA  747

seq1  TTTAAATATATGTAGAGTCAGATCCTCTCAGTGCTCCTTGGTGCTACAGA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAATATATGTAGAGTCAGATCCTCTCAGTGCTCCTTGGTGCTACAGA  797

seq1  GCTGCACGGAGCTATGGAGAGCACCTGAGCAGTAACAAAGGGCAGCTACA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCACGGAGCTATGGAGAGCACCTGAGCAGTAACAAAGGGCAGCTACA  847

seq1  AAGCATGCTTGCTTGGCCTTAATTGTAGTCATTGACTTATTTTGAAAAAG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCATGCTTGCTTGGCCTTAATTGTAGTCATTGACTTATTTTGAAAAAG  897

seq1  ACAAATGCACACTTTTAAATCAACATAGTAACTACAGTTGAGTATAATGT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAATGCACACTTTTAAATCAACATAGTAACTACAGTTGAGTATAATGT  947

seq1  AAGACTGTACTGTGTATTTGTTATCTAATTTATTTCATATATCTAGTCTT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACTGTACTGTGTATTTGTTATCTAATTTATTTCATATATCTAGTCTT  997

seq1  TATAACTGCAAAGAATTTTCACAAATATAATGCCAATGAAGTGATCCGGG  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAACTGCAAAGAATTTTCACAAATATAATGCCAATGAAGTGATCCGGG  1047

seq1  CCATTCAAGTTCTGTGACTAGTACATTTGGCTTCTATTGACTGAATTC  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTCAAGTTCTGTGACTAGTACATTTGGCTTCTATTGACTGAATTC  1095

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information