MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-161I02
Chromosome	13 (Build37)
Map Location	54,534,511 - 54,534,715
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Msx2, EG432760, E130119H09Rik, Drd1a, Sfxn1, Hrh2, LOC100040535, Cplx2
Downstream gene	Thoc3, LOC100040543, 4732471D19Rik, 4833439L19Rik, Arl10, D13Wsu177e, Higd2a, Cltb, Ubxd8, Rn4.5s-ps3, Rnf44, BC040758, Gprin1, Sncb, Eif4e1b, Tspan17, Unc5a, Hk3, Uimc1, LOC622707, Zfp346, Fgfr4, Nsd1, Rab24, Prelid1, Mxd3, Lman2, Rgs14, Slc34a1, Pfn3, F12
Link	Open Mouse BAC browser

Click to get alignment info.

name	Msx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17702 MGI:97169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432760 MGI:3643792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 134 ESTs, 5 Proteins

name	E130119H09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78550 MGI:1925800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Drd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13488 MGI:99578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfxn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14057 MGI:2137677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hrh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15466 MGI:108482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cplx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12890 MGI:104726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thoc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73666 MGI:1920916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4732471D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319719 MGI:2442599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833439L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97820 MGI:1921162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56795 MGI:1930788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D13Wsu177e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28126 MGI:107862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67044 MGI:1914294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cltb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74325 MGI:1921575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubxd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76577 MGI:1923827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rn4.5s-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19802 MGI:97944
definition	note : 4.5s RNA, pseudogene 3 pseudo : _no_value

name	Rnf44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105239 MGI:2145310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC040758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268663 MGI:2687323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26913 MGI:1349455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sncb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104069 MGI:1889011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4e1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218268 MGI:2685119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tspan17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74257 MGI:1921507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107448 MGI:894682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212032 MGI:2670962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uimc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20184 MGI:103185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 903 ESTs, 5 Proteins

name	Zfp346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26919 MGI:1349417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgfr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14186 MGI:95525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18193 MGI:1276545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19336 MGI:105065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prelid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66494 MGI:1913744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17121 MGI:104987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lman2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66890 MGI:1914140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51791 MGI:1859709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc34a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20505 MGI:1345284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75477 MGI:2178800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58992 MGI:1891012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326503 GeneID:17702 MGI:97169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box, msh-like 2 transcript_id : NM_013601.2

name	EG432760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395141 GeneID:432760 MGI:3643792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 134 ESTs, 5 Proteins product : predicted gene, EG432760 transcript_id : XM_484260.3

name	Drd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366202 GeneID:13488 MGI:99578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine receptor D1A transcript_id : NM_010076.2

name	Sfxn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347274 GeneID:14057 MGI:2137677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 1 transcript_id : NM_027324.3

name	Hrh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131131 GeneID:15466 MGI:108482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine receptor H 2 transcript_id : NM_001010973.2

name	Hrh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331135 GeneID:15466 MGI:108482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine receptor H 2 transcript_id : NM_008286.2

name	LOC100040535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264237 GeneID:100040535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040535 transcript_id : XM_001474874.1

name	Cplx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370333 GeneID:12890 MGI:104726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complexin 2 transcript_id : NM_009946.2

name	Thoc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384623 GeneID:73666 MGI:1920916
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THO complex 3 transcript_id : NM_028597.2

name	LOC100040543 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264242 GeneID:100040543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to synapsin I transcript_id : XM_001474889.1

name	4732471D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196777 GeneID:319719 MGI:2442599
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732471D19 gene transcript_id : NM_176987.3

name	4833439L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384711 GeneID:97820 MGI:1921162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833439L19 gene transcript_id : NM_133797.2

name	Arl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910333 GeneID:56795 MGI:1930788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 10 transcript_id : NM_019968.1

name	D13Wsu177e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802676 GeneID:28126 MGI:107862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 13, Wayne State University 177, expressed transcript_id : NM_178605.3

name	Higd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382651 GeneID:67044 MGI:1914294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 2A transcript_id : NM_025933.2

name	Cltb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351309 GeneID:74325 MGI:1921575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clathrin, light polypeptide (Lcb) transcript_id : NM_028870.2

name	Ubxd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341590 GeneID:76577 MGI:1923827
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UBX domain containing 8 transcript_id : NM_178397.2

name	Rnf44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527279 GeneID:105239 MGI:2145310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 44 transcript_id : NM_134064.1

name	BC040758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372214 GeneID:268663 MGI:2687323
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC040758 transcript_id : NM_001033364.2

name	Gprin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803046 GeneID:26913 MGI:1349455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-regulated inducer of neurite outgrowth 1 transcript_id : NM_012014.3

name	Sncb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20589946 GeneID:104069 MGI:1889011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synuclein, beta transcript_id : NM_033610.2

name	Eif4e1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89199236 GeneID:218268 MGI:2685119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E family member 1B transcript_id : NM_001033269.2

name	Eif4e1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89199241 GeneID:218268 MGI:2685119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E family member 1B transcript_id : NM_001039683.1

name	Tspan17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386321 GeneID:74257 MGI:1921507
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 17 transcript_id : NM_028841.2

name	Unc5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803458 GeneID:107448 MGI:894682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-5 homolog A (C. elegans) transcript_id : NM_153131.2

name	Hk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356834 GeneID:212032 MGI:2670962
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexokinase 3 transcript_id : NM_001033245.2

name	Uimc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363034 GeneID:20184 MGI:103185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin interaction motif containing 1 transcript_id : NM_011307.2

name	LOC622707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264246 GeneID:622707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 902 ESTs, 5 Proteins product : similar to ribosomal protein, transcript variant 1 transcript_id : XM_001475711.1

name	LOC622707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264248 GeneID:622707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 1 Protein product : similar to ribosomal protein, transcript variant 2 transcript_id : XM_001475730.1

name	Zfp346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672927 GeneID:26919 MGI:1349417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 346 transcript_id : NM_012017.2

name	Fgfr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293259 GeneID:14186 MGI:95525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 4 transcript_id : NM_008011.2

name	Nsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118918399 GeneID:18193 MGI:1276545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor-binding SET-domain protein 1 transcript_id : NM_008739.3

name	Rab24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560646 GeneID:19336 MGI:105065
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB24, member RAS oncogene family transcript_id : NM_009000.2

name	Prelid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50582543 GeneID:66494 MGI:1913744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRELI domain containing 1 transcript_id : NM_025596.5

name	Mxd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372266 GeneID:17121 MGI:104987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Max dimerization protein 3 transcript_id : NM_016662.4

name	Lman2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892179 GeneID:66890 MGI:1914140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, mannose-binding 2 transcript_id : NM_025828.3

name	Rgs14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980625 GeneID:51791 MGI:1859709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 14 transcript_id : NM_016758.2

name	Slc34a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119120880 GeneID:20505 MGI:1345284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 34 (sodium phosphate), member 1 transcript_id : NM_011392.2

name	Pfn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:106506691 GeneID:75477 MGI:2178800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : profilin 3 transcript_id : NM_029303.2

name	F12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946899 GeneID:58992 MGI:1891012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor XII (Hageman factor) transcript_id : NM_021489.1

name	Msx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326504 CCDS:CCDS26522.1 GeneID:17702 MGI:97169
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : homeo box, msh-like 2 protein_id : NP_038629.2

name	EG432760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51767685 GeneID:432760 MGI:3643792
definition	codon_start : 1 product : similar to Sm D2 protein_id : XP_484260.1

name	Drd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859542 CCDS:CCDS26524.1 GeneID:13488 MGI:99578
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0001590 - dopamine D1 receptor activity [Evidence IDA] [Evidence IMP]; GO:0004952 - dopamine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IDA] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence IDA]; GO:0007610 - behavior [Evidence IMP]; GO:0007191 - dopamine receptor, adenylate cyclase activating pathway [Evidence IDA] [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence IDA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007617 - mating behavior [Evidence IDA]; GO:0042493 - response to drug [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0019226 - transmission of nerve impulse [Evidence IMP] codon_start : 1 note : D1 receptor; D1A dopamine receptor; G protein-coupled receptor DRD1 product : dopamine receptor D1A protein_id : NP_034206.1

name	Sfxn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15147224 CCDS:CCDS26525.1 GeneID:14057 MGI:2137677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence TAS] [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : flexed tail product : sideroflexin 1 protein_id : NP_081600.1

name	Hrh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331134 CCDS:CCDS26526.1 GeneID:15466 MGI:108482
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; histamine H2 receptor product : histamine receptor H 2 isoform 1 protein_id : NP_001010973.1

name	Hrh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331136 GeneID:15466 MGI:108482
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; histamine H2 receptor product : histamine receptor H 2 isoform 2 protein_id : NP_032312.2

name	LOC100040535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264238 GeneID:100040535
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474924.1

name	Cplx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753508 GeneID:12890 MGI:104726
definition	GO_function : GO:0019905 - syntaxin binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0043303 - mast cell degranulation [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence ISS] codon_start : 1 product : complexin 2 protein_id : NP_034076.1

name	Thoc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312090 CCDS:CCDS26527.1 GeneID:73666 MGI:1920916
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : THO complex 3 protein_id : NP_082873.1

name	LOC100040543 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264243 GeneID:100040543
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474939.1

name	4732471D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196778 CCDS:CCDS26528.1 GeneID:319719 MGI:2442599
definition	codon_start : 1 product : hypothetical protein LOC319719 protein_id : NP_795961.2

name	4833439L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527012 CCDS:CCDS26529.1 GeneID:97820 MGI:1921162
definition	codon_start : 1 product : hypothetical protein LOC97820 protein_id : NP_598558.1

name	Arl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910334 CCDS:CCDS26530.1 GeneID:56795 MGI:1930788
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ADP-ribosylation factor-like membrane-associated product : ADP-ribosylation factor-like 10A protein_id : NP_064352.1

name	D13Wsu177e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519925 CCDS:CCDS26531.1 GeneID:28126 MGI:107862
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC28126 protein_id : NP_848720.1

name	Higd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385426 CCDS:CCDS26532.1 GeneID:67044 MGI:1914294
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : HIG1 domain family, member 2A protein_id : NP_080209.1

name	Cltb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794164 CCDS:CCDS26533.1 GeneID:74325 MGI:1921575
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 product : clathrin, light polypeptide (Lcb) protein_id : NP_083146.1

name	Ubxd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409970 GeneID:76577 MGI:1923827
definition	codon_start : 1 exception : unclassified translation discrepancy product : protein expressed in T-cells and eosinophils in atopic dermatitis protein_id : NP_848484.1

name	Rnf44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527280 GeneID:105239 MGI:2145310
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 44 protein_id : NP_598825.1

name	BC040758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662397 GeneID:268663 MGI:2687323
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin LKC protein_id : NP_001028536.1

name	Gprin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000009 CCDS:CCDS26534.1 GeneID:26913 MGI:1349455
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0031175 - neurite development [Evidence IDA] codon_start : 1 product : G protein-regulated inducer of neurite outgrowth 1 protein_id : NP_036144.2

name	Sncb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809030 GeneID:104069 MGI:1889011
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_process : GO:0042417 - dopamine metabolism [Evidence IGI] codon_start : 1 product : synuclein, beta protein_id : NP_291088.1

name	Eif4e1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701778 GeneID:218268 MGI:2685119
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; oocyte-specific eukaryotic translation initiation factor 4E-like product : oocyte-specific eukaryotic translation initiation factor 4E-like isoform 1 protein_id : NP_001028441.1

name	Eif4e1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89199242 GeneID:218268 MGI:2685119
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; oocyte-specific eukaryotic translation initiation factor 4E-like product : oocyte-specific eukaryotic translation initiation factor 4E-like isoform 2 protein_id : NP_001034772.1

name	Tspan17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312678 CCDS:CCDS26536.1 GeneID:74257 MGI:1921507
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : F-box only protein 23; transmembrane 4 superfamily member 17 product : tetraspanin 17 protein_id : NP_083117.1

name	Unc5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346571 CCDS:CCDS26537.1 GeneID:107448 MGI:894682
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : unc5 homolog (C. elegans) 1 product : netrin receptor Unc5h1 protein_id : NP_694771.1

name	Hk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370288 CCDS:CCDS26538.1 GeneID:212032 MGI:2670962
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : hexokinase 3 protein_id : NP_001028417.1

name	Uimc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597445 GeneID:20184 MGI:103185
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : retinoid X receptor interacting protein 110 protein_id : NP_035437.1

name	LOC622707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264247 GeneID:622707
definition	codon_start : 1 product : similar to ribosomal protein isoform 1 protein_id : XP_001475761.1

name	LOC622707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264249 GeneID:622707
definition	codon_start : 1 product : similar to ribosomal protein isoform 2 protein_id : XP_001475780.1

name	Zfp346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754396 CCDS:CCDS26539.1 GeneID:26919 MGI:1349417
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IMP] codon_start : 1 note : just another zinc finger protein product : zinc finger protein 346 protein_id : NP_036147.1

name	Fgfr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293260 CCDS:CCDS26540.1 GeneID:14186 MGI:95525
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001759 - induction of an organ [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : fibroblast growth factor receptor 4 16 minus form product : fibroblast growth factor receptor 4 protein_id : NP_032037.2

name	Nsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118918400 GeneID:18193 MGI:1276545
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence IC]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0050681 - androgen receptor binding [Evidence ISS]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0030331 - estrogen receptor binding [Evidence IPI]; GO:0046975 - histone lysine N-methyltransferase activity (H3-K36 specific) [Evidence IDA]; GO:0042799 - histone lysine N-methyltransferase activity (H4-K20 specific) [Evidence IDA]; GO:0042054 - histone methyltransferase activity [Evidence IDA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0016922 - ligand-dependent nuclear receptor binding [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0046965 - retinoid X receptor binding [Evidence IPI]; GO:0046966 - thyroid hormone receptor binding [Evidence IPI]; GO:0003712 - transcription cofactor activity [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0016571 - histone methylation [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear receptor-binding SET-domain protein 1 protein_id : NP_032765.3

name	Rab24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679591 CCDS:CCDS26541.1 GeneID:19336 MGI:105065
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006914 - autophagy [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB24, member RAS oncogene family protein_id : NP_033026.1

name	Prelid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518501 CCDS:CCDS26542.1 GeneID:66494 MGI:1913744
definition	codon_start : 1 note : protein of relevant evolutionary and lymphoid interest product : PX19 homolog protein_id : NP_079872.4

name	Mxd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254561 CCDS:CCDS26543.1 GeneID:17121 MGI:104987
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : Max dimerization protein 3 protein_id : NP_057871.2

name	Lman2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328278 CCDS:CCDS26544.1 GeneID:66890 MGI:1914140
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lectin, mannose-binding 2 protein_id : NP_080104.2

name	Rgs14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980626 GeneID:51791 MGI:1859709
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007067 - mitosis [Evidence IMP]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : rap1/rap2 interacting protein product : regulator of G-protein signaling 14 protein_id : NP_058038.2

name	Slc34a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119120881 GeneID:20505 MGI:1345284
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015321 - sodium-dependent phosphate transporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 17 (sodium/hydrogen exchanger), member 2; renal Na+/Pi transporter; Na/Pi cotransporter; type IIa Na+/Pi-cotransporter product : solute carrier family 34 (sodium phosphate), member 1 protein_id : NP_035522.2

name	Pfn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312794 CCDS:CCDS26545.1 GeneID:75477 MGI:2178800
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence TAS]; GO:0005471 - ATP:ADP antiporter activity [Evidence TAS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : profilin 3 protein_id : NP_083579.1

name	F12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946900 GeneID:58992 MGI:1891012
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : blood coagulation, fibrinolysis note : factor XII product : coagulation factor XII (Hageman factor) protein_id : NP_067464.1

name	(CDS detail)
type	misc_feature
link
xref
definition	citation : [PUBMED 1373121] label : clone19 note : Terminal EcoRI-PstI fragment from 8 kb EcoRI genomic clone pseudo : _no_value

name	E130119H09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94395144 GeneID:78550 MGI:1925800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130119H09 gene transcript_id : XR_002314.1

clone name	MSMg01-442K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-435J13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-474P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-266L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-332I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E19
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-161I02.T7 (MSMg01no161_i02.b1)	MSMg01-161I02.TJ (MSMg01no161_i02.g1)
ACC	AG360891	AG360892
length	1,147	1,200
length of high quality (start - end)	208 (187 - 394)	33 (384 - 416)
definition	CHROMAT_FILE: MSMg01no161_i02.b1 PHD_FILE: MSMg01no161_i02.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:28:11 2005	CHROMAT_FILE: MSMg01no161_i02.g1 PHD_FILE: MSMg01no161_i02.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:28:11 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NNGGGCTATTGGCGCTATAGACTACTATAGGGAGAGGATCGCGGAATTCA TCAATAAATTGCCCCTTTTAATGGNTTTNTGTTNNNATTTATNATNTGTG NAGGACATTAATGCCTAGNAGATGGTGTGGTGTCTGGGTCTACCCAGGGC TACAGTCATCCTTCTCCCTCAAGATGTTCTCAAAGCTGCTTGTCAAATGG AATCTCTAGTCTGTGGTCTGGGAAACTAGTTTTATTCAATACGGAATCAC TTAGAGTCGAGCTTATCCTAGTATCAACACTTCTCTTTTCTATGGAAGAT AAAGAGGGCCATTTGTCTTCGCTTATTCGTTAAAACCATGCAGCTATCTC CCTTCATCTGGACTCTGGTTAAATGACTAACGGAGAAGCCTTTTTTTTTT TTTGANACACGGNCAGCCNCANCCACTGGANNAAAAAGAAACCCTTTCTT TTTTTTCCCCCCCCCCGANAAANCNNNGCCCAAAAAAAAGAAAAGGGCGG CCNNNAGGCCNNCNCNNNNNNNCNNGNNAGCGACGGCGGGGACGGNCANA AACNNGGCNNAAGGCGNNGNAAGGNNCCCAGNACCNGGAAACGGGCNGAA CCGCANGCCAGGAACCCAGACGGNAACGGNCAAGNAAGCGAAACCCACGG NACAGAGGNGGAAANACACCAAGGAGCAANAGAGCCGGGNCCCCGGNGAA GACCGNANGAGNNNGACCCNAAGAAAAAACCCCCAANCNAGAAACCCACA AAGGAAGCGGAGCCACGGGGGCNNNGGGGNCAGAAAGGACNCGGCNNAAA NCAGCAGAGCNNNGCCAAGNGGGGGCCACAGAACCGAAAGCCCCCCGAAA GNNGGGGGAACCCCGCAAAACGGAAAGGACCGCAAGCCNAAGGGGNCCCA CCACCAAAAGCNAGAAAGCGCCAAGGACCCCACGGGGCCNCCCAACCCGG GAGCNCCCAGGGAAAAACCNCCCAACCGGGGCCCCCGGAGCCAAACCCGG GCCCGAAAAAAGGGGGAACAGGGCAACCCCGGGGGGGAAGGAAAGAACCC CCCAGAAAAAAAAAGGAAACCGGGGGAACCAAGAAACCCAAGGAAGACAA AGCCCCCCCCACACAGAGAAAGGAAGAGACCGGGGAAAAAAAAAGGG	NNGGAAGCATGGTAGCGGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXTCAAGAAAAGCAGGGGTAACACAAAAAAACCT GGTTTCAAAAACCAAAAACAAATAAGAACCCAAACAACCAAACCCAACCC CTTGGCCAAAGGAAATAAAAAGAAAAAAAAGGGGGAAGGAACAAAATTAA AAAACATTTAAAAAAAATAAAAAAGGGGGGGGCCCAAACTTGGTTTTCCC CCCAAAACAGGGTTCCCCGGAAAAGCCTGAATGGCCCGGAAATTCGGAAA ACAAGGTGGGCCACAAATTCAAAAACCACCTGGTTCCGGCCCCCAAGGGG CGGGAATAAAAGGGGGGGGCCAAAATGGCCGGGTTAAAACTTTTTTTTTT TTTTTGTTTTTTGAAAAAAGGGTTCCCCGGAAAAGCCTGGGTGGTCTGGA ATTTTTTTTTCCCCCCCCCCCGGGNNTTGAATCCTAAAAAAAAAAAAGGG GGCCTCCCCAGGGTGGGAATAAAAGGAAGGCCCCACAAAGAATGGAATGA AAGTAATAGCACCCGGGGTCCCCAACAATGAACCCTTCCCTCCAGAATGG TGGCTCATCCTAAAAAGCACTTCGGGAAGTAAAAAAAAAATTTCTTCAAA GCTTGGCTAAAAAGTAATTTTTAAATATGTAACCTAACTTAAAAAAATTT ACCAACTTATAAGCCAAAACTTGAAAGGAAAAAGGGTATTTTCAAAAATG ACTTCCCAAAAATCCTTCCTTTAAAAAAATCCTTGGAAAAAAGGATAAAC CTTGGTTACCCGGGAATCCACAGGGTCAATTTCAAAAAATTTCCCGGGGA TCCTCCAAGGGTTGGGAACTAACCCCCTTCTGGTAATTTATAAAAAAAAA AAAATCCCACCCCCTTTAACCTCGGGGTGTTAACCAAAAAAAACTGAAAA ACACCCTATACAGCCCCCTGGTTCGTAAAAAAAATTTCCAAAAAAAATAA AGGCTCCCTAAAAAATCCCAAATTTTTTTTCTAAAGAAGAGGGCCAAATT AAATGGGCAAAAAAAAACCTGTAAAAGGTTAATTAAAAATAAAACAAAAA AATCGAAAGTCCTCGGGTCTGTAAAAAATACCCCCACCGTGAAGGTGAAC CTCTGTGCCGTTTTACAGGGTTTGTCCCCCACCACCCTCAAAATAATATG
quality values	Open. Hide. 0 0 3 6 6 6 6 6 6 8 8 8 8 8 8 8 10 10 8 10 8 10 10 8 8 8 13 11 19 26 31 36 36 36 36 31 22 12 10 10 23 23 50 50 50 50 26 26 10 10 12 10 12 14 26 32 33 26 21 9 9 9 8 8 8 8 8 9 10 10 9 9 9 3 0 3 25 3 0 3 23 23 3 0 0 0 3 21 21 21 23 3 0 3 3 0 3 21 21 3 0 3 8 6 6 6 6 6 9 10 10 13 10 10 13 21 15 3 0 3 21 21 33 33 31 31 33 33 33 36 47 50 53 53 53 53 53 53 43 47 47 47 47 53 59 59 57 57 50 50 53 53 50 50 50 50 50 50 53 53 53 53 53 53 53 53 53 50 50 42 42 39 30 19 17 9 9 9 9 9 9 9 12 18 12 14 24 24 23 35 37 25 24 19 30 34 48 57 57 57 57 57 57 57 47 47 47 47 47 53 68 68 57 57 57 54 54 54 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 68 68 57 35 32 20 15 15 15 12 12 16 24 30 59 59 68 68 68 68 68 68 68 68 68 57 57 59 54 54 59 59 59 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 48 47 33 33 33 33 33 41 23 23 12 16 9 13 12 12 9 8 9 9 10 11 11 25 3 0 3 27 27 27 27 3 0 3 27 27 29 3 0 3 3 0 3 23 15 20 20 21 21 3 0 0 3 14 15 10 9 10 8 8 9 9 8 6 6 7 3 3 3 18 18 32 30 25 18 16 16 20 26 32 14 16 18 9 9 6 8 3 0 3 17 3 0 3 0 0 0 3 11 9 9 9 10 7 9 9 9 9 7 8 8 8 7 6 6 6 6 7 9 9 18 3 0 0 0 3 25 25 25 3 0 0 3 0 3 0 0 0 0 0 0 0 3 0 0 3 0 0 3 9 9 9 15 8 9 9 9 19 44 44 24 24 7 7 3 0 3 3 0 3 7 7 3 0 0 3 6 3 0 0 3 27 23 22 22 3 0 0 3 0 3 7 7 3 0 0 3 8 8 21 3 0 3 17 3 0 3 7 7 18 18 9 9 7 7 3 0 3 23 9 9 9 13 11 3 0 3 27 27 44 44 21 21 9 9 9 15 22 43 43 27 27 3 0 3 14 7 7 3 0 3 27 27 3 0 3 22 18 28 19 9 9 9 9 19 24 22 7 7 3 0 3 7 7 15 7 7 3 0 3 27 25 25 3 0 3 27 21 9 9 6 7 7 9 9 18 23 27 3 0 3 27 27 44 24 19 7 7 3 0 3 18 14 7 7 3 0 3 21 19 31 37 23 25 3 0 3 0 3 11 3 0 0 0 3 17 17 17 3 0 3 22 22 18 19 11 9 9 9 9 9 9 9 7 7 3 0 3 0 3 10 10 19 19 22 24 33 16 14 9 9 9 9 12 19 14 8 7 9 9 9 13 34 23 22 9 6 6 6 6 6 3 0 0 0 3 9 9 3 0 3 12 12 19 26 32 37 25 18 3 0 3 7 7 3 0 0 3 16 3 0 3 16 16 13 13 9 9 9 3 0 0 0 3 12 12 13 8 3 0 3 8 8 17 9 9 9 10 8 8 8 8 8 9 17 15 16 12 11 9 8 7 17 9 7 6 6 8 8 8 3 0 0 3 9 12 15 9 9 7 7 7 7 11 13 16 25 33 33 25 25 10 9 8 9 9 9 8 12 9 9 7 13 13 11 10 8 3 0 3 8 8 8 8 3 0 3 6 8 8 8 7 7 7 8 8 8 8 8 8 3 0 3 9 12 16 9 10 10 10 9 9 9 9 12 13 10 9 9 9 9 9 7 8 8 8 6 6 3 0 3 8 6 6 6 6 17 15 16 8 7 6 6 3 0 3 9 10 12 11 8 8 8 12 21 15 13 9 3 0 3 9 8 10 11 8 9 8 19 19 16 17 12 24 16 12 11 13 10 8 8 6 6 8 8 7 7 7 11 9 9 12 8 10 8 10 8 8 9 8 8 8 8 8 7 7 8 8 8 9 14 10 8 8 8 9 9 9 12 14 14 16 18 19 25 14 12 10 10 10 10 10 11 13 10 13 11 12 11 12 12 12 12 10 10 10 14 24 24 28 16 10 10 9 11 12 10 13 8 8 8 8 8 8 10 12 9 9 9 11 11 11 11 11 9 10 10 10 10 12 12 15 8 13 6 7 8 14 15 10 9 9 9 10 11 9 6 6 6 6 6 6 6 6 6 8 8 8 13 10 8 8 8 10 8 8 6 6 8 6 11 11 16 19 12 14 14 28 17 11 11 10 8 10 13 13 13	Open. Hide. 0 0 3 6 6 6 6 6 6 6 6 6 6 6 10 8 8 8 8 9 14 10 16 8 8 8 3 0 3 8 8 10 15 8 10 15 17 10 15 12 21 13 11 11 11 19 19 10 13 13 19 13 21 17 25 15 15 14 28 15 20 16 23 16 22 12 11 11 19 12 11 11 13 17 12 11 12 11 15 11 11 10 21 17 9 9 9 16 12 12 15 16 24 24 25 15 15 12 12 11 11 11 11 11 11 12 12 28 30 18 18 14 14 14 34 34 28 20 15 15 12 12 14 12 21 12 12 18 24 34 32 34 20 20 20 20 28 30 24 24 18 18 15 27 12 13 13 18 32 32 15 15 11 15 12 12 12 14 24 24 15 15 15 10 13 13 15 12 19 18 20 20 20 27 41 38 32 18 17 17 17 24 28 18 15 13 15 18 18 21 12 14 21 38 13 13 13 13 13 32 24 24 28 13 13 12 15 12 13 13 38 38 41 38 28 24 17 17 17 34 26 38 27 29 29 29 35 35 27 24 14 12 12 18 18 15 15 13 12 12 12 18 15 34 38 38 14 14 14 38 38 16 14 14 24 26 12 11 11 11 13 13 13 15 15 18 18 18 20 20 35 20 26 13 15 15 12 12 11 12 11 11 11 12 18 15 14 14 22 38 22 14 14 14 14 16 20 34 38 39 35 27 21 15 16 15 11 11 11 15 12 12 12 13 12 18 13 13 13 13 13 32 38 18 16 15 13 12 11 11 12 12 11 12 12 12 12 15 18 15 12 12 11 11 11 12 15 15 24 12 11 11 15 26 20 27 27 28 28 14 13 13 18 18 20 21 18 16 16 14 14 14 16 15 14 13 12 19 15 12 12 11 15 15 20 32 32 32 18 18 29 32 59 59 59 59 68 68 68 68 59 44 41 24 15 12 11 16 27 34 27 26 11 11 18 23 18 20 15 15 18 18 18 18 18 23 23 20 23 20 23 20 24 17 18 34 18 14 12 15 25 12 12 11 15 12 11 11 15 11 11 12 16 27 28 36 28 18 9 9 9 9 11 14 23 23 23 24 24 20 17 20 17 3 0 0 3 12 12 11 11 10 8 8 8 8 13 15 26 27 25 24 24 21 10 9 9 9 9 10 23 15 12 12 15 16 33 12 12 12 18 23 23 11 11 12 23 25 33 28 24 24 20 15 15 15 12 11 12 12 13 13 13 18 12 12 12 25 18 15 15 13 12 12 17 17 11 11 11 11 12 11 12 11 12 12 11 11 12 12 12 19 12 18 18 34 15 12 11 12 15 21 20 18 22 15 15 12 12 9 11 9 11 11 16 16 15 14 14 14 15 15 19 15 20 18 18 11 11 11 9 9 9 11 11 12 12 11 11 11 12 12 14 21 18 15 11 11 9 9 9 12 12 13 19 13 13 9 9 9 10 15 30 34 43 43 33 33 28 23 23 20 16 14 14 14 18 19 17 14 14 14 14 14 13 13 13 13 13 18 25 23 15 15 12 15 15 22 32 34 28 23 22 18 13 13 12 12 11 11 15 12 12 13 19 18 15 11 11 12 12 26 26 32 24 25 23 24 19 19 16 19 15 15 12 12 12 13 13 10 13 11 14 11 11 13 21 18 11 11 11 11 10 12 12 12 9 9 10 18 15 21 13 12 13 12 12 14 24 25 25 17 17 15 30 19 11 11 11 11 10 8 8 8 8 10 10 16 28 22 20 23 19 17 14 12 12 10 13 11 8 8 8 15 17 24 19 15 19 15 10 9 12 10 12 18 22 19 18 18 14 14 12 11 9 9 6 8 8 8 8 11 13 11 8 8 8 8 8 8 8 6 6 7 7 8 6 8 8 8 9 9 11 11 10 10 11 14 15 10 10 8 8 8 8 12 12 10 12 8 8 8 10 8 12 10 10 10 10 10 10 10 10 12 11 11 11 16 11 10 13 15 16 9 8 8 8 8 8 6 8 8 8 8 8 11 10 11 11 11 11 10 9 9 9 11 14 13 10 9 10 9 9 14 13 13 10 10 19 31 19 21 21 13 10 10 8 8 6 6 6 9 15 19 12 11 12 11 12 12 9 9 9 10 12 7 7 6 6 8 8 8 8 8 8 8 10 10 12 13 9 9 8 8 8 8 8 8 15 17 10 7 7 7 12 11 8 8 8 8 8 10 10 10 8 9 8 8 8 8 8 8 8 8 9 9 12 12 22 19 17 13 13 13 9 9 9 10 10 10 13 22 19 18 12 12 9 9 8 10 11 11 12 13 8 8 8 8 8 8 9 8 10 9 9 9 9 10 15 15 24 23 28 29 29 32 19 12 11 11 10 10 10 10 8 10 8 7 7 9 10 7 6 8 6 6 8 8 10 10 10 10 12 10 8 8 8 8 8 8 9 9 11 18 12 10 10 8 8 12 10 10 8 10 11 11 11 11 10 10 10 10 10 10 14 14 20 21 12 11 9 8 8 7 7 7 10 10 8 8 7 8 8 8 8 8 10 12 6 6 6 6 8 11 12 11 8 8 6 6 6 6 10 15 21 23 13 8 8 8 8 8 12 13 12 12 12 12 12 12 12 13 10 8 8 8 8 9 8 8 8 8 8 8 9 10 8 6 6 6 8 8 9 9 12 11 10 9 9 9 8 8 8 8 8 8 11 15 12 12 8 8 6 6 8 8 7 6 8 8 10 10 6 6 6 8 10 10 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no161_i02.b1 MSMg01no161_i02.b1 CHROMAT_FILE:
MSMg01no161_i02.b1 PHD_FILE: MSMg01no161_i02.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 19:28:11 2005
         (208 letters)



>mm_chr13_54534311_54534918
          Length = 608

 Score =  381 bits (197), Expect = e-110
 Identities = 203/205 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   tgcttgtcaaatggaatctctagtctgtggtctgggaaactagttttattcaatacggaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tgcttgtcaaatggaatctctagtctgtggtctgggaaactagttttattcaatacggaa 260

                                                                       
Query: 61  tcacttagagtcgagcttatcctagtatcaacacttctcttttctatggaagataaagag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tcacttagagtcgagcttatcctagtatcaacacttctcttttctatggaagataaagag 320

                                                                       
Query: 121 ggccatttgtcttcgcttattcgttaaaaccatgcagctatctcccttcatctggactct 180
           ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||
Sbjct: 321 ggccatttgtcttcgcttactcgttaaaaccatgcggctatctcccttcatctggactct 380

                                    
Query: 181 ggttaaatgactaacggagaagcct 205
           |||||||||||||||||||||||||
Sbjct: 381 ggttaaatgactaacggagaagcct 405


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 8
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 208
Length of database: 608
Length adjustment: 9
Effective length of query: 199
Effective length of database: 599
Effective search space:   119201
Effective search space used:   119201
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information