MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-211A23
Chromosome	13 (Build37)
Map Location	49,502,762 - 49,503,203
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Zfp169, A830005F24Rik, AW456874, Barx1, Phf2, EG667415, BC010304, C030044B11Rik, Wnk2, Ninj1, 1110007C09Rik, Susd3, Fgd3, Bicd2
Downstream gene	Ippk, Cenpp, Tes3-ps, Ecm2, Aspn, Omd, Ogn, Nol8, Iars, LOC667488, LOC670357, EG638833, Gm272, EG667503, EG667507, LOC100040099, LOC625110, LOC676907, LOC667546, LOC667552, LOC100040085, LOC100040159, LOC100040176, LOC100040118, Gm906, 2310081J21Rik, LOC676954, LOC667625, LOC667632
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67911 MGI:1915161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830005F24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442803 MGI:3045249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	AW456874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218232 MGI:2145430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Barx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12022 MGI:103124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18676 MGI:1338034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667415 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667415 MGI:3645592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	BC010304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218236 MGI:2446163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030044B11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68128 MGI:1915378
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs

name	Wnk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75607 MGI:1922857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ninj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18081 MGI:1196617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110007C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68480 MGI:1915730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Susd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66329 MGI:1913579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30938 MGI:1353657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bicd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ippk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75678 MGI:1922928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66336 MGI:1913586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tes3-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54339 MGI:3582925
definition	note : testis derived transcript 3, pseudogene pseudo : _no_value

name	Ecm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407800 MGI:3039578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aspn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66695 MGI:1913945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Omd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27047 MGI:1350918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18295 MGI:109278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70930 MGI:1918180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105148 MGI:2145219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 99 Proteins

name	LOC670357 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins pseudo : _no_value

name	EG638833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638833 MGI:3646144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 231 ESTs, 25 Proteins

name	Gm272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218244 MGI:2685118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 Proteins pseudo : _no_value

name	EG667503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667503 MGI:3643443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG667507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667507 MGI:3645762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040099 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins

name	LOC625110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins pseudo : _no_value

name	LOC676907 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	LOC100040085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100040159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein

name	LOC100040176 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Gm906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380882 MGI:2685752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310081J21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69211 MGI:1916461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC676954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC667632 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667632
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538822 GeneID:67911 MGI:1915161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 169 transcript_id : NM_026450.2

name	A830005F24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264210 GeneID:442803 MGI:3045249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA A830005F24 gene transcript_id : XM_001473764.1

name	AW456874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402212 GeneID:218232 MGI:2145430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW456874 transcript_id : NM_207232.1

name	Barx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347660 GeneID:12022 MGI:103124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BarH-like homeobox 1 transcript_id : NM_007526.2

name	Phf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543475 GeneID:18676 MGI:1338034
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 2 transcript_id : NM_011078.2

name	EG667415 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264212 GeneID:667415 MGI:3645592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG667415 transcript_id : XM_990441.2

name	BC010304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090856 GeneID:218236 MGI:2446163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC010304 transcript_id : NM_001033268.2

name	C030044B11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264214 GeneID:68128 MGI:1915378
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs product : RIKEN cDNA C030044B11 gene transcript_id : XM_001473676.1

name	Wnk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383423 GeneID:75607 MGI:1922857
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WNK lysine deficient protein kinase 2 transcript_id : NM_029361.2

name	Ninj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129888 GeneID:18081 MGI:1196617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ninjurin 1 transcript_id : NM_013610.2

name	1110007C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344140 GeneID:68480 MGI:1915730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110007C09 gene transcript_id : NM_026738.2

name	Susd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130318 GeneID:66329 MGI:1913579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi domain containing 3 transcript_id : NM_025491.3

name	Fgd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719308 GeneID:30938 MGI:1353657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 3 transcript_id : NM_015759.2

name	Bicd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702354 GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bicaudal D homolog 2 (Drosophila) transcript_id : NM_001039179.1

name	Bicd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702357 GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bicaudal D homolog 2 (Drosophila) transcript_id : NM_029791.3

name	Bicd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702358 GeneID:76895 MGI:1924145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bicaudal D homolog 2 (Drosophila) transcript_id : NM_001039180.1

name	Ippk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892241 GeneID:75678 MGI:1922928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,3,4,5,6-pentakisphosphate 2-kinase transcript_id : NM_199056.2

name	Cenpp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343891 GeneID:66336 MGI:1913586
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein P transcript_id : NM_025495.2

name	Ecm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802059 GeneID:407800 MGI:3039578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extracellular matrix protein 2, female organ and adipocyte specific transcript_id : NM_001012324.2

name	Aspn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754117 GeneID:66695 MGI:1913945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asporin transcript_id : NM_025711.2

name	Omd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754933 GeneID:27047 MGI:1350918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : osteomodulin transcript_id : NM_012050.1

name	Ogn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802339 GeneID:18295 MGI:109278
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : osteoglycin transcript_id : NM_008760.3

name	Nol8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486812 GeneID:70930 MGI:1918180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 8 transcript_id : NM_001081350.1

name	Iars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802528 GeneID:105148 MGI:2145219
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isoleucine-tRNA synthetase transcript_id : NM_172015.2

name	LOC667488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264216 GeneID:667488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 99 Proteins product : hypothetical LOC667488 transcript_id : XM_990847.2

name	EG638833 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264219 GeneID:638833 MGI:3646144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 231 ESTs, 25 Proteins product : predicted gene, EG638833 transcript_id : XM_990888.2

name	EG667503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395091 GeneID:667503 MGI:3643443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG667503 transcript_id : XM_990932.1

name	EG667507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395093 GeneID:667507 MGI:3645762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG667507 transcript_id : XM_990959.1

name	LOC100040099 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264224 GeneID:100040099
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : similar to immediate early response 3 interacting protein 1 transcript_id : XM_001474265.1

name	LOC667552 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94395101 GeneID:667552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical LOC667552 transcript_id : XM_991187.1

name	LOC100040085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264222 GeneID:100040085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100040085 transcript_id : XM_001474059.1

name	LOC100040159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264228 GeneID:100040159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : hypothetical protein LOC100040159 transcript_id : XM_001474305.1

name	Gm906 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802418 GeneID:380882 MGI:2685752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 906, (NCBI) transcript_id : NM_001033438.2

name	2310081J21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395109 GeneID:69211 MGI:1916461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 2310081J21 gene transcript_id : XM_991450.1

name	Zfp169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538823 CCDS:CCDS26493.1 GeneID:67911 MGI:1915161
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : GLI-Kruppel family member HKR1 protein_id : NP_080726.2

name	A830005F24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264211 GeneID:442803 MGI:3045249
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473814.1

name	AW456874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402213 CCDS:CCDS26495.1 GeneID:218232 MGI:2145430
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase domain containing 1 protein protein_id : NP_997115.1

name	Barx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671614 GeneID:12022 MGI:103124
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence IMP] [Evidence IGI]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009888 - tissue development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : BarH-like homeobox 1 protein_id : NP_031552.1

name	Phf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543476 CCDS:CCDS26496.1 GeneID:18676 MGI:1338034
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PHD finger protein 2 protein_id : NP_035208.2

name	EG667415 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264213 GeneID:667415 MGI:3645592
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995535.2

name	BC010304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090857 GeneID:218236 MGI:2446163
definition	codon_start : 1 product : hypothetical protein LOC218236 protein_id : NP_001028440.2

name	C030044B11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264215 GeneID:68128 MGI:1915378
definition	codon_start : 1 product : hypothetical protein LOC68128 protein_id : XP_001473726.1

name	Wnk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94536870 GeneID:75607 MGI:1922857
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : WNK lysine deficient protein kinase 2 protein_id : NP_083637.1

name	Ninj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305315 CCDS:CCDS26497.1 GeneID:18081 MGI:1196617
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0042246 - tissue regeneration [Evidence IEA] codon_start : 1 product : ninjurin 1 protein_id : NP_038638.1

name	1110007C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312030 GeneID:68480 MGI:1915730
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : RIKEN cDNA 1110007C09 protein_id : NP_081014.1

name	Susd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21702740 CCDS:CCDS26498.1 GeneID:66329 MGI:1913579
definition	codon_start : 1 product : sushi domain containing 3 protein_id : NP_079767.2

name	Fgd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719309 CCDS:CCDS26499.1 GeneID:30938 MGI:1353657
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0046847 - filopodium formation [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : faciogenital dysplasia homolog 3; Fgd1 family, member 3 product : FYVE, RhoGEF and PH domain containing 3 protein_id : NP_056574.2

name	Bicd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18139547 GeneID:76895 MGI:1924145
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : bicaudal D homolog 2 isoform 2 protein_id : NP_084067.1

name	Bicd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702355 GeneID:76895 MGI:1924145
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : bicaudal D homolog 2 isoform 1 protein_id : NP_001034268.1

name	Bicd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702359 GeneID:76895 MGI:1924145
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : bicaudal D homolog 2 isoform 3 protein_id : NP_001034269.1

name	Ippk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979616 CCDS:CCDS26500.1 GeneID:75678 MGI:1922928
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0035299 - inositol pentakisphosphate 2-kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046853 - inositol and derivative phosphorylation [Evidence ISS] codon_start : 1 product : inositol 1,3,4,5,6-pentakisphosphate 2-kinase protein_id : NP_951011.1

name	Cenpp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789150 CCDS:CCDS26501.1 GeneID:66336 MGI:1913586
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : centromere protein P protein_id : NP_079771.1

name	Ecm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858563 CCDS:CCDS26502.1 GeneID:407800 MGI:3039578
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : extracellular matrix protein 2 protein_id : NP_001012324.1

name	Aspn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754118 CCDS:CCDS26503.1 GeneID:66695 MGI:1913945
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : asporin protein_id : NP_079987.2

name	Omd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754934 CCDS:CCDS26504.1 GeneID:27047 MGI:1350918
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : osteoadherin product : osteomodulin protein_id : NP_036180.1

name	Ogn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679166 CCDS:CCDS26505.1 GeneID:18295 MGI:109278
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : osteoglycin protein_id : NP_032786.1

name	Nol8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486813 GeneID:70930 MGI:1918180
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : nucleolar protein 8 protein_id : NP_001074819.1

name	Iars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789383 GeneID:105148 MGI:2145219
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004822 - isoleucine-tRNA ligase activity [Evidence ISS] [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006428 - isoleucyl-tRNA aminoacylation [Evidence IEA] [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : isoleucyl-tRNA synthetase protein_id : NP_742012.1

name	LOC667488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264217 GeneID:667488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995941.2

name	EG638833 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264220 GeneID:638833 MGI:3646144
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995982.2

name	EG667503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395092 GeneID:667503 MGI:3643443
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996026.1

name	EG667507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395094 GeneID:667507 MGI:3645762
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996053.1

name	LOC100040099 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264225 GeneID:100040099
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474315.1

name	LOC667552 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94395102 GeneID:667552
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996281.1

name	LOC100040085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264223 GeneID:100040085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474109.1

name	LOC100040159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264229 GeneID:100040159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474355.1

name	Gm906 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701949 GeneID:380882 MGI:2685752
definition	GO_process : GO:0006520 - amino acid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC380882 protein_id : NP_001028610.1

name	2310081J21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395110 GeneID:69211 MGI:1916461
definition	codon_start : 1 product : hypothetical protein LOC69211 protein_id : XP_996544.1

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 1 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 2 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 3 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 4 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 5 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 6 pseudo : _no_value

name	Gm272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218244
definition	number : 7 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 7 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 6 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 5 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 4 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 3 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 2 pseudo : _no_value

name	LOC676907 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676907
definition	number : 1 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 10 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 9 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 8 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 7 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 6 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 5 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 4 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 3 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 2 pseudo : _no_value

name	LOC667546 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667546
definition	number : 1 pseudo : _no_value

name	LOC100040176 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040176
definition	number : 2 pseudo : _no_value

name	LOC100040176 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040176
definition	number : 1 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 7 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 6 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 5 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 4 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 3 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 2 pseudo : _no_value

name	LOC676954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676954
definition	number : 1 pseudo : _no_value

name	LOC667632 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667632
definition	number : 1 pseudo : _no_value

name	LOC670357 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264218 GeneID:670357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : hypothetical LOC670357 pseudo : _no_value transcript_id : XR_031421.1

name	LOC625110 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264221 GeneID:625110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to mKIAA1897 protein pseudo : _no_value transcript_id : XR_031471.1

name	LOC100040118 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264226 GeneID:100040118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical protein LOC100040118 pseudo : _no_value transcript_id : XR_031576.1

name	LOC667625 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264227 GeneID:667625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : hypothetical LOC667625 pseudo : _no_value transcript_id : XR_035664.1

clone name	MSMg01-380F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172K09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-405L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-082P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-279D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-162F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-056M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145N07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138A23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-211A23.T7 (MSMg01no211_a23.b1)	MSMg01-211A23.TJ (MSMg01no211_a23.g1)
ACC	AG392942	AG392943
length	1,850	1,262
length of high quality (start - end)	---	414 (73 - 486)
definition	CHROMAT_FILE: MSMg01no211_a23.b1 PHD_FILE: MSMg01no211_a23.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:35:54 2005	CHROMAT_FILE: MSMg01no211_a23.g1 PHD_FILE: MSMg01no211_a23.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:35:54 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GAAATATCATNNNGGGCAAAGATAAAAAGGTGGGGCGGAAACAAAGATAC ATAATTATTGGGGAGGAGGGAATGCCTCCGCGATGTTTCAAACTTTACTC TATATGAGCAACAGTGTCAGTCCCGTTGTCTATATCTATCTTGCCATGTG TTGACTCTGTGATAATGTAAGTTTTATAACCTAGCTAGCACGCTCTCTAG TGATTTTACATTTATACCCCAATGCATCTTGATGGCGTTATACCTTAGTA AATCTGCATCAGCTATGTCTCAAGTAGCATCTATGTAGATGGTGGGAATC TATGTACGTAAGAATTCTACACCCCAATAATAAGTCTGCTATTCATGACA CCTTAGTAAGTATCACTTGATGGAAAACTTGCTCAGACACTTTGACAATG ACATACATTAGAAATCTAATAAATGCAGATATAAAAGAATTTGGAATACC TGCAACTGAAGCTGACACGGATCTAGTCCATTATTGACACTTAACAAATC CTACTGTTAGCTCTAGAAGGACTAAATGCTTTCCCTCTATTTGAGTAAAT TACTCTTGATGCTAGACACCATCAAATCAATATCCATAGCACGCCTAATC ACTCTTACTGAACTCGATTAACTCCTGACCGTTAAATAATATCTCATTTA TACCAAAACAATTTATTTTATACACACAACATTGAACCTATTCACCATCT CTTTCCTTTTACCACCTATATTACCACCAAAAGAATATATTTTTTTTTTT TCTCCCCCCCCACACGTAATAATCATCTCATTCTTTCTCCCCCCCCTAAT AAAAAAAGTGCTTCTGTATTTTTATCTCCTACATTTGCAGCTACAGAATA GTTCGGCTGAACCTATTTACTGCTTCTATAATTCTCATTTATAATTGATT CATACTTAACAACATCCGACTGCATATATTAATCTTATTAGACATTATCG ATATCTCTTATTTATCACCTTTTCTCATTTTTACTAGTATTTATATCAAA CACCATATCTACAACTTAACAACCCGGTACTATCAACAGTTGACTTTAGT ACAATATAATATCGTACAATACGGACAACTATCTCGTTTAACGTCTATGG TGACCATCGATTTCTCTTCTTTCTCGTTTATTTCCCTTCCTACCCCTTTT TCTATACTAATGTCACATGTTACTCTATAATCTACGAACATAGTTGTTCT TATCTTTTACTTATACACCACAAAATACTTATTCCAGTTTAAATTTTATA CTTCAATTCACTCTTCTCTTCAGCTACTTCCTACATGTTGTATAATGATC TGTCTATAACTTTTTAATAGCAAGTATATATTCTACTTCCTTAACTTCCA TAAACTTCACACTTATATGATATGATTAATGATTAAATCTGTCTTCATTC TGATAACTTATCTCTATCTCTGAATAAATTCTTCTCTAGTTCCTAATACT ACTACTCATTCCTTCCTACTTTAGTCTATTATCTCTAATATACTATGTTA AATACACACACACTCACTTATCTACTTACTTCTCACTAAGATACATCAAA TTTGGCTTCTACTATGTACCACAATTATTTTCTAGTTTCGTCTTTTCTCA TTTCTCCGTAGCATCCTGCATGTCATTAACTATTCCTCACTTACGGTATC CACCTCTCACATACACGATCTAATCCTCGACTCCTCTTCACCATGTATCT CTCATACCTCCGCTATACTACTTCTCATCAATTCATTTTAACATCTGCAT CAATTTGATGTAATAGTGTTCTGTCCAATTTCCCAACTCTTATACACGTA ATTAAGATCTATCTAACATTTTATAATATGGACTCTCATATCAAGATGAC	NNAAAATGACTGGAGGCTGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXAGTGATCCTCCTGCCTCAATCTCCTGCT TATGGAAATTACAGATATGAACAACCCTGCCCAGTTGAGATGAACAAATC TCAGAAATTATCATTTCTTTTTAAACATTTATTTACTTTGTAGAGGAGAA GGGCACAGATCTCAGCACATGGGTAGAAGTCAGGGGACAGTTTGTGGAAG TTGGTCCTCTCCTTCTACCATGTAGATTCTGAGGCTCGGACTAAAGTCTT CAGACTTGGGAAGCAAATACCTTTACCTGATAAAGCAAATATCTTTAATT TCTCACTCAGCCAGCTTTTGTCCACATCTACCTTGCCTTGCCTTTTCTTT TTCTTTTCTTTTTCTTTTCTTTTCTTTTCTCTTCTTTTCTCTTCTTTTTT TTTTTTCCCCCCCCCCTTTCCTTTCTTTCTTCTTTAAACAAAACTTTTCT TTTCTTTTCTTTTCTTTTTTCTTTTCTTTTCTTTTCTTTTTGAAACAAGG TCTTACTATGTATCCCTGCTTGGCCTGGGACTCTATCTGCAGACTCAGAG ATCTGCCTGTCTGTCTCCTGAGTGCTGAGATTAAAAGCATACATCACCAC ACCCAGCCCACAAATAACTTTTTAAATAAAACATCAATGGGGGGGTGGTC TGGGGGACTTTTGGGATAGCATTTGAAATGTAAATGAAGAAAATACCTAA TTAACAAAAATCAATTGGTATAATCTATGGATGAGATAATTAAAAGTTTG GAGCTTACATTAGTTGCTTTTGCTCAACACTGTGTCCCAATGAACCACAA ATATCCCCCGGGGGGTGGCCTATATTTGTTCCCCCCTCCTTCTGATATAT GATTGCTTTCTCGAATTATACCTACGAATCTCTTACCTCTTATTACTTAA AATGGCCGCTCATATCTTTCTATTAAGAACTTTTCCCCCGTTCACCTCTC TCCTAATGCAATACTCTTTTGTCTACAAACCTTTCTCCGGTATTTTTTCT TATCTTTCTCTTACTCCCTATTTTTTACTCTTCACCATCCGGCCTTCTCA ATCTCTCTATTTCCTCCCTTCTTTATCTCTTCTCTATTTTCATTCCTTTT TTCTCTCTTGTCCCTCTCCTCTTCTATACTTATCACTTCTTTCACCTTCA ACCTTCCTCTCTCTGTTCTCACTCATCACTATCCTTTCGCTCTCTATACT CTTACTTCTATG
quality values	Open. Hide. 6 6 10 8 9 7 8 8 9 3 0 0 0 3 21 10 10 11 11 11 8 8 8 8 8 8 12 12 8 8 8 8 8 8 13 11 11 10 6 6 6 6 6 11 8 8 6 6 8 8 8 8 9 9 9 10 8 8 6 6 8 10 8 8 8 8 8 9 9 9 11 10 8 8 8 10 10 10 10 9 10 10 10 9 9 8 8 8 8 7 6 8 10 8 9 10 10 8 8 8 8 8 8 8 6 6 8 8 8 10 8 6 6 6 8 8 8 8 6 8 10 8 9 9 9 9 9 10 8 6 6 6 7 8 8 10 8 8 8 8 8 9 10 10 8 8 6 6 8 8 8 8 8 8 11 8 8 11 9 9 9 10 8 8 8 8 8 8 6 6 8 8 8 9 9 9 9 9 9 9 8 8 8 9 9 9 9 9 9 8 8 8 8 8 6 8 9 9 10 8 8 8 8 8 8 8 8 6 8 8 10 10 8 10 8 8 8 10 10 13 8 8 8 8 8 8 8 8 9 9 9 9 9 8 8 8 8 8 8 10 11 8 8 8 8 8 8 6 6 8 8 10 9 8 8 8 10 10 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 6 6 8 8 8 8 8 10 8 8 6 6 8 8 8 8 8 8 9 9 11 11 8 8 8 8 8 8 8 8 8 6 6 8 8 9 8 6 8 8 6 6 8 8 8 6 6 8 8 11 11 11 9 9 9 8 8 8 8 8 8 8 8 6 6 8 8 6 6 8 8 8 8 8 8 8 8 11 11 11 12 11 9 9 8 8 6 6 8 8 11 10 10 9 8 8 8 11 8 11 10 8 8 8 8 8 8 8 8 9 9 9 10 10 10 10 12 10 8 8 8 8 8 8 8 8 10 8 8 8 8 8 10 10 9 9 10 11 8 8 8 6 6 8 8 9 10 11 8 8 8 8 8 8 8 8 8 8 8 11 11 11 11 10 9 9 9 9 9 10 9 8 8 8 8 8 8 8 8 6 6 8 10 9 9 10 11 9 8 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 11 8 8 6 6 8 8 8 6 6 8 8 8 8 8 8 8 9 10 10 10 10 10 10 11 12 9 10 9 9 9 9 8 8 8 8 6 6 8 8 8 10 8 8 8 8 8 9 9 8 8 8 8 8 9 12 10 8 8 8 9 8 8 8 8 8 8 11 11 10 11 11 9 8 8 8 8 8 12 11 11 10 8 8 8 6 6 8 8 8 10 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 9 9 8 9 9 10 8 8 7 6 8 8 8 7 7 8 8 10 10 9 8 8 8 8 8 8 8 10 9 9 8 8 8 8 8 8 8 9 8 8 8 9 9 9 9 9 10 8 8 8 8 8 8 6 6 8 6 6 8 6 7 8 8 8 8 8 8 8 8 8 12 12 13 13 10 10 6 7 6 6 8 8 10 8 8 9 9 11 11 11 11 11 11 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 7 7 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 9 9 8 8 8 8 8 8 9 12 15 24 19 19 21 22 23 23 18 8 12 7 7 8 8 10 15 24 28 21 12 8 8 6 8 8 8 8 8 9 9 9 9 10 10 8 8 8 9 8 8 8 11 10 8 8 8 8 8 8 10 10 9 9 9 9 9 8 8 8 8 10 10 11 9 13 13 9 8 8 10 8 8 8 8 8 8 8 8 8 8 9 13 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 6 6 10 6 6 8 8 8 8 8 8 8 8 6 6 8 8 10 10 10 9 9 11 9 8 8 8 8 8 8 10 8 8 8 10 8 8 8 8 8 8 8 8 8 9 12 12 10 9 10 8 8 8 9 9 12 11 11 11 12 12 11 11 11 8 8 8 8 10 8 6 6 8 8 12 12 10 10 10 10 10 10 10 10 10 11 11 11 11 11 9 9 9 9 9 8 10 10 10 8 8 8 8 8 8 9 9 8 8 8 8 8 8 8 6 6 8 8 8 8 9 8 8 8 8 8 8 11 10 10 9 8 8 8 8 8 8 16 15 12 12 11 11 10 9 8 8 8 8 8 8 10 10 10 10 10 10 9 8 8 8 8 8 10 8 8 8 8 8 6 6 8 8 8 8 8 8 9 12 12 12 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 10 8 6 6 8 8 10 8 8 8 8 8 8 11 11 12 12 8 8 8 8 8 8 9 9 11 11 8 8 6 6 8 8 8 8 6 6 8 8 8 8 6 6 8 8 11 11 11 9 8 8 8 8 8 10 10 10 10 9 9 9 9 9 9 8 8 6 6 8 8 9 10 10 10 9 9 9 9 8 8 6 6 8 8 9 9 9 11 10 10 10 10 10 11 11 10 10 11 11 10 9 8 8 8 8 8 8 8 10 11 11 10 19 13 10 10 10 9 10 9 9 9 9 9 9 10 10 10 10 10 10 12 12 9 10 10 8 8 8 8 8 8 8 8 10 11 12 12 16 12 14 10 10 10 10 8 8 8 8 8 7 9 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 6 6 8 8 11 10 10 8 8 6 6 8 8 12 10 10 8 8 8 10 8 8 8 8 8 8 9 8 10 8 8 8 8 8 8 10 12 12 12 12 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 6 6 8 6 9 9 8 8 8 8 8 6 6 8 8 11 15 8 8 6 6 8 8 9 9 9 9 9 8 8 8 8 8 9 9 10 10 10 10 10 10 10 10 10 10 8 8 8 8 8 8 6 6 8 8 10 10 10 10 8 6 6 8 8 11 8 8 10 8 6 6 8 8 8 6 6 8 6 8 9 9 15 9 10 10 12 9 9 11 11 11 9 8 8 8 8 8 8 8 8 8 10 6 6 6 6 8 8 11 8 8 6 6 8 8 8 8 8 8 6 8 6 6 8 8 8 8 8 8 8 11 12 10 11 8 8 8 8 8 8 11 11 10 8 8 8 8 8 8 8 12 10 13 10 10 11 10 8 8 6 7 8 8 8 8 9 12 12 8 8 8 8 8 8 10 11 10 10 10 11 12 8 10 9 10 10 10 10 11 11 8 8 8 8 9 9 8 8 8 6 6 8 8 10 8 9 9 9 10 10 11 11 10 9 8 8 6 6 8 8 8 8 8 8 8 8 10 10 10 10 8 8 8 8 6 6 8 8 6 7 8 8 12 8 10 8 8 8 8 10 8 8 6 6 8 6 6 8 6 7 8 8 10 8 8 8 8 8 8 8 8 8 8 6 8 8 8 8 8 8 9 10 11 10 9 10 9 9 9 13 8 8 8 8 8 8 12 15 10 9 9 9 9 8 8 8 8 9 10 10 11 11 11 11 11 12 15 11 9 9 9 9 11 9 8 8 7 6 8 8 8 8 10 8 8 8 8 8 8 8 6 8 8 8 6 6 6 8 8 8 8 8 8 8 11 11 8 8 8 13 12 8 10 9 10 10 8 8 8 8 8 8 8 8 12 11 11 11 11 12 9 8 8 8 8 8 12 15 10 10 10 10 12 12 12 11 9 9 8 8 8 6 8 6 6 8 8 11 12 11 11 10 10 8 8 6 6 8 8 8 8 8 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 11 11 10 10 9 8 8 8 8 10 8 8 6 6 8 8 8 8 8 8 6 6 8 8 10 10 10 8 8 6 6 6 6 8 6 10 11 11 8 8 6 6 8 8 11 11 10 9 9 9 9 9 10 10 9 9 8 8 8 8 8 8 11 10 8 8 8 8 8 10 10 8 8 8 8 11 11 12 11 11 10 10 10 10 10 10 10 9 10 11 9 8 8 8 8 8 9 10 9 8 8 8 8 6 6 8 8 8 8 8	Open. Hide. 0 0 3 6 6 6 9 7 6 6 6 8 8 8 9 9 10 7 6 6 12 21 19 15 9 8 8 7 8 8 10 19 19 20 23 18 21 21 30 32 36 36 36 36 36 36 38 37 37 37 47 53 53 53 53 53 59 57 57 68 57 57 57 57 42 39 35 35 39 39 46 42 50 48 48 57 57 57 68 57 57 50 50 50 50 50 50 50 51 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 57 57 59 59 44 43 52 52 37 52 57 50 50 50 50 57 57 59 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 68 68 68 57 57 57 57 57 57 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 68 68 59 59 59 57 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 59 59 57 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 68 68 68 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 54 54 52 57 57 57 52 52 52 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 57 57 57 57 48 48 47 57 59 59 59 59 59 59 59 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 68 68 68 57 57 57 59 57 68 68 68 68 68 68 59 59 57 57 57 59 59 59 48 48 48 59 59 59 59 59 59 59 59 59 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 48 48 48 57 57 57 59 59 59 59 59 59 59 59 59 27 25 15 19 19 33 32 32 24 18 18 15 15 17 26 36 37 31 21 28 24 28 31 59 59 59 59 59 59 59 59 43 47 39 39 32 28 21 12 12 10 10 10 10 10 10 10 10 10 10 11 15 17 19 30 36 59 59 59 59 59 59 59 59 59 59 59 59 48 48 48 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 59 59 68 68 59 59 54 54 54 59 59 68 57 57 57 57 57 57 48 48 48 57 57 57 68 68 57 57 57 57 57 47 47 48 48 57 48 57 57 57 57 48 48 48 59 57 57 57 43 43 37 43 44 59 57 57 47 43 43 43 43 43 57 44 42 42 30 30 42 44 57 57 48 47 47 47 48 41 43 43 48 48 54 57 59 59 59 59 59 59 59 48 48 34 34 24 14 14 34 34 37 32 28 28 21 30 14 17 15 28 19 28 37 32 32 36 32 32 30 30 28 34 28 34 32 26 26 35 39 37 41 41 41 40 34 37 35 35 37 39 37 37 37 30 30 30 37 37 43 37 37 33 31 23 20 20 20 32 32 40 40 39 37 41 36 31 22 28 28 30 28 22 28 28 39 33 34 34 41 34 30 20 12 10 10 11 14 17 16 22 22 30 30 24 19 19 24 18 18 9 9 9 9 9 19 16 13 13 18 22 13 13 11 11 15 27 22 28 21 21 15 8 8 8 8 8 8 9 15 15 11 11 11 10 10 10 10 11 15 12 14 13 24 18 23 23 24 16 18 20 19 24 15 16 11 11 11 15 21 19 10 10 8 10 8 8 9 8 14 12 19 15 10 10 10 8 8 8 10 10 8 9 9 10 10 10 9 10 15 12 13 8 8 11 13 13 11 11 11 15 14 18 10 10 9 9 9 9 10 10 13 14 14 14 9 10 9 9 9 10 10 9 9 10 15 10 10 10 10 9 12 10 8 8 10 10 11 9 9 8 10 8 8 8 12 13 10 8 8 8 9 9 11 11 10 8 8 8 8 8 8 8 8 13 8 8 6 6 8 8 10 13 10 10 10 8 8 8 8 8 9 10 10 10 10 8 8 8 8 8 8 8 9 10 10 9 8 8 8 8 10 8 8 8 8 6 6 8 8 9 9 9 10 9 9 10 10 11 11 11 13 11 11 12 11 10 10 10 10 10 12 12 12 15 16 15 10 10 10 12 10 11 9 11 9 9 9 15 18 17 14 13 12 10 9 7 8 8 8 8 8 8 8 8 6 6 8 6 6 8 8 8 10 10 12 10 9 8 8 8 6 6 8 6 9 9 10 10 8 8 7 7 6 8 6 6 8 8 8 10 10 8 8 10 8 8 6 6 8 8 6 6 10 12 22 25 25 24 25 16 16 11 11 9 8 10 10 8 8 8 10 10 10 10 8 8 8 8 8 8 8 12 12 12 8 8 8 8 8 8 7 6 8 8 8 8 8 10 6 6 8 8 8 8 8 8 10 6 6 6 8 10 10 10 8 8 8 8 8 13 10 10 9 8 8 8 6 6 6 7 8 8 6 6 6 6 8 8 9 9 9 8 8 8 8 8 8 10 13 9 9 9 10 9 13 13 15 16 17 10 10 10 8 8 8 6 8 8 8 6 8 8 8 8 8 8 8 8 13 18 10 8 8 12 15 8 8 9 9 9 10 10 8 8 6 6 8 7 7 10 8 7 7 8 8 8 8 6 6 6 8 8 8 8 9 10 13 10 14 14 11 11 10 9 11 8 13 8 8 8 8 7 6 8 8 6 6 6 6 8 8 10 7 7 8 6 6 8 6 6 8 10 13 8 6 6 6 6 6 7 7 8 8 8 8 8 8 8 8 8 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no211_a23.g1 MSMg01no211_a23.g1 CHROMAT_FILE:
MSMg01no211_a23.g1 PHD_FILE: MSMg01no211_a23.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:35:54 2005
         (414 letters)



>mm_chr13_49502621_49503434
          Length = 814

 Score =  685 bits (354), Expect = 0.0
 Identities = 409/442 (92%), Gaps = 29/442 (6%)
 Strand = Plus / Minus

                                                                       
Query: 1   agtgatcctcctgcctcaatctcctgcttatggaaattacagatatgaacaaccctgccc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 agtgatcctcctgcctcaatctcctgcttatggaaattacagatatgaacaaccctgccc 524

                                                                       
Query: 61  agttgagatgaacaaatctcagaaattatcatttctttttaaacatttatttactttgta 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 agttgagatgaacaaatctcagaaattatcatttctttttaaacatttatttactttgta 464

                                                                       
Query: 121 gaggagaagggcacagatctcagcacatgggtagaagtcaggggacagtttgtggaagtt 180
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 463 gaggagaagggcacagatctcagcacatgggtagaagtcaggggacagtttggggaagtt 404

                                                                       
Query: 181 ggtcctctccttctaccatgtagattctgaggctcggactaaagtcttcagacttgggaa 240
           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 ggttctctccttctaccatgtagattctgaggctcggactaaagtcttcagacttgggaa 344

                                                                       
Query: 241 gcaaatacctttacctgataaagcaaatatctttaatttctcactcagccagcttttgtc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 gcaaatacctttacctgataaagcaaatatctttaatttctcactcagccagcttttgtc 284

                                                                       
Query: 301 cacatctaccttgccttgccttttctttt-----tcttttctttt---------tctttt 346
           |||||||||||||||||||||||||||||     |||||||||||         ||||||
Sbjct: 283 cacatctaccttgccttgccttttcttttctttttcttttcttttcttttcttttctttt 224

                                                                       
Query: 347 cttttcttttctcttcttttctcttctttt------tttt-ttttcccc--cc---cc-- 392
           ||||||||||||||||||||||||||||||      |||| ||||| |   ||   ||  
Sbjct: 223 cttttcttttctcttcttttctcttcttttctcttcttttcttttctctttcctttcctt 164

                                 
Query: 393 -cctttcctttctttcttcttt 413
            |||||||||||||||||||||
Sbjct: 163 tcctttcctttctttcttcttt 142


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 50
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 3
Number of HSP's successfully gapped: 1
Length of query: 414
Length of database: 814
Length adjustment: 9
Effective length of query: 405
Effective length of database: 805
Effective search space:   326025
Effective search space used:   326025
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information