MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-096L14
Chromosome	14 (Build37)
Map Location	6,155,634 - 6,291,700
singlet/doublet	doublet
Overlap gene	LOC666637, EG622640, LOC100041333, LOC100041678, LOC100041702, LOC100041363
Upstream gene	4930555G01Rik, EG666772, LOC666765, LOC100041401, LOC100041105, EG666750, LOC666743, LOC100041447, LOC673138, LOC666740, LOC641258, LOC673685, LOC100041158, LOC100041501, LOC100041515, LOC100041184, EG666706, LOC100041195, LOC100041545, LOC100041565, LOC100041215, LOC100041226, ENSMUSG00000057445, LOC100041598, LOC100041243, EG666684, LOC100041268, LOC100041279, LOC100041651, LOC100041287, LOC100041299
Downstream gene	LOC100041721, LOC100041784, LOC100041735, LOC100041406, LOC100041825, LOC100041421, LOC100041817, LOC100041431, LOC100041438, LOC100041442, LOC100041848, LOC100041456, LOC100041758, LOC100041470, LOC100041804, LOC100041487, LOC100041747, LOC100041507, LOC100041836, LOC100041728, LOC100041774, LOC100041530, LOC100041540, LOC100041840, EG666844, LOC666851, LOC100041569, LOC100041970, LOC100042000, EG666874, B930046C15Rik, LOC100041600, LOC100041958, LOC100041964
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930555G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108978 MGI:1922055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666772 MGI:3647811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins pseudo : _no_value

name	LOC666765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 26 ESTs, 10 Proteins

name	LOC100041401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein pseudo : _no_value

name	LOC100041105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666750 MGI:3648017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 10 Proteins

name	LOC666743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041447 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 8 Proteins pseudo : _no_value

name	LOC673138 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC641258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC673685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041158 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041501 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein pseudo : _no_value

name	LOC100041184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins

name	EG666706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041226 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	ENSMUSG00000057445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622931 MGI:3704419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein

name	LOC100041598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666684 MGI:3644039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 1 Protein pseudo : _no_value

name	LOC100041268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	LOC100041279 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein pseudo : _no_value

name	LOC100041651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 22 ESTs, 8 Proteins

name	LOC100041287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein pseudo : _no_value

name	EG622640 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 21 ESTs, 10 Proteins

name	LOC100041363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 26 ESTs, 9 Proteins

name	LOC100041735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein pseudo : _no_value

name	LOC100041406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041438 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100041442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 7 Proteins pseudo : _no_value

name	LOC100041456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 30 ESTs, 8 Proteins

name	LOC100041487 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins

name	LOC100041747 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 90 ESTs, 1 Protein pseudo : _no_value

name	LOC100041507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041836 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein pseudo : _no_value

name	LOC100041774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 9 Proteins

name	LOC100041530 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 105 ESTs, 1 Protein pseudo : _no_value

name	LOC100041540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins

name	EG666844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666844 MGI:3646015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC666851 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100041569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC100041970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 24 ESTs, 8 Proteins

name	LOC100042000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	EG666874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666874 MGI:3647183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	B930046C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544998 MGI:2441866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	LOC100041600 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 1 Protein pseudo : _no_value

name	LOC100041964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 7 Proteins

name	4930555G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381650 GeneID:108978 MGI:1922055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930555G01 gene transcript_id : NM_175393.3

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264972 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476808.1

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396550 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 24 ESTs, 9 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_985877.1

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264974 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476830.1

name	EG666750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264976 GeneID:666750 MGI:3648017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 10 Proteins product : predicted gene, EG666750 transcript_id : XM_985778.2

name	LOC666740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264901 GeneID:666740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : hypothetical LOC666740 transcript_id : XM_985716.2

name	LOC641258 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264905 GeneID:641258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475869.1

name	LOC100041158 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264915 GeneID:100041158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001475892.1

name	LOC100041184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264924 GeneID:100041184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475932.1

name	EG666706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264991 GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : predicted gene, EG666706, transcript variant 1 transcript_id : XM_985542.2

name	LOC100041215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264927 GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475986.1

name	LOC100041226 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264929 GeneID:100041226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476002.1

name	LOC100041598 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265001 GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 29 ESTs, 7 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477003.1

name	LOC100041598 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264999 GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477020.1

name	LOC100041243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264932 GeneID:100041243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476033.1

name	LOC100041651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265005 GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477044.1

name	LOC100041651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265007 GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 20 ESTs, 7 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477032.1

name	LOC100041287 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264949 GeneID:100041287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476104.1

name	EG622640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265015 GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 8 Proteins product : predicted gene, EG622640, transcript variant 2 transcript_id : XM_889197.3

name	EG622640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265013 GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG622640, transcript variant 1 transcript_id : XM_001477087.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265022 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 19 ESTs, 9 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477101.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265018 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477115.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265020 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001477131.1

name	LOC100041784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265037 GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477242.1

name	LOC100041784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265039 GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477252.1

name	LOC100041825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265048 GeneID:100041825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477338.1

name	LOC100041438 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264978 GeneID:100041438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : hypothetical protein LOC100041438 transcript_id : XM_001476390.1

name	LOC100041442 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264980 GeneID:100041442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001476403.1

name	LOC100041456 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264983 GeneID:100041456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476419.1

name	LOC100041804 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265045 GeneID:100041804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 28 ESTs, 7 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477275.1

name	LOC100041804 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265043 GeneID:100041804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477298.1

name	LOC100041487 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264986 GeneID:100041487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001476447.1

name	LOC100041836 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265050 GeneID:100041836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477361.1

name	LOC100041774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265033 GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 21 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477197.1

name	LOC100041774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265035 GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477217.1

name	LOC100041840 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265052 GeneID:100041840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477400.1

name	LOC100041569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264996 GeneID:100041569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical protein LOC100041569 transcript_id : XM_001476596.1

name	LOC100041970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265070 GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 7 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477506.1

name	LOC100041970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265068 GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477521.1

name	LOC100042000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265079 GeneID:100042000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001477589.1

name	B930046C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265074 GeneID:544998 MGI:2441866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : RIKEN cDNA B930046C15 gene transcript_id : XM_001477541.1

name	LOC100041964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265066 GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 6 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477474.1

name	LOC100041964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265064 GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477494.1

name	4930555G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425104 GeneID:108978 MGI:1922055
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC108978 protein_id : NP_780602.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264975 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476880.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264973 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476858.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396551 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_990971.1

name	EG666750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264977 GeneID:666750 MGI:3648017
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_990872.2

name	LOC666740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264902 GeneID:666740
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990810.2

name	LOC641258 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264906 GeneID:641258
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001475919.1

name	LOC100041158 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264916 GeneID:100041158
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475942.1

name	LOC100041184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264925 GeneID:100041184
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475982.1

name	EG666706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264992 GeneID:666706 MGI:3644639
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_990636.2

name	LOC100041215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264928 GeneID:100041215
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476036.1

name	LOC100041226 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264930 GeneID:100041226
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476052.1

name	LOC100041598 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265000 GeneID:100041598
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477070.1

name	LOC100041598 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265002 GeneID:100041598
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477053.1

name	LOC100041243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264933 GeneID:100041243
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476083.1

name	LOC100041651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265006 GeneID:100041651
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477094.1

name	LOC100041651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265008 GeneID:100041651
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477082.1

name	LOC100041287 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264950 GeneID:100041287
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476154.1

name	EG622640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265014 GeneID:622640 MGI:3646283
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477137.1

name	EG622640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952965 GeneID:622640 MGI:3646283
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_894290.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265019 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477165.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265021 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001477181.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265023 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477151.1

name	LOC100041784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265040 GeneID:100041784
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477302.1

name	LOC100041784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265038 GeneID:100041784
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477292.1

name	LOC100041825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265049 GeneID:100041825
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477388.1

name	LOC100041438 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264979 GeneID:100041438
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476440.1

name	LOC100041442 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264981 GeneID:100041442
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476453.1

name	LOC100041456 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264984 GeneID:100041456
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476469.1

name	LOC100041804 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265044 GeneID:100041804
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477348.1

name	LOC100041804 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265046 GeneID:100041804
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477325.1

name	LOC100041487 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264987 GeneID:100041487
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001476497.1

name	LOC100041836 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265051 GeneID:100041836
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477411.1

name	LOC100041774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265036 GeneID:100041774
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477267.1

name	LOC100041774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265034 GeneID:100041774
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477247.1

name	LOC100041840 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265053 GeneID:100041840
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477450.1

name	LOC100041569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264997 GeneID:100041569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476646.1

name	LOC100041970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265069 GeneID:100041970
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477571.1

name	LOC100041970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265071 GeneID:100041970
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477556.1

name	LOC100042000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265080 GeneID:100042000
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477639.1

name	B930046C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265075 GeneID:544998 MGI:2441866
definition	codon_start : 1 product : hypothetical protein LOC544998 protein_id : XP_001477591.1

name	LOC100041964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265065 GeneID:100041964
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477544.1

name	LOC100041964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265067 GeneID:100041964
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477524.1

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 4 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 3 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 2 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 1 pseudo : _no_value

name	LOC666743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666743
definition	number : 2 pseudo : _no_value

name	LOC666743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666743
definition	number : 1 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 1 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 2 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 3 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 4 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 1 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 2 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 3 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 1 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 2 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 3 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 5 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 4 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 3 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 2 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 1 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 4 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 3 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 2 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 1 pseudo : _no_value

name	LOC100041421 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041421
definition	number : 2 pseudo : _no_value

name	LOC100041421 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041421
definition	number : 1 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 1 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 2 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 3 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 4 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 4 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 3 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 2 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 1 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 4 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 3 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 2 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 1 pseudo : _no_value

name	EG666844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666844
definition	number : 1 pseudo : _no_value

name	LOC666851 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666851
definition	number : 1 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 1 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 2 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 3 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 4 pseudo : _no_value

name	EG666772 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264970 GeneID:666772 MGI:3647811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins product : predicted gene, EG666772 pseudo : _no_value transcript_id : XR_032904.1

name	LOC100041401 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264971 GeneID:100041401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein product : hypothetical protein LOC100041401 pseudo : _no_value transcript_id : XR_032912.1

name	LOC100041447 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264982 GeneID:100041447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825 pseudo : _no_value transcript_id : XR_032958.1

name	LOC673685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264988 GeneID:673685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical LOC673685 pseudo : _no_value transcript_id : XR_032967.1

name	LOC100041501 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264989 GeneID:100041501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041501 pseudo : _no_value transcript_id : XR_032973.1

name	LOC100041515 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264990 GeneID:100041515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032977.1

name	LOC100041195 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264926 GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032499.1

name	LOC100041545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264994 GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041545 pseudo : _no_value transcript_id : XR_033000.1

name	LOC100041565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264995 GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical protein LOC100041565 pseudo : _no_value transcript_id : XR_033011.1

name	ENSMUSG00000057445 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264931 GeneID:622931 MGI:3704419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : predicted gene, ENSMUSG00000057445 transcript_id : XR_032520.1

name	EG666684 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264940 GeneID:666684 MGI:3644039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 1 Protein product : predicted gene, EG666684 pseudo : _no_value transcript_id : XR_032534.1

name	LOC100041268 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264942 GeneID:100041268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032545.1

name	LOC100041279 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264947 GeneID:100041279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein product : hypothetical protein LOC100041279 pseudo : _no_value transcript_id : XR_032551.1

name	LOC666637 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264952 GeneID:666637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein product : hypothetical LOC666637 pseudo : _no_value transcript_id : XR_032568.1

name	LOC100041678 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265012 GeneID:100041678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033046.1

name	LOC100041721 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265024 GeneID:100041721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins product : hypothetical protein LOC100041721 pseudo : _no_value transcript_id : XR_033072.1

name	LOC100041735 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265026 GeneID:100041735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein product : hypothetical protein LOC100041735 pseudo : _no_value transcript_id : XR_033088.1

name	LOC100041817 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265047 GeneID:100041817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 6 Proteins product : similar to Predicted gene, EG432825 pseudo : _no_value transcript_id : XR_033173.1

name	LOC100041848 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265054 GeneID:100041848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 7 Proteins product : hypothetical protein LOC100041848 pseudo : _no_value transcript_id : XR_033227.1

name	LOC100041758 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265030 GeneID:100041758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041758 pseudo : _no_value transcript_id : XR_033105.1

name	LOC100041470 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264985 GeneID:100041470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032739.1

name	LOC100041747 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265029 GeneID:100041747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 90 ESTs, 1 Protein product : hypothetical protein LOC100041747 pseudo : _no_value transcript_id : XR_033096.1

name	LOC100041728 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265025 GeneID:100041728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein product : hypothetical protein LOC100041728 pseudo : _no_value transcript_id : XR_033083.1

name	LOC100041530 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264993 GeneID:100041530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 105 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032805.1

name	EG666874 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264998 GeneID:666874 MGI:3647183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : predicted gene, EG666874 pseudo : _no_value transcript_id : XR_001934.2

name	LOC100041958 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265063 GeneID:100041958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 1 Protein product : hypothetical protein LOC100041958 pseudo : _no_value transcript_id : XR_033237.1

clone name	B6Ng01-196B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-096L14.b	B6Ng01-096L14.g
ACC	DH907292	DH907293
length	1,121	277
definition	DH907292\|Mus musculus domesticus DNA, BAC clone: B6Ng01-096L14, 5' end.	DH907293\|Mus musculus domesticus DNA, BAC clone: B6Ng01-096L14, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(6,155,634 - 6,156,756)	(6,291,424 - 6,291,700)
sequence	gaattctaactgctttattagacgtcatgtgcttttgagggggaatgttg gttaggactgacatgcttaagagattttgttagcacccaaatctctagga attgtggattaggtagatgtttcacaacaataaatataccagctgtgtca attcatgtgacatacactccaatttcccagggttatcctgtctcacagag gcaaatatctttctcctataggtttaattgtacaaaatatggacaatatt ttctaacggtgtattccttgatacggggcatttttttcatatatatgtat atatatatccatgagttttacaaaatctctggtttacaaccctatctttt agaaagaaaactccctattcttttgaacatacggaatcatctacagggca aatataaatggtaaacttgctgtcccttcttcaaaacattatcctgcaca tgctcccgttctcaaatacaactagacaatttaagtgggcatcagagagt aatggttatcctggactgtacattactgcattgtagcctcatagcaatta cttctccaatatctgtcttcctgaattgctaagttgagaaatgagggtgt tgctggttgtaacatcatactgtactcacagcaaatataatactcagaag gtagggctgggagtgcaatgacctgagttgagatgaaacctcaattttaa tgtgtctataaggtcaggatgctgtccctttggcattatcatctctggct tctctgttcttatgctggctttcctgaacctgtgctataataccccccaa ccacacagatttaagagtgaaaaatcatgtatatcttctttcagaaaaca tctgaatttcactaccttcttgatccacacaatatcaatatgcacagctc aaaaatcacagggagataggtgatggctgcaaagatgagggctttttctt acaattagggcacatatttttttccaatatgatttttcctttcctctttc actaaaggtggcttgtgtgttgctggcctaaagggttctggttccaacaa catgggggcttactcatacaggcctcaatttacaagaaaagaattgtgta gaattcatgtccgttacagca	cactgcaccttttttctatgcagtactgggaactaaatccagagcttcat gcatactagcaaagcagtataccagtgagctgcctccccagcccaaactg ttctgcactgttcactgcctgccaaacaggggcatgaccccggggacctt caatgggaactaaagtgagtgggcttgttctaatgataatattcacattg caagtatttaataactatgcagtcactcatgaaaagatatttgtgtgtgt gtgtgtgtgtgtgtgtgtgtgtgtgtg
quality values	Open. Hide. 61 42 32 38 61 61 61 50 61 61 47 61 61 61 61 61 50 61 61 35 47 61 49 49 49 49 49 16 20 11 14 12 19 36 36 30 32 41 52 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 39 59 37 35 32 43 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 59 61 61 59 55 59 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 39 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 53 61 61 61 57 57 57 38 57 57 53 52 57 57 57 57 53 45 57 53 57 57 57 57 57 57 45 57 57 52 53 47 57 52 57 57 53 57 53 57 57 57 53 53 57 57 57 45 57 43 53 53 53 53 57 50 53 50 50 53 52 57 53 53 53 53 45 57 52 37 47 30 53 39 57 52 33 57 57 57 47 52 38 52 52 42 57 47 52 53 38 46 57 50 57 41 32 52 53 52 57 45 52 30 50 57 57 50 36 57 53 53 36 37 42 57 57 45 40 52 38 57 38 41 38 50 45 40 45 42 53 33 41 24 44 44 30 53 35 29 53 39 53 53 42 38 53 47 27 53 37 53 52 30 42 41 38 34 40 50 42 52 53 42 40 38 39 57 35 41 53 44 52 53 40 57 27 36 39 29 34 42 42 40 37 37 57 37 36 53 52 37 28 44 40 32 40 52 20 16 33 53 37 53 47 29 29 37 37 44 37 35 37 57 53 53 45 35 25 41 37 44 24 53 34 44 29 33 37 25 57 29 31 30 17 46 16 30 31 29 46 46 46 30 30 30 35 30 46 29 25 32 27 30 30 39 28 34 36 46 43 22 23 12 47 46 46 18 21 25 29 29 29 28 48 29 20 46 30 39 29 29 29 29 41 33 29 25 33 13 29 48 35 35 35 29 20 29 22 35 17 29 33 38 33 38 35 28 29 29 29 28 32 28 36 23 30 29 31 29 28 51 51 46 30 29 28 21 30 21 33 51 33 13 15 28 22 33 28 29 25 28 31 15 43 29 26 31 28 28 21 39 25 14 29 20 28 43 25 51 31 22 29 51 51 51 21 28 24 31 25 24 22 29 19 29 30 26 46 34 14 23 23 21 26 28 27 51 51 51 51 44 19 21 32 21 28 10 13 27 27 27 11 51 51 44 32 9 30 20 51 19 28 22 20 26 12 51 28 23 11 12 27 23 25 5 23 30 9 6 17 5 13 14 36 9 28 12 32 30 13 26 31 22 24 22 12 22 23 17 26 14 6 18 17 7 8 39 17 23 12 22 17 21 23 28 7 6 21 9 19 19 25 19 30 35 35 24 21 29 22 26 26 26 6 4 6 7 15 6 14 29 9 8 12 21 13 12 11 33 26 9 9 4 9 9 25 30 30 21 12 5 14 12 6 6 29 6 13 6 4 13 23 13 7 7 4 5 14 6 26 10 5 5 4 5 7 4 7 10 26	Open. Hide. 23 14 24 18 23 18 12 18 23 19 32 59 61 61 61 59 59 59 61 61 59 59 59 59 61 59 61 61 59 59 59 59 61 61 61 61 59 61 61 59 59 59 61 59 61 59 59 49 36 43 43 44 37 52 59 61 61 61 59 61 61 61 61 59 59 61 59 61 61 61 55 59 61 59 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 50 50 24 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_6155634_6156756
seq2: B6Ng01-096L14.b_47_1167

seq1  GAATTCTAACTGCTTTATTAGACGTCATGTGCTTTTGAGGGGGAATGTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAACTGCTTTATTAGACGTCATGTGCTTTTGAGGGGGAATGTTG  50

seq1  GTTAGGACTGACATGCTTAAGAGATTTTGTTAGCACCCAAATCTCTAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAGGACTGACATGCTTAAGAGATTTTGTTAGCACCCAAATCTCTAGGA  100

seq1  ATTGTGGATTAGGTAGATGTTTCACAACAATAAATATACCAGCTGTGTCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTGGATTAGGTAGATGTTTCACAACAATAAATATACCAGCTGTGTCA  150

seq1  ATTCATGTGACATACACTCCAATTTCCCAGGGTTATCCTGTCTCACAGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATGTGACATACACTCCAATTTCCCAGGGTTATCCTGTCTCACAGAG  200

seq1  GCAAATATCTTTCTCCTATAGGTTTAATTGTACAAAATATGGACAATATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAATATCTTTCTCCTATAGGTTTAATTGTACAAAATATGGACAATATT  250

seq1  TTCTAACGGTGTATTCCTTGATACGGGGCATTTTTTTCATATATATGTAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAACGGTGTATTCCTTGATACGGGGCATTTTTTTCATATATATGTAT  300

seq1  ATATATATCCATGAGTTTTACAAAATCTCTGGTTTACAACCCTATCTTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATATCCATGAGTTTTACAAAATCTCTGGTTTACAACCCTATCTTTT  350

seq1  AGAAAGAAAACTCCCTATTCTTTTGAACATACGGAATCATCTACAGGGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAGAAAACTCCCTATTCTTTTGAACATACGGAATCATCTACAGGGCA  400

seq1  AATATAAATGGTAAACTTGCTGTCCCTTCTTCAAAACATTATCCTGCACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATAAATGGTAAACTTGCTGTCCCTTCTTCAAAACATTATCCTGCACA  450

seq1  TGCTCCCGTTCTCAAATACAACTAGACAATTTAAGTGGGCATCAGAGAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCCCGTTCTCAAATACAACTAGACAATTTAAGTGGGCATCAGAGAGT  500

seq1  AATGGTTATCCTGGACTGTACATTACTGCATTGTAGCCTCATAGCAATTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGTTATCCTGGACTGTACATTACTGCATTGTAGCCTCATAGCAATTA  550

seq1  CTTCTCCAATATCTGTCTTCCTGAATTGCTAAGTTGAGAAATGAGGGTGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCCAATATCTGTCTTCCTGAATTGCTAAGTTGAGAAATGAGGGTGT  600

seq1  TGCTGGTTGTAACATCATACTGTACTCACAGCAAATATAATACTCAGAAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGTTGTAACATCATACTGTACTCACAGCAAATATAATACTCAGAAG  650

seq1  GTAGGGCTGGGAGTGCAATGACCTGAGTTGAGATGAAACCTCAATTTTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGGCTGGGAGTGCAATGACCTGAGTTGAGATGAAACCTCAATTTTAA  700

seq1  TGTGTCTATAAGGTCAGGATGCTGTCCCTTTGGCATTATCATCTCTGGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCTATAAGGTCAGGATGCTGTCCCTTTGGCATTATCATCTCTGGCT  750

seq1  TCTCTGTTCTTATGCTGGCTTTCCTGAACCTGTGCTATAATACCCCCCAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGTTCTTATGCTGGCTTTCCTGAACCTGTGCTATAATACCCCCCAA  800

seq1  CCACACAGATTTAAGAGTGAAAAATCATGTATATCTTCTTTCAGAAAACA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACACAGATTTAAGAGTGAAAAATCATGTATATCTTCTTTCAGAAAACA  850

seq1  TCTGAATTTCACTACCTTCTTGATCCACACAATATCAATATGCACAGCTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAATTTCACTACCTTCTTGATCCACACAATATCAATATGCACAGCTC  900

seq1  AAAAATCACAGGGAGATAGGTGATGGCTGCAAAGATGAGGGCTTTTTCTT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATCACAGGGAGATAGGTGATGGCTGCAAAGATGAGGGCTTTTTCTT  950

seq1  ACAATTAGGGCACATATTTTTTTCCAATATGATTTTTTCCTTTCCTCTTT  1000
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  ACAATTAGGGCACATATTTTTTTCCAATATGA-TTTTTCCTTTCCTCTTT  999

seq1  CACTAAGGGTGGCTTGTGTGTTTGCTGGCCTAAAGGGTCCTGGTTCCAAC  1050
      |||||| ||||||||||||| ||||||||||||||||| |||||||||||
seq2  CACTAAAGGTGGCTTGTGTG-TTGCTGGCCTAAAGGGTTCTGGTTCCAAC  1048

seq1  AACAT-GGGGCTTACTCTATACAGG-CTCAATTTTACCAAGAAAAGGATT  1098
      ||||| ||||||||||| ||||||| ||||||||   ||||||||| |||
seq2  AACATGGGGGCTTACTC-ATACAGGCCTCAATTT--ACAAGAAAAGAATT  1095

seq1  GTTGTAGAA-TCATG-CCGTGACAGCA  1123
      | ||||||| ||||| |||| ||||||
seq2  G-TGTAGAATTCATGTCCGTTACAGCA  1121

seq1: chr14_6291424_6291700
seq2: B6Ng01-096L14.g_76_352 (reverse)

seq1  CACACACACACACACACACACACACACACACACACAAATATCTTTTCATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACACACACACACACACACACACACACACACAAATATCTTTTCATG  50

seq1  AGTGACTGCATAGTTATTAAATACTTGCAATGTGAATATTATCATTAGAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACTGCATAGTTATTAAATACTTGCAATGTGAATATTATCATTAGAA  100

seq1  CAAGCCCACTCACTTTAGTTCCCATTGAAGGTCCCCGGGGTCATGCCCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCCCACTCACTTTAGTTCCCATTGAAGGTCCCCGGGGTCATGCCCCT  150

seq1  GTTTGGCAGGCAGTGAACAGTGCAGAACAGTTTGGGCTGGGGAGGCAGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGGCAGGCAGTGAACAGTGCAGAACAGTTTGGGCTGGGGAGGCAGCT  200

seq1  CACTGGTATACTGCTTTGCTAGTATGCATGAAGCTCTGGATTTAGTTCCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGTATACTGCTTTGCTAGTATGCATGAAGCTCTGGATTTAGTTCCC  250

seq1  AGTACTGCATAGAAAAAAGGTGCAGTG  277
      |||||||||||||||||||||||||||
seq2  AGTACTGCATAGAAAAAAGGTGCAGTG  277

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information