MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-168B05
Chromosome	14 (Build37)
Map Location	56,401,638 - 56,402,866
singlet/doublet	singlet
Overlap gene	Adcy4
Upstream gene	LOC667893, Homez, Ppp1r3e, Bcl2l2, Pabpn1, Slc22a17, Efs, Il25, Cmtm5, Myh6, Myh7, Ngdn, Zfhx2, Thtpa, Ap1g2, Jph4, LOC667938, Dhrs2, LOC100042720, LOC628176, LOC100042729, EG667952, Dhrs4, BC036313, Cpne6, Nrl, Pck2, Wdr23, 1110028A07Rik, Psme1, 1500005A01Rik, Psme2, Rnf31, Isgf3g, Rec8L1, Ipo4, Tm9sf1, Tssk4, 1810034K20Rik, Nedd8, Gmpr2, Tinf2, Tgm1, Rabggta, Dhrs1, 2610027L16Rik, Cideb, Ltb4r2, Ltb4r1
Downstream gene	Ripk3, Nfatc4, BC030046, Cbln3, 9130227C08Rik, 2310014G06Rik, Cma1, Cma2, LOC100042759, EG545056, Mcpt1, Mcpt9, Mcpt2, Mcpt4, Mcpt8, Ctsg, Gzme, Gzmd, Gzmg, LOC672095, Gzmn, LOC100042770, LOC668072, LOC668074, Gzmf, Gzmc, LOC219102, Gzmb, LOC668082, Atp12a, Rnf17, Cenpj, Parp4, LOC100042788, 4930548G07Rik, Pspc1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 4 Proteins pseudo : _no_value

name	Homez (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239099 MGI:2678023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105651 MGI:2145790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 2 Proteins

name	Bcl2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12050 MGI:108052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pabpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54196 MGI:1859158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59049 MGI:1926225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13644 MGI:105311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140806 MGI:2155888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67272 MGI:2447164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17888 MGI:97255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140781 MGI:2155600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngdn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68966 MGI:1916216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfhx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239102 MGI:2686934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thtpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105663 MGI:2446078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11766 MGI:1328307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jph4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319984 MGI:2443113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dhrs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71412 MGI:1918662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042720 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC628176 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG667952 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667952 MGI:3643084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 353 ESTs, 32 Proteins

name	Dhrs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28200 MGI:90169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC036313 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268747 MGI:2448573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12891 MGI:1334445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18185 MGI:102567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pck2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74551 MGI:1860456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28199 MGI:90168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110028A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68680 MGI:1915930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psme1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19186 MGI:1096367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500005A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:85308 MGI:1934682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psme2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19188 MGI:1096365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rnf31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268749 MGI:1934704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isgf3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16391 MGI:107587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rec8L1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56739 MGI:1929645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ipo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75751 MGI:1923001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm9sf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74140 MGI:1921390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71099 MGI:1918349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810034K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67881 MGI:1915131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nedd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18002 MGI:97301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmpr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105446 MGI:1917903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tinf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28113 MGI:107246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21816 MGI:98730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabggta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56187 MGI:1860443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhrs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52585 MGI:1196314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610027L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67842 MGI:1915092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cideb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12684 MGI:1270844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltb4r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57260 MGI:1888501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltb4r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16995 MGI:1309472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adcy4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104110 MGI:99674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ripk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56532 MGI:2154952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfatc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73181 MGI:1920431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC030046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277154 MGI:2652872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 114 ESTs, 3 Proteins

name	Cbln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56410 MGI:1889286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130227C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219094 MGI:2451333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310014G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654795 MGI:1916876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cma1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17228 MGI:96941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cma2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545055 MGI:88426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042759 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 5 Proteins

name	EG545056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545056 MGI:3646055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Mcpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17224 MGI:96937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17232 MGI:1194491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17225 MGI:96938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17227 MGI:96940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17231 MGI:1261780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13035 MGI:88563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzme (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14942 MGI:109265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14941 MGI:109255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14944 MGI:109253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Gzmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245839 MGI:2675494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042770 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC668072 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	LOC668074 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	Gzmf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14943 MGI:109254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14940 MGI:109256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC219102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:219102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gzmb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14939 MGI:109267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668082 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	Atp12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192113 MGI:1926943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30054 MGI:1353419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219103 MGI:2684927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328417 MGI:2685589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs, 2 Proteins

name	LOC100042788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930548G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75339 MGI:1922589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pspc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66645 MGI:1913895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Homez (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301480 GeneID:239099 MGI:2678023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain leucine zipper-encoding gene transcript_id : NM_183174.2

name	Ppp1r3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397162 GeneID:105651 MGI:2145790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 2 Proteins product : protein phosphatase 1, regulatory (inhibitor) subunit 3E transcript_id : XM_993154.1

name	Bcl2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680773 GeneID:12050 MGI:108052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-like 2 transcript_id : NM_007537.1

name	Pabpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506944 GeneID:54196 MGI:1859158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A) binding protein, nuclear 1 transcript_id : NM_019402.1

name	Slc22a17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385256 GeneID:59049 MGI:1926225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 17 transcript_id : NM_021551.3

name	Efs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801691 GeneID:13644 MGI:105311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : embryonal Fyn-associated substrate transcript_id : NM_010112.3

name	Il25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131057 GeneID:140806 MGI:2155888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 25 transcript_id : NM_080729.2

name	Cmtm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365114 GeneID:67272 MGI:2447164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 5 transcript_id : NM_026066.2

name	Myh6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802865 GeneID:17888 MGI:97255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 6, cardiac muscle, alpha transcript_id : NM_010856.3

name	Myh7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131045 GeneID:140781 MGI:2155600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 7, cardiac muscle, beta transcript_id : NM_080728.2

name	Ngdn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037132 GeneID:68966 MGI:1916216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroguidin, EIF4E binding protein transcript_id : NM_026890.1

name	Zfhx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986588 GeneID:239102 MGI:2686934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger homeobox 2 transcript_id : NM_001039198.1

name	Thtpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375828 GeneID:105663 MGI:2446078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thiamine triphosphatase transcript_id : NM_153083.3

name	Ap1g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801694 GeneID:11766 MGI:1328307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-1, gamma 2 subunit transcript_id : NM_007455.2

name	Jph4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254386 GeneID:319984 MGI:2443113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 4 transcript_id : NM_177049.4

name	Jph4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892540 GeneID:319984 MGI:2443113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 4 transcript_id : NM_001003829.2

name	Dhrs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386259 GeneID:71412 MGI:1918662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase member 2 transcript_id : NM_027790.1

name	LOC100042729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265607 GeneID:100042729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Hep27 protein transcript_id : XM_001478704.1

name	EG667952 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265609 GeneID:667952 MGI:3643084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 353 ESTs, 32 Proteins product : predicted gene, EG667952 transcript_id : XM_993473.2

name	Dhrs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816904 GeneID:28200 MGI:90169
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 4 transcript_id : NM_001037938.1

name	Dhrs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507611 GeneID:28200 MGI:90169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 4 transcript_id : NM_030686.1

name	BC036313 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66912204 GeneID:268747 MGI:2448573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC036313 transcript_id : NM_001024645.1

name	Cpne6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25141336 GeneID:12891 MGI:1334445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine VI transcript_id : NM_009947.2

name	Nrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892674 GeneID:18185 MGI:102567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neural retina leucine zipper gene transcript_id : NM_008736.2

name	Pck2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382732 GeneID:74551 MGI:1860456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoenolpyruvate carboxykinase 2 (mitochondrial) transcript_id : NM_028994.2

name	Wdr23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816979 GeneID:28199 MGI:90168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 23 transcript_id : NM_133734.2

name	1110028A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328074 GeneID:68680 MGI:1915930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110028A07 gene transcript_id : NM_026808.1

name	Psme1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755211 GeneID:19186 MGI:1096367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 28 subunit, alpha transcript_id : NM_011189.1

name	1500005A01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14994309 GeneID:85308 MGI:1934682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500005A01 gene transcript_id : NM_033146.1

name	Psme2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725357 GeneID:19188 MGI:1096365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 28 subunit, beta transcript_id : NM_001029855.1

name	Psme2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725356 GeneID:19188 MGI:1096365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 28 subunit, beta transcript_id : NM_011190.3

name	Rnf31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254408 GeneID:268749 MGI:1934704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 31 transcript_id : NM_194346.2

name	Isgf3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982244 GeneID:16391 MGI:107587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon dependent positive acting transcription factor 3 gamma transcript_id : NM_008394.2

name	Rec8L1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982698 GeneID:56739 MGI:1929645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REC8-like 1 (yeast) transcript_id : NM_020002.2

name	Ipo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376112 GeneID:75751 MGI:1923001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : importin 4 transcript_id : NM_024267.6

name	Tm9sf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376447 GeneID:74140 MGI:1921390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 9 superfamily member 1 transcript_id : NM_028780.3

name	Tssk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892361 GeneID:71099 MGI:1918349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 4 transcript_id : NM_027673.2

name	1810034K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254380 GeneID:67881 MGI:1915131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810034K20 gene transcript_id : NM_023397.3

name	Nedd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803217 GeneID:18002 MGI:97301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neural precursor cell expressed, developmentally down-regulated gene 8 transcript_id : NM_008683.3

name	Gmpr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553609 GeneID:105446 MGI:1917903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanosine monophosphate reductase 2 transcript_id : NM_177992.2

name	Tinf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26892290 GeneID:28113 MGI:107246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Terf1 (TRF1)-interacting nuclear factor 2 transcript_id : NM_145705.2

name	Tgm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982704 GeneID:21816 MGI:98730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 1, K polypeptide transcript_id : NM_019984.2

name	Rabggta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130666 GeneID:56187 MGI:1860443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab geranylgeranyl transferase, a subunit transcript_id : NM_019519.2

name	Dhrs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980843 GeneID:52585 MGI:1196314
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 1 transcript_id : NM_026819.2

name	2610027L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980977 GeneID:67842 MGI:1915092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610027L16 gene transcript_id : NM_026403.2

name	Cideb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359816 GeneID:12684 MGI:1270844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell death-inducing DNA fragmentation factor, alpha subunit-like effector B transcript_id : NM_009894.2

name	Ltb4r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048441 GeneID:57260 MGI:1888501
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukotriene B4 receptor 2 transcript_id : NM_020490.1

name	Ltb4r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678727 GeneID:16995 MGI:1309472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukotriene B4 receptor 1 transcript_id : NM_008519.1

name	Adcy4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17978249 GeneID:104110 MGI:99674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 4 transcript_id : NM_080435.1

name	Ripk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910533 GeneID:56532 MGI:2154952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor-interacting serine-threonine kinase 3 transcript_id : NM_019955.1

name	Nfatc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45504364 GeneID:73181 MGI:1920431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 transcript_id : NM_023699.2

name	BC030046 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397167 GeneID:277154 MGI:2652872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 114 ESTs, 3 Proteins product : cDNA sequence BC030046 transcript_id : XM_147850.7

name	Cbln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130579 GeneID:56410 MGI:1889286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebellin 3 precursor protein transcript_id : NM_019820.3

name	9130227C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359903 GeneID:219094 MGI:2451333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130227C08Rik gene transcript_id : NM_027143.2

name	2310014G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131889221 GeneID:654795 MGI:1916876
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310014G06 gene transcript_id : NM_001082975.1

name	Cma1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366233 GeneID:17228 MGI:96941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chymase 1, mast cell transcript_id : NM_010780.2

name	Cma2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861154 GeneID:545055 MGI:88426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chymase 2, mast cell transcript_id : NM_001024714.2

name	LOC100042759 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265613 GeneID:100042759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 5 Proteins product : similar to Chymase precursor (Mast cell protease I) (Mast cell chymase 1) (Mast cell protease 5) (MMCP-5) transcript_id : XM_001478769.1

name	Mcpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678835 GeneID:17224 MGI:96937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 1 transcript_id : NM_008570.1

name	Mcpt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657922 GeneID:17232 MGI:1194491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 9 transcript_id : NM_010782.2

name	Mcpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678837 GeneID:17225 MGI:96938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 2 transcript_id : NM_008571.1

name	Mcpt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205405 GeneID:17227 MGI:96940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 4 transcript_id : NM_010779.2

name	Mcpt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678839 GeneID:17231 MGI:1261780
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 8 transcript_id : NM_008572.1

name	Ctsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681082 GeneID:13035 MGI:88563
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin G transcript_id : NM_007800.1

name	Gzme (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325996 GeneID:14942 MGI:109265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme E transcript_id : NM_010373.3

name	Gzmd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754105 GeneID:14941 MGI:109255
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme D transcript_id : NM_010372.1

name	Gzmg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778833 GeneID:14944 MGI:109253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme G transcript_id : NM_010375.2

name	Gzmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346542 GeneID:245839 MGI:2675494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme N transcript_id : NM_153052.1

name	LOC100042770 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265615 GeneID:100042770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042770 transcript_id : XM_001478784.1

name	Gzmf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325973 GeneID:14943 MGI:109254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme F transcript_id : NM_010374.3

name	Gzmc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754103 GeneID:14940 MGI:109256
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme C transcript_id : NM_010371.1

name	Gzmb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892516 GeneID:14939 MGI:109267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme B transcript_id : NM_013542.2

name	Atp12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149727 GeneID:192113 MGI:1926943
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+/K+ transporting, nongastric, alpha polypeptide transcript_id : NM_138652.1

name	Rnf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74271881 GeneID:30054 MGI:1353419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 17 transcript_id : NM_001033043.1

name	Cenpj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945401 GeneID:219103 MGI:2684927
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein J transcript_id : NM_001014996.1

name	Parp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265621 GeneID:328417 MGI:2685589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs, 2 Proteins product : poly (ADP-ribose) polymerase family, member 4 transcript_id : XM_994286.2

name	4930548G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13357211 GeneID:75339 MGI:1922589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930548G07 gene transcript_id : NM_023773.1

name	Pspc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366164 GeneID:66645 MGI:1913895
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paraspeckle protein 1 transcript_id : NM_025682.2

name	Homez (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301481 CCDS:CCDS27102.1 GeneID:239099 MGI:2678023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeodomain leucine zipper-encoding protein_id : NP_898997.2

name	Ppp1r3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397163 GeneID:105651 MGI:2145790
definition	codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 3E protein_id : XP_998248.1

name	Bcl2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680774 CCDS:CCDS27103.1 GeneID:12050 MGI:108052
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IDA] codon_start : 1 product : Bcl2-like 2 protein_id : NP_031563.1

name	Pabpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506945 CCDS:CCDS27104.1 GeneID:54196 MGI:1859158
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence TAS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006378 - mRNA polyadenylation [Evidence TAS]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : poly(A) binding protein II product : poly(A) binding protein, nuclear 1 protein_id : NP_062275.1

name	Slc22a17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999479 GeneID:59049 MGI:1926225
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : organic cation transporter BOCT; 24p3 receptor product : solute carrier family 22 (organic cation transporter), member 17 protein_id : NP_067526.2

name	Efs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981787 GeneID:13644 MGI:105311
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : embryonal Fyn-associated substrate protein_id : NP_034242.2

name	Il25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18141561 GeneID:140806 MGI:2155888
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0030380 - interleukin-17E receptor binding [Evidence ISS] GO_process : GO:0030222 - eosinophil differentiation [Evidence IDA]; GO:0006954 - inflammatory response [Evidence IDA] [Evidence IMP]; GO:0009620 - response to fungus [Evidence IDA]; GO:0009624 - response to nematode [Evidence IDA] codon_start : 1 product : interleukin 17E protein_id : NP_542767.1

name	Cmtm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21617843 CCDS:CCDS27105.1 GeneID:67272 MGI:2447164
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : chemokine-like factor super family five variant 4; chemokine-like factor super family 5 product : chemokine-like factor superfamily 5 protein_id : NP_080342.1

name	Myh6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754774 GeneID:17888 MGI:97255
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA]; GO:0005863 - striated muscle thick filament [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007512 - adult heart development [Evidence IMP]; GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0002027 - cardiac chronotropy [Evidence IMP]; GO:0002026 - cardiac inotropy [Evidence IMP]; GO:0048739 - cardiac muscle fiber development [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0045214 - sarcomere organization [Evidence IMP]; GO:0006941 - striated muscle contraction [Evidence IMP] [Evidence IEA]; GO:0007522 - visceral muscle development [Evidence IMP] codon_start : 1 note : myosin heavy chain, cardiac muscle, adult; alpha myosin; alpha cardiac MHC; cardiomyopathy, hypertrophic 1 product : myosin, heavy polypeptide 6, cardiac muscle, alpha protein_id : NP_034986.1

name	Myh7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18859641 CCDS:CCDS27106.1 GeneID:140781 MGI:2155600
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin heavy chain, cardiac muscle, fetal; cardiac myosin heavy chain beta product : myosin, heavy polypeptide 7, cardiac muscle, beta protein_id : NP_542766.1

name	Ngdn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037133 GeneID:68966 MGI:1916216
definition	codon_start : 1 product : neuroguidin, EIF4E binding protein protein_id : NP_081166.1

name	Zfhx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986589 CCDS:CCDS27107.1 GeneID:239102 MGI:2686934
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger homeobox 2 protein_id : NP_001034287.1

name	Thtpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346499 CCDS:CCDS27108.1 GeneID:105663 MGI:2446078
definition	EC_number : 3.6.1.28 GO_function : GO:0004016 - adenylate cyclase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] [Evidence ISS]; GO:0050333 - thiamin-triphosphatase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006171 - cAMP biosynthesis [Evidence IEA]; GO:0006091 - generation of precursor metabolites and energy [Evidence ISS]; GO:0006772 - thiamin metabolism [Evidence ISS] [Evidence IEA] codon_start : 1 product : thiamine triphosphatase protein_id : NP_694723.1

name	Ap1g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671555 GeneID:11766 MGI:1328307
definition	EC_number : 3.6.1.28 GO_component : GO:0030121 - AP-1 adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS]; GO:0005798 - Golgi-associated vesicle [Evidence ISS]; GO:0016020 - membrane [Evidence ISS]; GO:0030133 - transport vesicle [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : gamma 2-adaptin product : adaptor protein complex AP-1, gamma 2 subunit protein_id : NP_031481.1

name	Jph4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982212 CCDS:CCDS27109.1 GeneID:319984 MGI:2443113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant a product : junctophilin 4 isoform a protein_id : NP_796023.2

name	Jph4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491827 GeneID:319984 MGI:2443113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant b product : junctophilin 4 isoform b protein_id : NP_001003829.1

name	Dhrs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386260 CCDS:CCDS27110.1 GeneID:71412 MGI:1918662
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dehydrogenase/reductase member 2 protein_id : NP_082066.1

name	LOC100042729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265608 GeneID:100042729
definition	codon_start : 1 product : similar to Hep27 protein protein_id : XP_001478754.1

name	EG667952 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265610 GeneID:667952 MGI:3643084
definition	codon_start : 1 product : similar to non-muscle myosin alkali light chain protein_id : XP_998567.2

name	Dhrs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816905 CCDS:CCDS27111.1 GeneID:28200 MGI:90169
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IDA] GO_function : GO:0001758 - retinal dehydrogenase activity [Evidence IDA] GO_process : GO:0042574 - retinal metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : NADPH-dependent retinol dehydrogenase/reductase isoform 1 protein_id : NP_001033027.1

name	Dhrs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507612 GeneID:28200 MGI:90169
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IDA] GO_function : GO:0001758 - retinal dehydrogenase activity [Evidence IDA] GO_process : GO:0042574 - retinal metabolism [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : NADPH-dependent retinol dehydrogenase/reductase isoform 2 protein_id : NP_109611.1

name	BC036313 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66912205 GeneID:268747 MGI:2448573
definition	codon_start : 1 product : hypothetical protein LOC268747 protein_id : NP_001019816.1

name	Cpne6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753510 CCDS:CCDS27112.1 GeneID:12891 MGI:1334445
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0001786 - phosphatidylserine binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : copine 6; neuronal copine product : copine VI protein_id : NP_034077.1

name	Nrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679132 CCDS:CCDS27113.1 GeneID:18185 MGI:102567
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP] [Evidence IDA] GO_process : GO:0045872 - positive regulation of rhodopsin gene activity [Evidence IDA] [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0007468 - regulation of rhodopsin gene activity [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0046548 - retinal rod cell development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : neural retina leucine zipper protein protein_id : NP_032762.1

name	Pck2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077029 CCDS:CCDS27114.1 GeneID:74551 MGI:1860456
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004613 - phosphoenolpyruvate carboxykinase (GTP) activity [Evidence IEA]; GO:0004611 - phosphoenolpyruvate carboxykinase activity [Evidence IEA] GO_process : GO:0006094 - gluconeogenesis [Evidence IEA] codon_start : 1 product : mitochondrial phosphoenolpyruvate carboxykinase 2 protein_id : NP_083270.1

name	Wdr23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526930 CCDS:CCDS27115.1 GeneID:28199 MGI:90168
definition	codon_start : 1 product : WD repeat domain 23 protein_id : NP_598495.1

name	1110028A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328075 CCDS:CCDS27116.1 GeneID:68680 MGI:1915930
definition	codon_start : 1 note : Cg10671-like product : Cg10671 like protein_id : NP_081084.1

name	Psme1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755212 GeneID:19186 MGI:1096367
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0008537 - proteasome activator complex [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0008538 - proteasome activator activity [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IMP]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : protease (prosome, macropain) 28 subunit, alpha; PA28 alpha subunit product : proteasome (prosome, macropain) 28 subunit, alpha protein_id : NP_035319.1

name	1500005A01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14994310 CCDS:CCDS27117.1 GeneID:85308 MGI:1934682
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC85308 protein_id : NP_149158.1

name	Psme2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725358 GeneID:19188 MGI:1096365
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0008537 - proteasome activator complex [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0008538 - proteasome activator activity [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; protease (prosome, macropain) 28 subunit, beta product : proteasome activator subunit 2 isoform 2 protein_id : NP_001025026.1

name	Psme2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20137004 GeneID:19188 MGI:1096365
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0008537 - proteasome activator complex [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0008538 - proteasome activator activity [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protease (prosome, macropain) 28 subunit, beta product : proteasome activator subunit 2 isoform 1 protein_id : NP_035320.1

name	Rnf31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254409 CCDS:CCDS27118.1 GeneID:268749 MGI:1934704
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0009898 - internal side of plasma membrane [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 31 protein_id : NP_919327.2

name	Isgf3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680474 CCDS:CCDS27119.1 GeneID:16391 MGI:107587
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0045351 - interferon type I biosynthesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon dependent positive acting transcription factor 3 gamma protein_id : NP_032420.1

name	Rec8L1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982699 CCDS:CCDS27120.1 GeneID:56739 MGI:1929645
definition	GO_component : GO:0000800 - lateral element [Evidence IDA]; GO:0000228 - nuclear chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007126 - meiosis [Evidence IPI] codon_start : 1 note : meiotic cohesin REC8; meiotic cohesion Rec8 product : REC8 homolog protein_id : NP_064386.2

name	Ipo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19745156 CCDS:CCDS27121.1 GeneID:75751 MGI:1923001
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006610 - ribosomal protein import into nucleus [Evidence ISS]; GO:0042254 - ribosome biogenesis and assembly [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : importin 4a product : RANBP4 protein_id : NP_077229.4

name	Tm9sf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229185 CCDS:CCDS27122.1 GeneID:74140 MGI:1921390
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane 9 superfamily member 1 protein_id : NP_083056.2

name	Tssk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312834 GeneID:71099 MGI:1918349
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : testis-specific serine kinase 4 protein_id : NP_081949.1

name	1810034K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963663 CCDS:CCDS27123.1 GeneID:67881 MGI:1915131
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : magnesium-dependent phosphatase-1 protein_id : NP_075886.1

name	Nedd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679034 GeneID:18002 MGI:97301
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008104 - protein localization [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0045116 - protein neddylation [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : neural precursor cell expressed, developmentally down-regulated gene 8 protein_id : NP_032709.1

name	Gmpr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29568082 CCDS:CCDS27124.1 GeneID:105446 MGI:1917903
definition	EC_number : 1.7.1.7 GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003920 - GMP reductase activity [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0046038 - GMP catabolism [Evidence ISS]; GO:0030224 - monocyte differentiation [Evidence ISS]; GO:0009117 - nucleotide metabolism [Evidence IEA] codon_start : 1 product : guanosine monophosphate reductase 2 protein_id : NP_818773.1

name	Tinf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26892291 CCDS:CCDS27125.1 GeneID:28113 MGI:107246
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000723 - telomere maintenance [Evidence IDA] codon_start : 1 product : TRF1-interacting nuclear factor 2 protein_id : NP_663751.2

name	Tgm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982705 GeneID:21816 MGI:98730
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0018149 - peptide cross-linking [Evidence IEA]; GO:0019538 - protein metabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : transglutaminase type 1; protein-glutamine-gamma-glutamyltransferase; TG K; TGase 1; K polypeptide product : transglutaminase 1, K polypeptide protein_id : NP_064368.2

name	Rabggta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507023 GeneID:56187 MGI:1860443
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004663 - Rab-protein geranylgeranyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : gunmetal product : Rab geranylgeranyl transferase, a subunit protein_id : NP_062392.1

name	Dhrs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980844 GeneID:52585 MGI:1196314
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : dehydrogenase/reductase (SDR family) member 1 protein_id : NP_081095.2

name	2610027L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980978 CCDS:CCDS27126.1 GeneID:67842 MGI:1915092
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67842 protein_id : NP_080679.2

name	Cideb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753422 CCDS:CCDS27127.1 GeneID:12684 MGI:1270844
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : DFFA-like B product : cell death-inducing DNA fragmentation factor, alpha subunit-like effector B protein_id : NP_034024.1

name	Ltb4r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048442 CCDS:CCDS27128.1 GeneID:57260 MGI:1888501
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001632 - leukotriene B4 receptor activity [Evidence IDA]; GO:0004974 - leukotriene receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0051546 - keratinocyte migration [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : leukotriene B4 receptor 2 protein_id : NP_065236.1

name	Ltb4r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678728 CCDS:CCDS27129.1 GeneID:16995 MGI:1309472
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001632 - leukotriene B4 receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : leukotriene B4 receptor 1 protein_id : NP_032545.1

name	Adcy4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978250 CCDS:CCDS27130.1 GeneID:104110 MGI:99674
definition	GO_component : GO:0030425 - dendrite [Evidence IDA]; GO:0005622 - intracellular [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007188 - G-protein signaling, coupled to cAMP nucleotide second messenger [Evidence IDA] codon_start : 1 product : adenylate cyclase 4 protein_id : NP_536683.1

name	Ripk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910534 CCDS:CCDS27131.1 GeneID:56532 MGI:2154952
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004704 - NF-kappaB-inducing kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : receptor interacting protein 3 product : receptor-interacting serine-threonine kinase 3 protein_id : NP_064339.1

name	Nfatc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45504365 CCDS:CCDS27132.1 GeneID:73181 MGI:1920431
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045333 - cellular respiration [Evidence IDA]; GO:0007507 - heart development [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 exception : mismatches in translation note : transcription complex subunit NF-ATc4 product : cytoplasmic nuclear factor of activated T-cells 4 protein_id : NP_076188.2

name	BC030046 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954257 GeneID:277154 MGI:2652872
definition	codon_start : 1 product : hypothetical protein LOC277154 protein_id : XP_147850.5

name	Cbln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789903 CCDS:CCDS27133.1 GeneID:56410 MGI:1889286
definition	codon_start : 1 note : precerebellin 3 product : cerebellin 3 precursor protein protein_id : NP_062794.1

name	9130227C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30840986 CCDS:CCDS27134.1 GeneID:219094 MGI:2451333
definition	codon_start : 1 product : hypothetical protein LOC219094 protein_id : NP_081419.1

name	2310014G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131889222 GeneID:654795 MGI:1916876
definition	codon_start : 1 product : hypothetical protein LOC654795 protein_id : NP_001076444.1

name	Cma1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857812 CCDS:CCDS27135.1 GeneID:17228 MGI:96941
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 5 protein_id : NP_034910.1

name	Cma2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67010053 CCDS:CCDS27136.1 GeneID:545055 MGI:88426
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 10 protein_id : NP_001019885.1

name	LOC100042759 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265614 GeneID:100042759
definition	codon_start : 1 product : similar to Chymase precursor (Mast cell protease I) (Mast cell chymase 1) (Mast cell protease 5) (MMCP-5) protein_id : XP_001478819.1

name	Mcpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678836 CCDS:CCDS27137.1 GeneID:17224 MGI:96937
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 1 protein_id : NP_032596.1

name	Mcpt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657923 CCDS:CCDS27138.1 GeneID:17232 MGI:1194491
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mast cell-specific serine protease product : mast cell protease 9 protein_id : NP_034912.2

name	Mcpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678838 CCDS:CCDS27139.1 GeneID:17225 MGI:96938
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 2 protein_id : NP_032597.1

name	Mcpt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205406 CCDS:CCDS27140.1 GeneID:17227 MGI:96940
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA] [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IDA] codon_start : 1 note : myonase product : mast cell protease 4 protein_id : NP_034909.2

name	Mcpt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678840 CCDS:CCDS27141.1 GeneID:17231 MGI:1261780
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 8 protein_id : NP_032598.1

name	Ctsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681083 CCDS:CCDS27142.1 GeneID:13035 MGI:88563
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004261 - cathepsin G activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin G preproprotein protein_id : NP_031826.1

name	Gzme (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982793 CCDS:CCDS27143.1 GeneID:14942 MGI:109265
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : granzyme E protein_id : NP_034503.2

name	Gzmd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754106 GeneID:14941 MGI:109255
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : granzyme D protein_id : NP_034502.1

name	Gzmg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754112 CCDS:CCDS27144.1 GeneID:14944 MGI:109253
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : AKA granzyme G; CTL serine protease 3 product : granzyme G protein_id : NP_034505.1

name	Gzmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346543 CCDS:CCDS27145.1 GeneID:245839 MGI:2675494
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : granzyme N protein_id : NP_694692.1

name	LOC100042770 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265616 GeneID:100042770
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478834.1

name	Gzmf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754110 GeneID:14943 MGI:109254
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : granzyme G; AKA granzyme G; CTL serine protease 3 product : granzyme F protein_id : NP_034504.1

name	Gzmc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754104 CCDS:CCDS27146.1 GeneID:14940 MGI:109256
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : granzyme C protein_id : NP_034501.1

name	Gzmb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305123 CCDS:CCDS27147.1 GeneID:14939 MGI:109267
definition	GO_function : GO:0004278 - granzyme B activity [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0019835 - cytolysis [Evidence IEA]; GO:0008626 - induction of apoptosis by granzyme [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : granzyme B protein_id : NP_038570.1

name	Atp12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149728 CCDS:CCDS27148.1 GeneID:192113 MGI:1926943
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATPase H+K+-transporting, alpha 2 product : ATPase, H+/K+ transporting, nongastric, alpha polypeptide protein_id : NP_619593.1

name	Rnf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74271882 CCDS:CCDS27149.1 GeneID:30054 MGI:1353419
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 note : Max dimerization protein member-interacting protein 2 product : ring finger protein 17 protein_id : NP_001028215.1

name	Cenpj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945402 CCDS:CCDS27150.1 GeneID:219103 MGI:2684927
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0030954 - astral microtubule nucleation [Evidence ISS]; GO:0046427 - positive regulation of JAK-STAT cascade [Evidence ISS] codon_start : 1 exception : mismatches in translation product : centromere protein J protein_id : NP_001014996.1

name	Parp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265622 GeneID:328417 MGI:2685589
definition	codon_start : 1 product : similar to mKIAA0177 protein protein_id : XP_999380.2

name	4930548G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13357212 GeneID:75339 MGI:1922589
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : M-phase phosphoprotein, mpp8 protein_id : NP_076262.1

name	Pspc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228986 CCDS:CCDS27151.1 GeneID:66645 MGI:1913895
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : paraspeckle component 1 product : paraspeckle protein 1 protein_id : NP_079958.2

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 1 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 2 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 3 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 4 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 5 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 6 pseudo : _no_value

name	LOC100042720 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042720
definition	number : 1 pseudo : _no_value

name	LOC628176 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628176
definition	number : 2 pseudo : _no_value

name	LOC628176 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628176
definition	number : 1 pseudo : _no_value

name	LOC672095 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672095
definition	number : 2 pseudo : _no_value

name	LOC672095 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672095
definition	number : 1 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 6 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 5 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 4 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 3 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 2 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 1 pseudo : _no_value

name	LOC668074 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668074
definition	number : 1 pseudo : _no_value

name	LOC219102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:219102
definition	number : 1 pseudo : _no_value

name	LOC100042788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042788
definition	number : 1 pseudo : _no_value

name	LOC667893 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265606 GeneID:667893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 4 Proteins product : similar to interferon-inducible protein 16 pseudo : _no_value transcript_id : XR_033805.1

name	EG545056 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:142351255 GeneID:545056 MGI:3646055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545056 pseudo : _no_value transcript_id : NR_002889.2

name	LOC668082 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265617 GeneID:668082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_033891.1

clone name	MSMg01-075M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-123K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-297B20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-369B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-396H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276D04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-168B05.b	B6Ng01-168B05.g
ACC	DH959409	DH959410
length	1,189	1,194
definition	DH959409\|Mus musculus domesticus DNA, BAC clone: B6Ng01-168B05, 5' end.	DH959410\|Mus musculus domesticus DNA, BAC clone: B6Ng01-168B05, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcagattgccctgaataaactattccaccatggaaaatgcttgcat gtttctatagtcatagaacaagagatagtcgtgactcaaggtatttacca acacactggtgtagacagcagatggacaggttacagcaaagtgcagaaaa atttgccatggcattcggatgctttctgatgccatcccgagcacatggct ggtgtaaagctgtggtctactacaaatccacccccagaggttttgtctga tagtcagaggatgtcaggtcagatgcagatgatgggcaatgagtgagatg gagataacccagaataatctgctctgaatctgcactattccaactctttt ctaaagctctaatcagcctttgtggaatcttaacacaggtgtggcttttt ccttggaacttagtctacaaataggaacaaagaactctcacatacacaac ttgtaaagtatgcatttcaatgataagcaaaggtcagatggacaggtgtg gacaggcatggcagcacacacctttaatcccagcactcaggaagctgaag aagggagatctctgtaaatccagataaaattagacaactctggctggaga gatggctcagtggttaagagcaccgactgctcttccagaggtcctgagtt caattcccagaaaccacatggtggctcacaaccatctgcaatggagtctg atgccctcttctggtgtgtgtctgaagagagcaatggtgtactcatataa aataaataaataaatctttaaaaaaaataaaataaatagttgacaactca ataaaagcaaaatcaaaagacttgaacaaagaaattaacaaaatatacat gtttaagctactgttagtaattaaattactaataaacgtgccgacctttg aactgcattagttaccaggagaacacaaaataggcccaaagcaatagcgt aatacactcacaagaatggttacattgaaagatgatatttcagggggaga aacagactcttatcactgttataatatttacacttcatatgccatataaa catagtctagtatatatatagctatgtgctaggtgggcaatctggtgcta ttactgactattccagctatgagatcttgactggggtctctggtccctgg gggcggcctacaggcttctctctctgctctctgtgccgc	gaattcctttctcctgaagccaaaccactaaacttgacaaatgtctacca gggcagcccaagtttctgcaacccctcgccccccccagcactgagttctg agtggctgcctttcctctaacctataagccccagtactaccctacctctc gtccctcctctttcaggacttggggtagacaagggttagttcccagtcat ttgccccacctttcctcccaggagtgaaagggaaacccagagtggaatag ttcccctttcttgcccagaataaaaacgaaaaaacaaaaacaaaaacaaa aaaagatggaggaaggcaaaaactatcttttggaagtctgtgggcacagc tagcagccccacattcccaaatctggatagagaaaaagtcaggaaatgac tctccccagggacatgagtagagtttcctctctggaaaaatggaaaatcc ggtgttggatttactcgagaaccaatagaacacagcgagaagcattcggg actcacttacgtcctagtatagacccagagactaagcttagagggtggag agctctgtcacatgtaaccagagtcacaattcatgacgaggttcaacgct tcgtttttggttcccagcaaagacattattaactaaaagacctcgcaaat ctcagatcttcaaatgtccccagcccgaggcagcccctgcctagagctcc cacatctagcccatcttaccctgccgctggcccaggcgacggcgggcagt gccaccagcgcgcagagcacaatgaccaaaagcagtatcagcagtgggta ctgttggctcaggctgtagtaagtttcgtagaagagatcttcgctgggag gaggccggggactgaagaggcgggccatggtcttccccgccccagcccgg agcccctgccctagggatcacagggcgctgagtcaatacctggcccggac cacgcgctttcccatctctccgaagcactctcgggcagcactagctttca gcagcatagggtccctgctagtgctctctcacaggctccagctgtgacag acttcttatctgcacaaacataacgtgctagtgtctggctggagctggaa agaggtgccgccagactcaccgctttgtccaggctcgagagtcttcttcg actagctagtcagagacctggtggatgtcactaccttcgctgct
quality values	Open. Hide. 61 47 31 40 61 38 29 43 61 40 61 47 61 61 61 61 61 49 61 61 61 61 61 61 61 31 35 33 45 24 10 20 19 13 23 44 37 34 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 41 37 28 32 59 49 36 59 59 61 61 59 59 59 61 61 61 61 59 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 52 61 61 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 53 61 61 61 61 50 50 42 61 47 61 61 61 61 61 61 61 61 53 61 53 61 53 45 61 61 61 61 61 61 61 61 53 53 61 61 53 61 61 61 53 61 61 61 61 61 61 57 53 45 53 52 47 43 57 57 42 57 53 53 52 53 57 53 52 52 50 57 52 57 53 53 45 47 57 53 53 53 53 57 46 53 53 57 57 45 53 27 50 57 26 47 53 53 57 53 57 57 45 53 57 45 52 53 52 53 38 47 47 52 50 57 57 43 43 46 42 53 50 53 57 57 45 57 43 45 57 50 45 45 39 53 47 43 37 57 53 53 52 50 50 53 40 57 53 53 42 45 52 47 53 52 26 53 45 53 46 52 45 57 52 45 53 57 53 37 53 52 52 47 52 38 30 53 39 53 52 40 57 38 57 34 40 42 52 50 57 41 36 53 38 50 37 52 42 35 53 53 41 52 57 57 40 28 25 57 41 52 39 57 53 44 35 57 53 53 44 52 41 52 31 57 57 57 57 57 57 53 29 29 57 57 40 37 53 57 37 40 41 36 40 53 33 41 27 16 37 47 47 34 29 30 41 48 57 53 43 31 30 30 53 57 34 36 40 15 53 47 43 24 31 23 38 48 31 30 37 30 24 47 37 20 30 51 27 29 39 26 36 31 30 51 51 31 22 39 12 19 30 23 35 30 17 51 26 21 30 14 29 28 23 29 22 48 32 28 29 22 35 35 29 28 11 8 46 34 20 22 29 33 28 27 23 29 28 51 33 35 29 29 31 34 34 18 17 6 22 6 33 28 34 34 35 24 29 29 18 28 32 29 39 23 28 29 28 23 20 24 15 19 32 16 36 29 21 22 28 21 46 51 29 21 12 15 16 34 36 26 20 29 30 18 28 28 27 22 23 21 29 20 20 31 10 31 28 28 17 20 35 26 16 33 18 34 23 28 31 29 29 31 18 21 19 8 12 7 27 27 29 51 39 11 28 23 21 20 9 27 7 51 12 39 15 22 51 51 51 22 29 12 15 51 23 16 17 12 27 19 22 20 18 6 15 9 23 10 15 18 33 12 15 23 15 9 19 17 33 17 44 30 19 8 19 10 17 27 23 33 16 9 6 25 22 16 13 25 9 5 8 6 5 4 4 14 11 17 6 18 14 29 10 30 14 27 13 12 29 27 3 3 10 12 12 15 23 21 14 9 10 27 15 19 10 17 18 8 30 27 12 14 15 9 14 13 21 9 7 17 17 10 3 4 7 9 12 7 14 24 13 24 11 9 23 18 20 5 5 12 11 5 5 5 6 6 23 6 6 4 4 2 3 5 15 10 27 35 4 4 2 4 7 8 7 3 1 3 4 3 10 12 21 25 25 7 13 8 6 7 4 2 3 7 5 11 13 4 17 5 19 6 16 5 13 6 15 4 6 22 4 5 4 9 6 7 6 4 3 4 3 5	Open. Hide. 61 47 49 49 61 28 28 23 22 19 22 26 23 21 28 41 59 59 59 59 59 59 59 55 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 49 32 35 35 32 30 30 59 55 55 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 59 61 61 61 61 55 44 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 55 37 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 53 61 47 61 61 61 61 61 61 52 61 50 50 61 39 61 61 61 50 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 47 61 47 61 53 61 61 61 61 61 61 61 47 53 61 61 61 52 61 61 61 61 61 61 47 46 45 57 50 53 53 53 53 53 57 53 50 53 53 57 57 57 57 57 47 43 53 53 57 47 36 53 57 57 57 57 50 57 52 53 53 53 42 31 37 53 47 46 53 53 57 57 57 45 57 23 47 53 53 43 46 53 57 53 53 53 47 52 53 38 57 50 45 53 53 41 30 57 53 50 52 34 45 50 47 46 42 45 50 47 47 45 52 28 52 50 47 34 38 17 16 43 52 52 38 46 47 50 38 52 50 50 53 28 46 52 45 50 42 50 53 45 53 45 43 35 24 31 52 50 50 37 34 35 35 38 47 50 50 46 37 39 38 53 47 14 46 34 33 18 46 38 50 37 23 37 43 22 29 57 53 29 37 36 44 53 24 53 29 40 52 27 32 38 37 45 37 40 40 23 33 17 33 27 24 18 27 37 53 37 40 40 30 44 37 53 27 40 37 33 33 30 30 32 29 28 40 40 33 23 32 46 45 26 28 32 35 48 22 43 37 20 16 31 32 25 8 38 25 32 34 23 41 27 36 28 51 32 32 51 29 39 29 27 46 23 43 33 13 46 15 29 23 28 28 39 34 28 29 23 19 36 29 29 18 19 29 16 31 6 28 19 43 43 31 19 11 29 29 22 26 12 37 20 29 11 30 51 31 13 26 25 29 35 24 26 28 28 24 26 32 27 29 28 23 30 30 26 20 21 30 29 26 16 24 14 6 20 27 26 23 29 34 21 20 25 24 24 18 44 15 18 20 31 22 23 28 20 51 30 16 17 19 16 14 33 9 25 27 33 16 10 26 7 13 20 28 20 6 31 20 10 19 27 12 15 9 30 16 21 27 22 25 51 21 22 38 26 24 29 17 31 26 31 19 32 19 27 34 13 30 7 15 19 16 28 17 25 39 16 18 35 15 31 15 28 27 35 15 19 14 44 20 11 17 21 20 22 14 23 34 16 7 12 30 11 29 5 36 13 10 15 14 11 29 5 11 18 13 17 6 6 15 20 9 18 12 5 10 15 7 28 16 22 7 10 21 11 17 5 13 6 8 5 15 7 12 26 14 15 24 18 4 5 19 4 1 5 4 11 7 12 14 4 4 8 9 4 23 8 9 17 10 23 23 14 4 3 5 24 12 13 15 15 11 18 6 6 4 5 17 12 4 9 20 17 6 18 11 6 7 5 6 13 6 8 5 14 5 20 10 16 8 5 12 6 6 5 3 1 13 20 6 4 5 14 9 5 4 6 14 4 12 7 9 4 11 4 6 16 8 8 9 7 4 13 3 1 7 6 16 21 8 10 1 2 3 7 8 7 3 3 6 4 20 15 7 7 18 6 4 6 2 3 7 4 9 4 9 7 13 12 9 4 3 9 7 4 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_56401638_56402866
seq2: B6Ng01-168B05.g_67_1260

seq1  GAATTCCTTTCTCCTGAAGCCAAACCACTAAACTTGACAAATGTCTACCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTTCTCCTGAAGCCAAACCACTAAACTTGACAAATGTCTACCA  50

seq1  GGGCAGCCCAAGTTTCTGCAACCCCTCGCCCCCCCCAGCACTGAGTTCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGCCCAAGTTTCTGCAACCCCTCGCCCCCCCCAGCACTGAGTTCTG  100

seq1  AGTGGCTGCCTTTCCTCTAACCTATAAGCCCCAGTACTACCCTACCTCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGCTGCCTTTCCTCTAACCTATAAGCCCCAGTACTACCCTACCTCTC  150

seq1  GTCCCTCCTCTTTCAGGACTTGGGGTAGACAAGGGTTAGTTCCCAGTCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCTCCTCTTTCAGGACTTGGGGTAGACAAGGGTTAGTTCCCAGTCAT  200

seq1  TTGCCCCACCTTTCCTCCCAGGAGTGAAAGGGAAACCCAGAGTGGAATAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCCCACCTTTCCTCCCAGGAGTGAAAGGGAAACCCAGAGTGGAATAG  250

seq1  TTCCCCTTTCTTGCCCAGAATAAAAACGAAAAAACAAAAACAAAAACAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCTTTCTTGCCCAGAATAAAAACGAAAAAACAAAAACAAAAACAAA  300

seq1  AAAAGATGGAGGAAGGCAAAAACTATCTTTTGGAAGTCTGTGGGCACAGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGATGGAGGAAGGCAAAAACTATCTTTTGGAAGTCTGTGGGCACAGC  350

seq1  TAGCAGCCCCACATTCCCAAATCTGGATAGAGAAAAAGTCAGGAAATGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAGCCCCACATTCCCAAATCTGGATAGAGAAAAAGTCAGGAAATGAC  400

seq1  TCTCCCCAGGGACATGAGTAGAGTTTCCTCTCTGGAAAAATGGAAAATCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCCAGGGACATGAGTAGAGTTTCCTCTCTGGAAAAATGGAAAATCC  450

seq1  GGTGTTGGATTTACTCGAGAACCAATAGAACACAGCGAGAAGCATTCGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTTGGATTTACTCGAGAACCAATAGAACACAGCGAGAAGCATTCGGG  500

seq1  ACTCACTTACGTCCTAGTATAGACCCAGAGACTAAGCTTAGAGGGTGGAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCACTTACGTCCTAGTATAGACCCAGAGACTAAGCTTAGAGGGTGGAG  550

seq1  AGCTCTGTCACATGTAACCAGAGTCACAATTCATGACGAGGTTCAACGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTGTCACATGTAACCAGAGTCACAATTCATGACGAGGTTCAACGCT  600

seq1  TCGTTTTTGGTTCCCAGCAAAGACATTATTAACTAAAAGACCTCGCAAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTTTTTGGTTCCCAGCAAAGACATTATTAACTAAAAGACCTCGCAAAT  650

seq1  CTCAGATCTTCAAATGTCCCCAGCCCGAGGCAGCCCCTGCCTAGAGCTCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGATCTTCAAATGTCCCCAGCCCGAGGCAGCCCCTGCCTAGAGCTCC  700

seq1  CACATCTAGCCCATCTTACCCTGCCGCTGGCCCAGGCGACGGCGGGCAGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATCTAGCCCATCTTACCCTGCCGCTGGCCCAGGCGACGGCGGGCAGT  750

seq1  GCCACCAGCGCGCAGAGCACAATGACCAAAAGCAGTATCAGCAGTGGGTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACCAGCGCGCAGAGCACAATGACCAAAAGCAGTATCAGCAGTGGGTA  800

seq1  CTGTTGGCTCAGGCTGTAGTAAGTTTCGTAGAAGAGATCTTCGCTGGGAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTGGCTCAGGCTGTAGTAAGTTTCGTAGAAGAGATCTTCGCTGGGAG  850

seq1  GAGGCCGGGGACTGAAGAGGCGGGCCATGGTCTTCCCCGCCCCAGCCCGG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCCGGGGACTGAAGAGGCGGGCCATGGTCTTCCCCGCCCCAGCCCGG  900

seq1  AGCCCCTGCCCTAGGGATCACAGGGCGCTGAGTCAATAACCTGGCCCGGA  950
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  AGCCCCTGCCCTAGGGATCACAGGGCGCTGAGTCAAT-ACCTGGCCCGGA  949

seq1  CCACCGCGCTTTCCCATCTCTCCCGAAGCCACTCTCGGGCAAGCCACTAA  1000
      ||| ||||||||||||||||| |||||| ||||||||||||   |||| |
seq2  CCA-CGCGCTTTCCCATCTCT-CCGAAG-CACTCTCGGGCA--GCACT-A  993

seq1  GCTTTCAGCAGCAATAGGGTTCCCTGCTAAGTGCTCTCTCACAGGGCTCC  1050
      |||||||||||| |||||| |||||||| |||||||||||||| |||| |
seq2  GCTTTCAGCAGC-ATAGGG-TCCCTGCT-AGTGCTCTCTCACA-GGCT-C  1038

seq1  CAGCTGTGACAGGACTTCTTTATCCTTCCCACAAACCATACCGTGCTAGT  1100
      ||||||||||| |||||| |||||     |||||| |||| |||||||||
seq2  CAGCTGTGACA-GACTTC-TTATC---TGCACAAA-CATAACGTGCTAGT  1082

seq1  GTCCTGGCTGGAGCTGAGAAGAAGGTGCCG-CAGACTCACCGCTTTGGGT  1149
      || ||||||||||||| |||  |||||||| ||||||||||||||| |  
seq2  GT-CTGGCTGGAGCTG-GAAAGAGGTGCCGCCAGACTCACCGCTTT-GTC  1129

seq1  CAAGCTCCAGAAGTTCTCTCAGCAAAGCTAGGCTCCAGGAGGGAACCTGG  1199
      || |||| || |||  |||  |   |||||| |      || | ||||||
seq2  CAGGCTCGAG-AGTCTTCTTCGACTAGCTAGTC------AGAG-ACCTGG  1171

seq1  GTGGGATGGCTACTACTCACCTTCGCTGCT  1229
         ||||| |    ||| ||||||||||||
seq2  --TGGATGTC----ACT-ACCTTCGCTGCT  1194

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information