MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242I06
Chromosome	14 (Build37)
Map Location	70,013,666 - 70,161,956
singlet/doublet	doublet
Overlap gene	Loxl2, R3hcc1, Chmp7
Upstream gene	Adam7, Adamdec1, Adam28, LOC641033, LOC100043082, Stc1, EG545808, Nkx2-6, Nkx3-1, Slc25a37, D930020E02Rik, Entpd4
Downstream gene	Tnfrsf10b, Rhobtb2, LOC100043701, 1700081D17Rik, LOC668397, Egr3, Bin3, 2610301G19Rik, 9930012K11Rik, Pdlim2, Sorbs3, Ppp3cc, LOC100043115, Slc39a14, EG668450, Piwil2, Polr3d, Phyhip, Bmp1, Sftpc, Lgi3, Reep4, Hr, Nudt18, Rai16, Epb4.9, Fgf17, Npm2, Xpo7, LOC668443
Link	Open Mouse BAC browser

Click to get alignment info.

name	Adam7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11500 MGI:107247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamdec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58860 MGI:1917650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13522 MGI:105988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC641033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043082 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Stc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20855 MGI:109131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545808 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545808 MGI:3647821
definition	note : predicted gene, EG545808 pseudo : _no_value

name	Nkx2-6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18092 MGI:97351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx3-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18095 MGI:97352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67712 MGI:1914962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D930020E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239167 MGI:3045308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67464 MGI:1914714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94352 MGI:2137913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	R3hcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71843 MGI:1919093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 1 Protein

name	Chmp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105513 MGI:1913922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21933 MGI:1341090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhobtb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246710 MGI:2180557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	1700081D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73523 MGI:1920773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Egr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13655 MGI:1306780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bin3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57784 MGI:1929883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610301G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219158 MGI:2444228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 91 ESTs, 3 Proteins

name	9930012K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268759 MGI:2145726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdlim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213019 MGI:2384850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sorbs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20410 MGI:700013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp3cc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19057 MGI:107162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Slc39a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213053 MGI:2384851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668450 MGI:3643688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 81 ESTs, 3 Proteins

name	Piwil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57746 MGI:1930036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67065 MGI:1914315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phyhip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105653 MGI:1860417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12153 MGI:88176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sftpc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20389 MGI:109517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgi3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213469 MGI:2182619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72549 MGI:1919799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15460 MGI:96223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213484 MGI:2385853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rai16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239170 MGI:3036290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 7 Proteins

name	Epb4.9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13829 MGI:99670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14171 MGI:1202401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328440 MGI:1890811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpo7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65246 MGI:1929705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668443 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 38 ESTs, 3 Proteins pseudo : _no_value

name	Adam7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347490 GeneID:11500 MGI:107247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 7 transcript_id : NM_007402.2

name	Adamdec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892417 GeneID:58860 MGI:1917650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADAM-like, decysin 1 transcript_id : NM_021475.2

name	Adam28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326441 GeneID:13522 MGI:105988
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 28 transcript_id : NM_001048175.1

name	Adam28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892955 GeneID:13522 MGI:105988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 28 transcript_id : NM_010082.2

name	Adam28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892903 GeneID:13522 MGI:105988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 28 transcript_id : NM_183366.2

name	Stc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053907 GeneID:20855 MGI:109131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stanniocalcin 1 transcript_id : NM_009285.3

name	Nkx2-6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859581 GeneID:18092 MGI:97351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK2 transcription factor related, locus 6 (Drosophila) transcript_id : NM_010920.1

name	Nkx3-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802698 GeneID:18095 MGI:97352
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK-3 transcription factor, locus 1 (Drosophila) transcript_id : NM_010921.2

name	Slc25a37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759342 GeneID:67712 MGI:1914962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 37 transcript_id : NM_026331.3

name	D930020E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387160 GeneID:239167 MGI:3045308
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D930020E02 gene transcript_id : NM_173420.2

name	Entpd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349997 GeneID:67464 MGI:1914714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 4 transcript_id : NM_026174.2

name	Loxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33589811 GeneID:94352 MGI:2137913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysyl oxidase-like 2 transcript_id : NM_033325.1

name	R3hcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265659 GeneID:71843 MGI:1919093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 1 Protein product : R3H domain and coiled-coil containing 1 transcript_id : XM_001479474.1

name	Chmp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801415 GeneID:105513 MGI:1913922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CHMP family, member 7 transcript_id : NM_134078.3

name	Tnfrsf10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789303 GeneID:21933 MGI:1341090
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 10b transcript_id : NM_020275.3

name	Rhobtb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803249 GeneID:246710 MGI:2180557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho-related BTB domain containing 2 transcript_id : NM_153514.4

name	LOC100043701 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265785 GeneID:100043701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100043701 transcript_id : XM_001480738.1

name	1700081D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348031 GeneID:73523 MGI:1920773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700081D17 gene transcript_id : NM_028526.2

name	1700081D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349112 GeneID:73523 MGI:1920773
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700081D17 gene transcript_id : NM_028560.2

name	Egr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130757 GeneID:13655 MGI:1306780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 3 transcript_id : NM_018781.2

name	Bin3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130496 GeneID:57784 MGI:1929883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bridging integrator 3 transcript_id : NM_021328.3

name	2610301G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265787 GeneID:219158 MGI:2444228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 91 ESTs, 3 Proteins product : RIKEN cDNA 2610301G19 gene transcript_id : XM_001001452.2

name	9930012K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921302 GeneID:268759 MGI:2145726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930012K11 gene transcript_id : NM_001004155.1

name	Pdlim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122422 GeneID:213019 MGI:2384850
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ and LIM domain 2 transcript_id : NM_145978.1

name	Sorbs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130192 GeneID:20410 MGI:700013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 3 transcript_id : NM_011366.2

name	Ppp3cc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130628 GeneID:19057 MGI:107162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 3, catalytic subunit, gamma isoform transcript_id : NM_008915.2

name	Slc39a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347500 GeneID:213053 MGI:2384851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 14 transcript_id : NM_144808.4

name	EG668450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397240 GeneID:668450 MGI:3643688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 81 ESTs, 3 Proteins product : predicted gene, EG668450 transcript_id : XM_001001520.1

name	Piwil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946609 GeneID:57746 MGI:1930036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : piwi-like homolog 2 (Drosophila) transcript_id : NM_021308.1

name	Polr3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981108 GeneID:67065 MGI:1914315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide D transcript_id : NM_025945.2

name	Phyhip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360820 GeneID:105653 MGI:1860417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phytanoyl-CoA hydroxylase interacting protein transcript_id : NM_145981.3

name	Bmp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734446 GeneID:12153 MGI:88176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 1 transcript_id : NM_009755.2

name	Sftpc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755479 GeneID:20389 MGI:109517
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfactant associated protein C transcript_id : NM_011359.1

name	Lgi3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369332 GeneID:213469 MGI:2182619
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeat LGI family, member 3 transcript_id : NM_145219.3

name	Reep4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30725846 GeneID:72549 MGI:1919799
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 4 transcript_id : NM_180588.1

name	Hr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31544071 GeneID:15460 MGI:96223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairless transcript_id : NM_021877.2

name	Nudt18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802266 GeneID:213484 MGI:2385853
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 18 transcript_id : NM_153136.3

name	Rai16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265788 GeneID:239170 MGI:3036290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 7 Proteins product : retinoic acid induced 16 transcript_id : XM_001480783.1

name	Epb4.9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893373 GeneID:13829 MGI:99670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.9 transcript_id : NM_013514.3

name	Fgf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802173 GeneID:14171 MGI:1202401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 17 transcript_id : NM_008004.3

name	Npm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348367 GeneID:328440 MGI:1890811
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleophosmin/nucleoplasmin 2 transcript_id : NM_181345.2

name	Xpo7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508429 GeneID:65246 MGI:1929705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin 7 transcript_id : NM_023045.2

name	Adam7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347491 CCDS:CCDS27234.1 GeneID:11500 MGI:107247
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : epididymal apical protein I; a disintegrin and metalloprotease domain (ADAM) 7 product : a disintegrin and metalloprotease domain 7 protein_id : NP_031428.2

name	Adamdec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946874 GeneID:58860 MGI:1917650
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : decysin product : disintegrin metalloprotease (decysin) protein_id : NP_067450.1

name	Adam28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326442 GeneID:13522 MGI:105988
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; a disintegrin and metalloproteinase domain 28; disintegrin 1; a disintegrin and metalloprotease domain 28 product : a disintegrin and metalloprotease domain 28 isoform 4 protein_id : NP_001041640.1

name	Adam28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956050 GeneID:13522 MGI:105988
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; a disintegrin and metalloproteinase domain 28; disintegrin 1; a disintegrin and metalloprotease domain 28 product : a disintegrin and metalloprotease domain 28 isoform 1 protein_id : NP_034212.1

name	Adam28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368582 GeneID:13522 MGI:105988
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; a disintegrin and metalloproteinase domain 28; disintegrin 1; a disintegrin and metalloprotease domain 28 product : a disintegrin and metalloprotease domain 28 isoform 2 protein_id : NP_899222.1

name	Stc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053908 CCDS:CCDS27236.1 GeneID:20855 MGI:109131
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0006874 - calcium ion homeostasis [Evidence TAS]; GO:0030320 - monovalent inorganic anion homeostasis [Evidence TAS] codon_start : 1 product : stanniocalcin 1 protein_id : NP_033311.3

name	Nkx2-6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859582 GeneID:18092 MGI:97351
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Drosophila NK2 transcription factor related, locus 6 product : NK2 transcription factor related, locus 6 protein_id : NP_035050.1

name	Nkx3-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110673 CCDS:CCDS27237.1 GeneID:18095 MGI:97352
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030850 - prostate gland development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007431 - salivary gland development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Drosophila NK-3 transcription factor, locus 1 product : NK-3 transcription factor, locus 1 protein_id : NP_035051.1

name	Slc25a37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17158033 CCDS:CCDS27238.1 GeneID:67712 MGI:1914962
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0005381 - iron ion transporter activity [Evidence IMP] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0048250 - mitochondrial iron ion transport [Evidence IMP] codon_start : 1 note : mitochondrial solute carrier protein product : solute carrier family 25, member 37 protein_id : NP_080607.2

name	D930020E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734142 CCDS:CCDS27239.1 GeneID:239167 MGI:3045308
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA]; GO:0019031 - viral envelope [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : placenta-specific/fusogenic product : envelope glycoprotein syncytin-B protein_id : NP_775596.1

name	Entpd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18093090 CCDS:CCDS27240.1 GeneID:67464 MGI:1914714
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IEA] codon_start : 1 note : lysosomal apyrase-like 1 product : ectonucleoside triphosphate diphosphohydrolase 4 protein_id : NP_080450.1

name	Loxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33589812 CCDS:CCDS27241.1 GeneID:94352 MGI:2137913
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004720 - protein-lysine 6-oxidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lysyl oxidase-like 2 protein_id : NP_201582.1

name	R3hcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265660 GeneID:71843 MGI:1919093
definition	codon_start : 1 product : R3H domain and coiled-coil containing 1 protein_id : XP_001479524.1

name	Chmp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21359827 CCDS:CCDS27242.1 GeneID:105513 MGI:1913922
definition	GO_process : GO:0015031 - protein transport [Evidence IEA] codon_start : 1 product : CHMP family, member 7 protein_id : NP_598839.2

name	Tnfrsf10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981095 CCDS:CCDS27243.1 GeneID:21933 MGI:1341090
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : KILLER/DR5 TRAIL death-inducing receptor; Trail Receptor; MK gene for TRAIL receptor2 KILLER/DR5 homologue product : tumor necrosis factor receptor superfamily, member 10b protein_id : NP_064671.2

name	Rhobtb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543590 CCDS:CCDS27244.1 GeneID:246710 MGI:2180557
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Rho-related BTB domain containing 2 protein_id : NP_705734.3

name	LOC100043701 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265786 GeneID:100043701
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480788.1

name	1700081D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62857901 CCDS:CCDS27245.1 GeneID:73523 MGI:1920773
definition	codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC73523 isoform a protein_id : NP_082836.1

name	1700081D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62857895 GeneID:73523 MGI:1920773
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC73523 isoform b protein_id : NP_082802.1

name	Egr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055212 CCDS:CCDS27246.1 GeneID:13655 MGI:1306780
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007274 - neuromuscular synaptic transmission [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : early growth response 3 protein_id : NP_061251.1

name	Bin3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946638 CCDS:CCDS27247.1 GeneID:57784 MGI:1929883
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0008093 - cytoskeletal adaptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007015 - actin filament organization [Evidence ISS]; GO:0000917 - barrier septum formation [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0008104 - protein localization [Evidence ISS]; GO:0009826 - unidimensional cell growth [Evidence ISS] codon_start : 1 note : bridging integrator-3 product : bridging integrator 3 protein_id : NP_067303.1

name	2610301G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397239 GeneID:219158 MGI:2444228
definition	codon_start : 1 product : p30 DBC protein protein_id : XP_001001452.1

name	9930012K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921303 GeneID:268759 MGI:2145726
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC268759 protein_id : NP_001004155.1

name	Pdlim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122423 CCDS:CCDS27248.1 GeneID:213019 MGI:2384850
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : STAT-interacting LIM protein product : PDZ and LIM domain 2 protein_id : NP_666090.1

name	Sorbs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755504 CCDS:CCDS27249.1 GeneID:20410 MGI:700013
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0031589 - cell-substrate adhesion [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IMP]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence IMP] [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vinexin; vinexin beta; vinexin alpha product : SH3 domain protein 4 protein_id : NP_035496.1

name	Ppp3cc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679447 GeneID:19057 MGI:107162
definition	GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : PP2BA gamma product : protein phosphatase 3, catalytic subunit, gamma isoform protein_id : NP_032941.1

name	Slc39a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059049 GeneID:213053 MGI:2384851
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA] GO_process : GO:0030001 - metal ion transport [Evidence IEA] codon_start : 1 product : solute carrier family 39 (zinc transporter), member 14 protein_id : NP_659057.2

name	EG668450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397241 GeneID:668450 MGI:3643688
definition	codon_start : 1 product : similar to Cell division cycle 26 protein_id : XP_001001520.1

name	Piwil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946610 CCDS:CCDS27252.1 GeneID:57746 MGI:1930036
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : Miwi like; Miwi likw product : piwi like homolog 2 protein_id : NP_067283.1

name	Polr3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981109 CCDS:CCDS27253.1 GeneID:67065 MGI:1914315
definition	GO_component : GO:0005666 - DNA-directed RNA polymerase III complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA]; GO:0006383 - transcription from RNA polymerase III promoter [Evidence IEA] codon_start : 1 exception : mismatches in translation note : BN51 (BHK21) temperature sensitivity complementing product : polymerase (RNA) III (DNA directed) polypeptide D protein_id : NP_080221.2

name	Phyhip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122427 GeneID:105653 MGI:1860417
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lupus nephritis-associated peptide 1 interacting protein product : phytanoyl-CoA hydroxylase interacting protein protein_id : NP_666093.1

name	Bmp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734447 GeneID:12153 MGI:88176
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0008533 - astacin activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence TAS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0017026 - procollagen C-endopeptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051216 - cartilage development [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0001503 - ossification [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : bone morphogenetic protein 1 protein_id : NP_033885.2

name	Sftpc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755480 CCDS:CCDS27254.1 GeneID:20389 MGI:109517
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0050828 - regulation of liquid surface tension [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IEA] codon_start : 1 exception : mismatches in translation product : surfactant associated protein C protein_id : NP_035489.1

name	Lgi3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644575 CCDS:CCDS27255.1 GeneID:213469 MGI:2182619
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leubrin; leucine-rich glioma inactivated 1-like product : leucine-rich repeat LGI family, member 3 protein_id : NP_660254.1

name	Reep4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725847 CCDS:CCDS27256.1 GeneID:72549 MGI:1919799
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor expression enhancing protein 4 protein_id : NP_850919.1

name	Hr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31544072 CCDS:CCDS27257.1 GeneID:15460 MGI:96223
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hairless protein protein_id : NP_068677.2

name	Nudt18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84871976 CCDS:CCDS27258.1 GeneID:213484 MGI:2385853
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 18 protein_id : NP_694776.2

name	Rai16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265789 GeneID:239170 MGI:3036290
definition	codon_start : 1 product : retinoic acid induced 16 protein_id : XP_001480833.1

name	Epb4.9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305037 CCDS:CCDS27259.1 GeneID:13829 MGI:99670
definition	GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA] codon_start : 1 product : erythrocyte protein band 4.9 protein_id : NP_038542.1

name	Fgf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679779 CCDS:CCDS27260.1 GeneID:14171 MGI:1202401
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : fibroblast growth factor 17 protein_id : NP_032030.1

name	Npm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31077089 CCDS:CCDS27261.1 GeneID:328440 MGI:1890811
definition	GO_component : GO:0000789 - cytoplasmic chromatin [Evidence ISS]; GO:0000790 - nuclear chromatin [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0042393 - histone binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence IMP] [Evidence ISS]; GO:0009790 - embryonic development [Evidence ISS]; GO:0007338 - fertilization (sensu Metazoa) [Evidence ISS]; GO:0009994 - oocyte differentiation [Evidence ISS]; GO:0045836 - positive regulation of meiosis [Evidence ISS]; GO:0007096 - regulation of exit from mitosis [Evidence ISS]; GO:0006445 - regulation of translation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : nucleoplasmin 2 product : nucleophosmin/nucleoplasmin 2 protein_id : NP_851990.1

name	Xpo7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746422 GeneID:65246 MGI:1929705
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA]; GO:0008536 - Ran GTPase binding [Evidence TAS] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence TAS]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : RAN binding protein 16 product : exportin 7 protein_id : NP_075532.1

name	LOC641033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:641033
definition	number : 1 pseudo : _no_value

name	LOC100043082 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043082
definition	number : 1 pseudo : _no_value

name	LOC100043082 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043082
definition	number : 2 pseudo : _no_value

name	LOC100043082 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043082
definition	number : 3 pseudo : _no_value

name	LOC100043082 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043082
definition	number : 4 pseudo : _no_value

name	LOC100043082 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043082
definition	number : 5 pseudo : _no_value

name	LOC668397 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668397
definition	number : 1 pseudo : _no_value

name	LOC100043115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043115
definition	number : 1 pseudo : _no_value

name	LOC100043115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043115
definition	number : 2 pseudo : _no_value

name	LOC100043115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043115
definition	number : 3 pseudo : _no_value

name	LOC100043115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043115
definition	number : 4 pseudo : _no_value

name	LOC100043115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043115
definition	number : 5 pseudo : _no_value

name	LOC100043115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043115
definition	number : 6 pseudo : _no_value

name	LOC668443 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265790 GeneID:668443
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 38 ESTs, 3 Proteins product : hypothetical LOC668443 pseudo : _no_value transcript_id : XR_034844.1

clone name	MSMg01-421L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137H14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-156O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023B12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242I06.b	B6Ng01-242I06.g
ACC	GA052138	GA052139
length	1,063	1,086
definition	B6Ng01-242I06.b	B6Ng01-242I06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(70,160,778 - 70,161,956)	(70,013,666 - 70,014,731)
sequence	gaattctgcatcattgcaactgataaaaatgtgtgtaattagatgatttg tgtgtgtgtgcgtgcacgcaaagctaggaaccgtgaagaacagaatttgg tggcctagccccatgatggaaaaatctatcctcgtacctcacaagacatc cctcctgaaagtgagctgcttttccattacagccggaattatgctcaaca ggtaagtgttcttgaatacccagatgtgtacctctgtaactgtggcaagg agtacaattcctagtcagagttcgcagctcatctgacaagccacatccat aatcatctccctagccagggccacagcagcagccacaggccaagccacag caaggaaaggaagtgttctctatacccccaggctttcatctctccttcca aaccccacgtgcacttaatgggtcatatgggggaacccccacaagtgtga tttttgtagcaagacttttggtgatccaagcaacctatagacacacctca acattcatacaggtcagaagaattataggtgtactttgtgggacaagtct ctcacgcagaaggctcacctggagtctcatatggccatccacacgggtga gaagaatctcaagtgtgattcctgtgacaagctgtccatgcggagacagg gcctcaagcagcccgtgctcatccgcccgcaagaacgccagaccaagcgt ccgaagtgcaataaactgttcttgagaacaaaccacttgaagaagcatct caattctcccggaggaaaacgagattatgtctgcaaacaatgtagaaagg tcgatctaaccaagtgccacgtcactcaccacctgaagacctgccaagag cctgcctccaggtcctcagcacaggacgaagatgcggacaagaagatctc acagactccatgagggacagaggactgcaagatgagcagtgctatttact caacagatgggtctctctccacacagaaatgagaggaaaaggcaactgct tcggatgggaacataacattgggaaaacataaaacccaggtcactgtttg tattttttattat	gaattcatttattcattctattttttttaatttagtttcttaggaattaa aaagcattacatcctatgtatgtgtgtgcacatagaggccactgcattat gtgtggaaatcagaggacaattttcacaagtcagttctcttccaccagag tgggctctgcggattgacactggtcattaagcttgttgctagcaagtgct ttcacctgctgagtcatcttgctggccccgttttctcatgattttcaaaa aatgcatgtatctgagtccatccttaggaatgtggtgtctgtgagacgga tgtttggtcttctagggagctgcaagtccagaggcagatgaatgtgaaag caggtaggaacttggccagagctttgggcacagcaagctgatgttaaaga gagtggaggcttgctaaagctgacccttgtagcaggctgttctttgagat gtaggaagaatattagaaccaatcttagaaggagacttgagattggcact agtgttgattggtgacagtagtaactgagaaagtctatcctgagcagtac acaggagaactgtgaggcctctgggtacatgccaccgccctgcagatgcc attatcttgagtgagcactggagacttggtaccagctggctttgtgcagc cgagcccagccagcttcgctgatgtggcagttggtgcctgtttctaacgc tctctgggctctctggtgggagccaaggctgccacgggcagcacagtccc agctctgaggcttttaaacactttcagtacagcactctgactctgggaca gccaagtgcttccagctgactatggcctctgctttgtcacccggtccctc tctgggttttactctcatgaaaagagcacaaggttgaaatgatggactgt tgaacccagttgtttccctctcagacccctccacttggttctccagcttt ctgggagaatgccccagtgaagcatgaagggcctgagcctccctttgaat ggttcaagcccttatcttagataaaggagtctgggaacttctggatgacc tgtgttactcctcttcactttgactcccacaatctc
quality values	Open. Hide. 34 17 22 28 58 62 47 47 62 43 47 47 43 54 62 62 47 51 62 62 62 62 35 62 62 62 62 62 62 47 59 13 21 12 17 18 13 23 25 23 24 23 40 39 46 46 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 50 34 24 25 28 28 34 34 36 32 28 36 44 48 28 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 33 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 54 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 38 49 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 56 37 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 58 49 49 58 50 52 58 58 58 58 58 58 58 58 54 58 58 58 54 49 58 54 30 54 54 58 54 52 54 58 58 58 58 45 46 58 58 58 58 48 54 58 58 58 58 58 58 54 58 58 42 27 58 52 58 58 58 58 54 58 38 33 58 58 52 58 39 37 58 58 54 48 58 58 54 58 54 58 45 37 58 53 58 58 58 58 54 49 48 33 58 51 58 58 58 49 51 58 41 51 58 58 41 58 58 28 45 51 42 58 49 58 51 58 54 50 58 51 51 51 51 49 54 58 54 46 35 46 50 51 53 39 54 49 58 49 41 51 58 51 49 32 39 39 49 19 28 41 51 41 27 52 46 26 50 49 58 51 51 52 52 52 58 31 49 39 34 35 51 50 43 39 49 50 58 58 50 58 51 47 33 52 49 50 52 53 39 44 54 32 40 49 41 28 15 27 40 44 51 33 33 39 34 54 51 23 52 34 52 53 53 35 19 19 38 51 49 45 35 44 39 28 49 30 9 54 36 54 54 45 37 32 34 15 29 27 37 37 26 54 53 45 37 42 30 13 54 33 44 18 20 32 53 37 43 34 54 54 36 24 53 31 34 20 53 31 34 36 26 27 37 29 10 9 15 31 40 18 25 25 52 27 21 32 22 33 53 32 31 28 41 26 30 30 28 37 32 32 26 27 15 30 31 42 30 40 12 31 32 41 16 32 45 32 31 31 41 31 36 38 35 39 43 31 31 37 31 31 23 31 36 23 31 22 31 26 30 24 29 32 25 13 20 16 26 30 31 31 29 21 23 27 24 33 20 22 18 24 38 32 37 31 27 24 20 21 16 31 31 25 23 21 13 25 6 46 18 31 26 26 35 44 22 28 32 31 32 38 27 18 5 31 33 31 32 32 31 37 31 34 24 28 25 36 31 44 44 29 21 23 12 21 31 13 22 20 17 34 28 35 44 31 32 34 25 19 21 12 11 16 21 11 9 12 34 9 15 16 31 21 18 22 32 14 19 9 9 14 43 25 18 15 20 14 13 15 21 7 10 9 31 7 21 9 17 15 13 16 30 8 21 15 19 10 14 8 5 6 11 28 18 10 47 11 9 40 29 17 12 13 17 8 30 34 27 7 30 7 13 7 10 17 22 13 21 10 12 7 28 6 8 18 20 3 26 34 29 33 13 7 7 9 8 28	Open. Hide. 46 35 43 38 62 47 47 62 56 43 13 18 15 20 6 21 21 19 21 21 27 28 27 30 34 62 62 59 62 62 62 62 59 59 62 62 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 43 30 39 39 28 38 28 43 34 43 30 43 48 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 45 45 46 46 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 62 62 62 47 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 47 62 62 62 47 62 54 54 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 47 62 47 62 62 62 52 62 62 62 62 62 62 47 41 62 62 62 62 62 47 47 62 62 62 62 62 62 54 43 62 62 54 62 62 62 52 62 62 42 58 49 42 58 41 54 58 58 54 54 58 52 58 49 58 54 54 58 54 49 52 54 42 54 52 58 58 58 54 50 54 58 54 58 58 58 58 58 54 52 42 45 41 54 54 44 47 54 38 58 52 54 58 58 58 58 52 58 58 58 52 58 52 54 58 58 54 36 30 54 34 43 52 58 54 53 46 46 45 37 50 54 50 58 58 50 58 58 58 58 58 54 49 46 31 48 41 47 45 23 52 58 41 41 39 45 58 50 52 58 58 34 32 11 11 29 40 54 30 51 48 37 41 50 52 34 53 46 58 51 53 51 50 58 49 49 48 58 32 48 50 58 50 46 50 46 50 46 53 41 47 44 58 49 49 41 38 51 39 33 58 51 32 54 41 28 41 39 24 58 49 50 17 58 33 50 52 50 31 22 50 45 54 35 50 29 41 52 34 37 42 34 49 35 49 51 39 49 35 46 40 35 39 38 31 53 28 51 54 54 52 32 51 39 39 37 37 53 54 37 34 37 37 33 34 37 25 33 37 39 42 54 42 32 37 41 29 37 30 35 51 54 23 33 25 31 34 33 25 7 28 18 30 41 29 40 53 25 33 16 32 41 31 26 33 16 33 36 52 25 16 23 40 32 52 31 45 31 21 46 12 34 19 31 33 9 46 19 14 51 31 42 51 51 43 31 31 28 23 14 47 22 31 51 51 37 21 17 21 31 38 31 29 31 31 30 46 46 25 20 29 16 31 19 26 46 10 44 35 21 32 24 41 46 18 15 30 31 28 33 19 26 29 28 36 22 32 29 38 30 21 31 10 36 17 30 20 31 16 26 16 13 30 11 18 16 30 28 27 14 32 9 30 41 6 22 10 7 10 20 21 33 8 24 9 9 36 33 18 30 31 24 18 7 36 27 27 24 24 38 8 23 7 17 18 23 14 18 41 42 22 31 6 7 25 11 23 26 31 32 34 32 32 23 11 32 23 5 7 30 5 4 4 4 9 11 13 31 12 17 36 19 22 11 24 9 26 28 10 18 17 15 25 6 10 33 14 32 32 21 19 32 14 33 17 5 16 5 16 40 6 8 8 21 18 9 25 7 12 19 14 7 13 5 6 8 9 8 10 5 3 3 3 12 5 7 20 6 3 3 3 3 8 19 19 28 27 9 18 11 13 13 9 9 23 33 23 18 13 10 20 16 22 11 9 9 3 7 7 6 8 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_70160778_70161956
seq2: B6Ng01-242I06.b_47_1109 (reverse)

seq1  ATAATAAAAAAAAAAAAAACAAAAACAAAAACAAAACTCACTAGGACATT  50
                                                        
seq2  --------------------------------------------------  0

seq1  CTTCTATAAGTGCTTTAGCTATCCCCACTCTGTCCACTTCTAACAGTGGG  100
                                                        
seq2  --------------------------------------------------  0

seq1  TTAAGGATCAGAAAGCATTTCAT-ATAAAAATTAC-AACAGTGA-CTTGG  147
                           || ||||||| ||| |||||||| || ||
seq2  ---------------------ATAATAAAAAATACAAACAGTGACCTGGG  29

seq1  TTTTATGTTTTCCCAAATGTATGTT-CCATCCGAAGCAGTTGCCTTTTCC  196
      ||||||||||||||||   |||||| ||||||||||||||||||||||||
seq2  TTTTATGTTTTCCCAATGTTATGTTCCCATCCGAAGCAGTTGCCTTTTCC  79

seq1  TCTCATTTCTGTGTGGAGAGAGACCCATCTGTTGAGTAAATAGCACTGCT  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCATTTCTGTGTGGAGAGAGACCCATCTGTTGAGTAAATAGCACTGCT  129

seq1  CATCCTGCAGTCCTCTGT-CCTCATGGAGTCTGTGAGATCTTCTTGTCCG  295
      |||| ||||||||||||| |||||||||||||||||||||||||||||||
seq2  CATCTTGCAGTCCTCTGTCCCTCATGGAGTCTGTGAGATCTTCTTGTCCG  179

seq1  CATCTTCGTCCTGTGCTGAGGACCTGGAGGCAGGCTCTTGGCAGGTCTTC  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTTCGTCCTGTGCTGAGGACCTGGAGGCAGGCTCTTGGCAGGTCTTC  229

seq1  AGGTGGTGAGTGACGTGGCACTTGGTTAGATCGACCTTTCTACATTGTTT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGGTGAGTGACGTGGCACTTGGTTAGATCGACCTTTCTACATTGTTT  279

seq1  GCAGACATAATCTCGTTTTCCTCCGGGAGAATTGAGATGCTTCTTCAAGT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGACATAATCTCGTTTTCCTCCGGGAGAATTGAGATGCTTCTTCAAGT  329

seq1  GGTTTGTTCTCAAGAACAGTTTATTGCACTTCGGACGCTTGGTCTGGCGT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTGTTCTCAAGAACAGTTTATTGCACTTCGGACGCTTGGTCTGGCGT  379

seq1  TCTTGCGGGCGGATGAGCACGGGCTGCTTGAGGCCCTGTCTCCGCATGGA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCGGGCGGATGAGCACGGGCTGCTTGAGGCCCTGTCTCCGCATGGA  429

seq1  CAGCTTGTCACAGGAATCACACTTGAGATTCTTCTCACCCGTGTGGATGG  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTGTCACAGGAATCACACTTGAGATTCTTCTCACCCGTGTGGATGG  479

seq1  CCATATGAGACTCCAGGTGAGCCTTCTGCGTGAGAGACTTGTCCCACAAA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATATGAGACTCCAGGTGAGCCTTCTGCGTGAGAGACTTGTCCCACAAA  529

seq1  GTACACCTATAATTCTTCTGACCTGTATGAATGTTGAGGTGTGTCTATAG  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACACCTATAATTCTTCTGACCTGTATGAATGTTGAGGTGTGTCTATAG  579

seq1  GTTGCTTGGATCACCAAAAGTCTTGCTACAAAAATCACACTTGTGGGGGT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGCTTGGATCACCAAAAGTCTTGCTACAAAAATCACACTTGTGGGGGT  629

seq1  TCCCCCATATGACCCATTAAGTGCACGTGGGGTTTGGAAGGAGAGATGAA  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCCATATGACCCATTAAGTGCACGTGGGGTTTGGAAGGAGAGATGAA  679

seq1  AGCCTGGGGGTATAGAGAACACTTCCTTTCCTTGCTGTGGCTTGGCCTGT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGGGGGTATAGAGAACACTTCCTTTCCTTGCTGTGGCTTGGCCTGT  729

seq1  GGCTGCTGCTGTGGCCCTGGCTAGGGAGATGATTATGGATGTGGCTTGTC  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTGCTGTGGCCCTGGCTAGGGAGATGATTATGGATGTGGCTTGTC  779

seq1  AGATGAGCTGCGAACTCTGACTAGGAATTGTACTCCTTGCCACAGTTACA  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGAGCTGCGAACTCTGACTAGGAATTGTACTCCTTGCCACAGTTACA  829

seq1  GAGGTACACATCTGGGTATTCAAGAACACTTACCTGTTGAGCATAATTCC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTACACATCTGGGTATTCAAGAACACTTACCTGTTGAGCATAATTCC  879

seq1  GGCTGTAATGGAAAAGCAGCTCACTTTCAGGAGGGATGTCTTGTGAGGTA  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGTAATGGAAAAGCAGCTCACTTTCAGGAGGGATGTCTTGTGAGGTA  929

seq1  CGAGGATAGATTTTTCCATCATGGGGCTAGGCCACCAAATTCTGTTCTTC  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGGATAGATTTTTCCATCATGGGGCTAGGCCACCAAATTCTGTTCTTC  979

seq1  ACGGTTCCTAGCTTTGCGTGCACGCACACACACACAAATCATCTAATTAC  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGTTCCTAGCTTTGCGTGCACGCACACACACACAAATCATCTAATTAC  1029

seq1  ACACATTTTTATCAGTTGCAATGATGCAGAATTC  1179
      ||||||||||||||||||||||||||||||||||
seq2  ACACATTTTTATCAGTTGCAATGATGCAGAATTC  1063

seq1: chr14_70013666_70014731
seq2: B6Ng01-242I06.g_67_1152

seq1  GAATTCATTTATTCATTCTATTTTTTTTAATTTAGTTTCTTAGGAATTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTTATTCATTCTATTTTTTTTAATTTAGTTTCTTAGGAATTAA  50

seq1  AAAGCATTACATCCTATGTATGTGTGTGCACATAGAGGCCACTGCATTAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCATTACATCCTATGTATGTGTGTGCACATAGAGGCCACTGCATTAT  100

seq1  GTGTGGAAATCAGAGGACAATTTTCACAAGTCAGTTCTCTTCCACCAGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGGAAATCAGAGGACAATTTTCACAAGTCAGTTCTCTTCCACCAGAG  150

seq1  TGGGCTCTGCGGATTGACACTGGTCATTAAGCTTGTTGCTAGCAAGTGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTCTGCGGATTGACACTGGTCATTAAGCTTGTTGCTAGCAAGTGCT  200

seq1  TTCACCTGCTGAGTCATCTTGCTGGCCCCGTTTTCTCATGATTTTCAAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACCTGCTGAGTCATCTTGCTGGCCCCGTTTTCTCATGATTTTCAAAA  250

seq1  AATGCATGTATCTGAGTCCATCCTTAGGAATGTGGTGTCTGTGAGACGGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCATGTATCTGAGTCCATCCTTAGGAATGTGGTGTCTGTGAGACGGA  300

seq1  TGTTTGGTCTTCTAGGGAGCTGCAAGTCCAGAGGCAGATGAATGTGAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTGGTCTTCTAGGGAGCTGCAAGTCCAGAGGCAGATGAATGTGAAAG  350

seq1  CAGGTAGGAACTTGGCCAGAGCTTTGGGCACAGCAAGCTGATGTTAAAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTAGGAACTTGGCCAGAGCTTTGGGCACAGCAAGCTGATGTTAAAGA  400

seq1  GAGTGGAGGCTTGCTAAAGCTGACCCTTGTAGCAGGCTGTTCTTTGAGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGAGGCTTGCTAAAGCTGACCCTTGTAGCAGGCTGTTCTTTGAGAT  450

seq1  GTAGGAAGAATATTAGAACCAATCTTAGAAGGAGACTTGAGATTGGCACT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGAAGAATATTAGAACCAATCTTAGAAGGAGACTTGAGATTGGCACT  500

seq1  AGTGTTGATTGGTGACAGTAGTAACTGAGAAAGTCTATCCTGAGCAGTAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTTGATTGGTGACAGTAGTAACTGAGAAAGTCTATCCTGAGCAGTAC  550

seq1  ACAGGAGAACTGTGAGGCCTCTGGGTACATGCCACCGCCCTGCAGATGCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGAGAACTGTGAGGCCTCTGGGTACATGCCACCGCCCTGCAGATGCC  600

seq1  ATTATCTTGAGTGAGCACTGGAGACTTGGTACCAGCTGGCTTTGTGCAGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATCTTGAGTGAGCACTGGAGACTTGGTACCAGCTGGCTTTGTGCAGC  650

seq1  CGAGCCCAGCCAGCTTCGCTGATGTGGCAGTTGGTGCCTGTTTCTAACGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGCCCAGCCAGCTTCGCTGATGTGGCAGTTGGTGCCTGTTTCTAACGC  700

seq1  TCTCTGGGCTCTCTGGTGGGAGCCAAGGCTGCCACGGGCAGCACAGTCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGGGCTCTCTGGTGGGAGCCAAGGCTGCCACGGGCAGCACAGTCCC  750

seq1  AGCTCTGAGGCTTTTAAACACTTTCAGTACAGCACTCTGACTCTGGGACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTGAGGCTTTTAAACACTTTCAGTACAGCACTCTGACTCTGGGACA  800

seq1  GCCAAGTGCTTCCAGCTGACTATGGCCTCTGC-TTGTCA-CCGGTCCCTC  848
      |||||||||||||||||||||||||||||||| |||||| ||||||||||
seq2  GCCAAGTGCTTCCAGCTGACTATGGCCTCTGCTTTGTCACCCGGTCCCTC  850

seq1  TCTGGGTTTTACTCTCATGAAAAGAGCACAAGGTTGAAATGATGGACTGT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGTTTTACTCTCATGAAAAGAGCACAAGGTTGAAATGATGGACTGT  900

seq1  TGAACCAAGTTGTT--CCTCTCAGACCC--TCACTTGG-TCTCCAGC-TT  942
      |||||| |||||||  ||||||||||||   ||||||| |||||||| ||
seq2  TGAACCCAGTTGTTTCCCTCTCAGACCCCTCCACTTGGTTCTCCAGCTTT  950

seq1  CT-GGAG-ATG-CCCAGTG-AGCATGAAGGG-CTGAGCCTCCCTTTG-AT  986
      || |||| ||| ||||||| ||||||||||| ||||||||||||||| ||
seq2  CTGGGAGAATGCCCCAGTGAAGCATGAAGGGCCTGAGCCTCCCTTTGAAT  1000

seq1  GG-TCAAG-CCTTATCTTAGATAAA-GAGTCTGGGGAC-TCTGAATGACT  1032
      || ||||| |||||||||||||||| ||||||||| || |||| ||||| 
seq2  GGTTCAAGCCCTTATCTTAGATAAAGGAGTCTGGGAACTTCTGGATGACC  1050

seq1  TGTG-TACTCCTC-TCACTTTGACTCCCACCATCTC  1066
      |||| |||||||| |||||||||||||||| |||||
seq2  TGTGTTACTCCTCTTCACTTTGACTCCCACAATCTC  1086

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information