MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-247D01
Chromosome	14 (Build37)	7 (Build37)
Map Location	57,650,536 - 57,651,419	117,363,692 - 117,363,959
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	Mcpt2, Mcpt4, Mcpt8, Ctsg, Gzme, Gzmd, Gzmg, LOC672095, Gzmn, LOC100042770, LOC668072, LOC668074, Gzmf, Gzmc, LOC219102, Gzmb, LOC668082, Atp12a, Rnf17, Cenpj, Parp4, LOC100042788, 4930548G07Rik, Pspc1, LOC100043499, 9830124H08Rik, LOC100042797, LOC219106, LOC668118, Zmym2, LOC100042817, B020004C17Rik
Downstream gene	Gja3, Gjb2, LOC100043515, Gjb6, LOC668140, Cryl1, LOC668090, AU040096, Ift88, Il17d, N6amt2, Xpo4, Lats2, Sap18, F630043A04Rik, Mrp63, Zdhhc20, Efha1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mcpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17225 MGI:96938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17227 MGI:96940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17231 MGI:1261780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13035 MGI:88563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzme (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14942 MGI:109265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14941 MGI:109255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14944 MGI:109253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Gzmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245839 MGI:2675494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042770 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC668072 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	LOC668074 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	Gzmf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14943 MGI:109254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14940 MGI:109256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC219102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:219102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gzmb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14939 MGI:109267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668082 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	Atp12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192113 MGI:1926943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30054 MGI:1353419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219103 MGI:2684927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328417 MGI:2685589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs, 2 Proteins

name	LOC100042788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930548G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75339 MGI:1922589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pspc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66645 MGI:1913895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043499 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	9830124H08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219105 MGI:3041170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042797 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042797
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC219106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:219106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC668118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 221 ESTs, 2 Proteins pseudo : _no_value

name	Zmym2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76007 MGI:1923257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	B020004C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432860 MGI:3588236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 4 Proteins

name	Gja3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14611 MGI:95714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gjb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14619 MGI:95720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gjb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14623 MGI:107588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Cryl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68631 MGI:1915881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668090 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 6 Proteins pseudo : _no_value

name	AU040096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105611 MGI:2145750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	Ift88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21821 MGI:98715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il17d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239114 MGI:2446510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	N6amt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68043 MGI:1915293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpo4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57258 MGI:1888526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lats2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50523 MGI:1354386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sap18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20220 MGI:1277978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F630043A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219114 MGI:3041235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrp63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67840 MGI:1915090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75965 MGI:1923215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68514 MGI:1915764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678837 GeneID:17225 MGI:96938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 2 transcript_id : NM_008571.1

name	Mcpt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205405 GeneID:17227 MGI:96940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 4 transcript_id : NM_010779.2

name	Mcpt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678839 GeneID:17231 MGI:1261780
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 8 transcript_id : NM_008572.1

name	Ctsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681082 GeneID:13035 MGI:88563
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin G transcript_id : NM_007800.1

name	Gzme (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325996 GeneID:14942 MGI:109265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme E transcript_id : NM_010373.3

name	Gzmd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754105 GeneID:14941 MGI:109255
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme D transcript_id : NM_010372.1

name	Gzmg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778833 GeneID:14944 MGI:109253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme G transcript_id : NM_010375.2

name	Gzmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346542 GeneID:245839 MGI:2675494
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme N transcript_id : NM_153052.1

name	LOC100042770 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265615 GeneID:100042770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042770 transcript_id : XM_001478784.1

name	Gzmf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325973 GeneID:14943 MGI:109254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme F transcript_id : NM_010374.3

name	Gzmc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754103 GeneID:14940 MGI:109256
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme C transcript_id : NM_010371.1

name	Gzmb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892516 GeneID:14939 MGI:109267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme B transcript_id : NM_013542.2

name	Atp12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149727 GeneID:192113 MGI:1926943
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+/K+ transporting, nongastric, alpha polypeptide transcript_id : NM_138652.1

name	Rnf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74271881 GeneID:30054 MGI:1353419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 17 transcript_id : NM_001033043.1

name	Cenpj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945401 GeneID:219103 MGI:2684927
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein J transcript_id : NM_001014996.1

name	Parp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265621 GeneID:328417 MGI:2685589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs, 2 Proteins product : poly (ADP-ribose) polymerase family, member 4 transcript_id : XM_994286.2

name	4930548G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13357211 GeneID:75339 MGI:1922589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930548G07 gene transcript_id : NM_023773.1

name	Pspc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366164 GeneID:66645 MGI:1913895
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paraspeckle protein 1 transcript_id : NM_025682.2

name	9830124H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140972029 GeneID:219105 MGI:3041170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830124H08 gene transcript_id : NM_144842.3

name	Zmym2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37595741 GeneID:76007 MGI:1923257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYM-type 2 transcript_id : NM_029498.2

name	B020004C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397170 GeneID:432860 MGI:3588236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 4 Proteins product : RIKEN cDNA B020004C17 gene transcript_id : XM_484380.3

name	Gja3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59710096 GeneID:14611 MGI:95714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 3 transcript_id : NM_016975.2

name	Gjb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542892 GeneID:14619 MGI:95720
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 2 transcript_id : NM_008125.2

name	LOC100043515 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265756 GeneID:100043515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043515 transcript_id : XM_001480243.1

name	Gjb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331125 GeneID:14623 MGI:107588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 6 transcript_id : NM_001010937.1

name	Gjb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476099 GeneID:14623 MGI:107588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 6 transcript_id : NM_008128.3

name	Cryl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892190 GeneID:68631 MGI:1915881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, lambda 1 transcript_id : NM_030004.3

name	AU040096 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265759 GeneID:105611 MGI:2145750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : expressed sequence AU040096 transcript_id : XM_001480259.1

name	Ift88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678332 GeneID:21821 MGI:98715
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 88 homolog (Chlamydomonas) transcript_id : NM_009376.1

name	Il17d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365726 GeneID:239114 MGI:2446510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17D transcript_id : NM_145837.2

name	N6amt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802144 GeneID:68043 MGI:1915293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-6 adenine-specific DNA methyltransferase 2 (putative) transcript_id : NM_026526.2

name	Xpo4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048437 GeneID:57258 MGI:1888526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin 4 transcript_id : NM_020506.1

name	Lats2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448548 GeneID:50523 MGI:1354386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : large tumor suppressor 2 transcript_id : NM_015771.2

name	Sap18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892423 GeneID:20220 MGI:1277978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sin3-associated polypeptide 18 transcript_id : NM_009119.2

name	F630043A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354600 GeneID:219114 MGI:3041235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F630043A04 gene transcript_id : NM_198605.2

name	Mrp63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803571 GeneID:67840 MGI:1915090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein 63 transcript_id : NM_026401.2

name	Zdhhc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719323 GeneID:75965 MGI:1923215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 20 transcript_id : NM_029492.4

name	Efha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802390 GeneID:68514 MGI:1915764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF hand domain family A1 transcript_id : NM_028643.2

name	Mcpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678838 CCDS:CCDS27139.1 GeneID:17225 MGI:96938
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 2 protein_id : NP_032597.1

name	Mcpt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205406 CCDS:CCDS27140.1 GeneID:17227 MGI:96940
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA] [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IDA] codon_start : 1 note : myonase product : mast cell protease 4 protein_id : NP_034909.2

name	Mcpt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678840 CCDS:CCDS27141.1 GeneID:17231 MGI:1261780
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 8 protein_id : NP_032598.1

name	Ctsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681083 CCDS:CCDS27142.1 GeneID:13035 MGI:88563
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004261 - cathepsin G activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : cathepsin G preproprotein protein_id : NP_031826.1

name	Gzme (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982793 CCDS:CCDS27143.1 GeneID:14942 MGI:109265
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : granzyme E protein_id : NP_034503.2

name	Gzmd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754106 GeneID:14941 MGI:109255
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : granzyme D protein_id : NP_034502.1

name	Gzmg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754112 CCDS:CCDS27144.1 GeneID:14944 MGI:109253
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : AKA granzyme G; CTL serine protease 3 product : granzyme G protein_id : NP_034505.1

name	Gzmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346543 CCDS:CCDS27145.1 GeneID:245839 MGI:2675494
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : granzyme N protein_id : NP_694692.1

name	LOC100042770 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265616 GeneID:100042770
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478834.1

name	Gzmf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754110 GeneID:14943 MGI:109254
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : granzyme G; AKA granzyme G; CTL serine protease 3 product : granzyme F protein_id : NP_034504.1

name	Gzmc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754104 CCDS:CCDS27146.1 GeneID:14940 MGI:109256
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : granzyme C protein_id : NP_034501.1

name	Gzmb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305123 CCDS:CCDS27147.1 GeneID:14939 MGI:109267
definition	GO_function : GO:0004278 - granzyme B activity [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0019835 - cytolysis [Evidence IEA]; GO:0008626 - induction of apoptosis by granzyme [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : granzyme B protein_id : NP_038570.1

name	Atp12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149728 CCDS:CCDS27148.1 GeneID:192113 MGI:1926943
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATPase H+K+-transporting, alpha 2 product : ATPase, H+/K+ transporting, nongastric, alpha polypeptide protein_id : NP_619593.1

name	Rnf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74271882 CCDS:CCDS27149.1 GeneID:30054 MGI:1353419
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 note : Max dimerization protein member-interacting protein 2 product : ring finger protein 17 protein_id : NP_001028215.1

name	Cenpj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945402 CCDS:CCDS27150.1 GeneID:219103 MGI:2684927
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0030954 - astral microtubule nucleation [Evidence ISS]; GO:0046427 - positive regulation of JAK-STAT cascade [Evidence ISS] codon_start : 1 exception : mismatches in translation product : centromere protein J protein_id : NP_001014996.1

name	Parp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265622 GeneID:328417 MGI:2685589
definition	codon_start : 1 product : similar to mKIAA0177 protein protein_id : XP_999380.2

name	4930548G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13357212 GeneID:75339 MGI:1922589
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : M-phase phosphoprotein, mpp8 protein_id : NP_076262.1

name	Pspc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228986 CCDS:CCDS27151.1 GeneID:66645 MGI:1913895
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : paraspeckle component 1 product : paraspeckle protein 1 protein_id : NP_079958.2

name	9830124H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140972030 GeneID:219105 MGI:3041170
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC219105 protein_id : NP_659091.3

name	Zmym2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37595742 GeneID:76007 MGI:1923257
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 198 protein_id : NP_083774.2

name	B020004C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954285 GeneID:432860 MGI:3588236
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484380.2

name	Gja3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59710097 CCDS:CCDS27152.1 GeneID:14611 MGI:95714
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 46; alpha 3 connexin; gap junction protein alpha 3 product : gap junction membrane channel protein alpha 3 protein_id : NP_058671.2

name	Gjb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680011 CCDS:CCDS27153.1 GeneID:14619 MGI:95720
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 26 product : gap junction membrane channel protein beta 2 protein_id : NP_032151.1

name	LOC100043515 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265757 GeneID:100043515
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480293.1

name	Gjb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331126 CCDS:CCDS27154.1 GeneID:14623 MGI:107588
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0042471 - ear morphogenesis [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 note : connexin 30; gap junction beta-6 protein product : gap junction membrane channel protein beta 6 protein_id : NP_001010937.1

name	Gjb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680017 CCDS:CCDS27154.1 GeneID:14623 MGI:107588
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0042471 - ear morphogenesis [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 note : connexin 30; gap junction beta-6 protein product : gap junction membrane channel protein beta 6 protein_id : NP_032154.1

name	Cryl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19525729 CCDS:CCDS27155.1 GeneID:68631 MGI:1915881
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA] codon_start : 1 note : crystallin, lamda 1 product : crystallin, lambda 1 protein_id : NP_084280.2

name	AU040096 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265760 GeneID:105611 MGI:2145750
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480309.1

name	Ift88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678333 GeneID:21821 MGI:98715
definition	GO_component : GO:0005930 - axoneme [Evidence IDA]; GO:0005932 - basal body [Evidence IDA]; GO:0019861 - flagellum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0042733 - embryonic digit morphogenesis [Evidence IGI] [Evidence IMP]; GO:0048598 - embryonic morphogenesis [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045862 - positive regulation of proteolysis [Evidence IMP]; GO:0042487 - regulation of odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IGI] [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Oak Ridge polycystic kidneys; transgene insert site 737, insertional mutation, polycystic kidney disease; tetratricopeptide repeat domain 10 product : Tg737 protein protein_id : NP_033402.1

name	Il17d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003886 GeneID:239114 MGI:2446510
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : interleukin 27A product : interleukin 17D protein_id : NP_665836.1

name	N6amt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386022 CCDS:CCDS27157.1 GeneID:68043 MGI:1915293
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA] codon_start : 1 note : Gt(Ayu21)96Imeg product : N-6 adenine-specific DNA methyltransferase 2 (putative) protein_id : NP_080802.1

name	Xpo4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048438 GeneID:57258 MGI:1888526
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : exportin 4 protein_id : NP_065252.1

name	Lats2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448549 CCDS:CCDS27158.1 GeneID:50523 MGI:1354386
definition	GO_component : GO:0000922 - spindle pole [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016730 - oxidoreductase activity, acting on iron-sulfur proteins as donors [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 product : large tumor suppressor 2 protein_id : NP_056586.2

name	Sap18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677847 CCDS:CCDS27159.1 GeneID:20220 MGI:1277978
definition	GO_component : GO:0000118 - histone deacetylase complex [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0016568 - chromatin modification [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Sin3-associated polypeptide 18 protein_id : NP_033145.1

name	F630043A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348456 CCDS:CCDS27160.1 GeneID:219114 MGI:3041235
definition	codon_start : 1 product : hypothetical protein LOC219114 protein_id : NP_941007.1

name	Mrp63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385888 CCDS:CCDS27161.1 GeneID:67840 MGI:1915090
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IDA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 product : mitochondrial ribosomal protein 63 protein_id : NP_080677.1

name	Zdhhc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719324 CCDS:CCDS27162.1 GeneID:75965 MGI:1923215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : DHHC-containing protein 20 protein_id : NP_083768.4

name	Efha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27477043 CCDS:CCDS27163.1 GeneID:68514 MGI:1915764
definition	codon_start : 1 product : Smhs2 homolog protein_id : NP_082919.1

name	LOC672095 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672095
definition	number : 2 pseudo : _no_value

name	LOC672095 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672095
definition	number : 1 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 6 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 5 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 4 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 3 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 2 pseudo : _no_value

name	LOC668072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668072
definition	number : 1 pseudo : _no_value

name	LOC668074 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668074
definition	number : 1 pseudo : _no_value

name	LOC219102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:219102
definition	number : 1 pseudo : _no_value

name	LOC100042788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042788
definition	number : 1 pseudo : _no_value

name	LOC100042797 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042797
definition	number : 1 pseudo : _no_value

name	LOC100042797 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042797
definition	number : 2 pseudo : _no_value

name	LOC219106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:219106
definition	number : 2 pseudo : _no_value

name	LOC219106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:219106
definition	number : 1 pseudo : _no_value

name	LOC100042817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042817
definition	number : 1 pseudo : _no_value

name	LOC100042817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042817
definition	number : 2 pseudo : _no_value

name	LOC100042817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042817
definition	number : 3 pseudo : _no_value

name	LOC100042817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042817
definition	number : 4 pseudo : _no_value

name	LOC100042817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042817
definition	number : 5 pseudo : _no_value

name	LOC668140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668140
definition	number : 1 pseudo : _no_value

name	LOC668082 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265617 GeneID:668082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_033891.1

name	LOC100043499 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265754 GeneID:100043499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c pseudo : _no_value transcript_id : XR_034585.1

name	LOC668118 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265755 GeneID:668118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 221 ESTs, 2 Proteins product : similar to cyclin I pseudo : _no_value transcript_id : XR_034588.1

name	LOC668090 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265758 GeneID:668090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 6 Proteins product : similar to transcription elongation factor B (SIII), polypeptide 2 pseudo : _no_value transcript_id : XR_034599.1

clone name	MSMg01-386O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-297B20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-369B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-396H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293G19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-312A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-247D01.b	B6Ng01-247D01.g
ACC	GA055593	GA055594
length	877	268
definition	B6Ng01-247D01.b	B6Ng01-247D01.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(57,650,536 - 57,651,419)	(117,363,692 - 117,363,959)
sequence	gaattctcaaatgaaagaaaggctactttgggccattgtaaaaagtaatc ttggccagtgaatcaatttccagacttgagccagtttgcagacccagaag cccttgaaggaaggggtagccaggtttccctgaggaaggaccttgttgat gagacacctaaaagttttgctgttagcctttctccagttcttcctcagag ggatctacttccttttacaagggtaactgtacacttggagaaaagtaata atcagaattaccagaggtctattagatcctggctctcaattgacaatgat cccaggagatcccaagaaacatggtgaccctccagttaaagtagggactt atggaggccagtcaactaatggcaatttggctgatgtctgactcagtagg tacagtagatccccaaattcattctgtggtcctttcccctgtttcaggat gtataattaggatagatatacttagaaactggcaaaattctcacattggt tcccttacctttggctattaaggttggcaaggctaaatggaaacctttag agttgtctctgccaaagaaaatagtgaatcaaaaccagtgtcatagcccg gcagtggtggcacacacctttaatcccagcacttggaggcagaggcaggc ggatttctgagttcgaggccagcttggtctacagaatgagttccaggacc accaaggctacacagagaaaccttgtctcaaaaaaccaaaaaaccaaacc aaaccaagtccaaaaccagtgtcatatttcctggaggaaatgcaggaatt agtgccacatcaaggacttaaaagatgcaggggttggtgggtcacaccac atcttcctgttaactctcctatctggc	agaagtccaatgacatccttagctacatatggaggttgaagctagccagg actaaatgaaaccctgcctgtaaattaataaacttcttgatgtccacata tgtcttattttaaaggggacaggagagataaactaatttggaaagagtca aaaaaaaagaaaaaaaaagaataagctgcatcaatgagtttaagggcaga gggaatattgtgatcataaaaagagaaagagctataagaatatgttctat ctgggtgtgggggaaggg
quality values	Open. Hide. 26 18 27 34 40 32 41 15 16 9 16 16 27 50 37 33 33 45 50 47 50 34 25 49 37 48 42 48 52 47 9 8 41 26 7 21 26 10 6 9 9 5 7 7 8 11 11 56 54 62 54 41 62 47 56 43 62 47 62 46 62 62 47 54 56 62 62 62 62 62 54 44 62 16 16 10 11 8 7 8 11 12 21 23 22 24 24 37 43 62 49 35 37 49 62 62 59 59 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 43 31 34 43 43 62 46 59 46 62 59 62 46 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 30 34 56 28 34 34 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 49 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 56 49 33 46 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 54 62 62 39 62 62 28 43 56 62 56 43 47 47 56 56 56 62 56 56 56 56 47 56 56 35 62 54 52 54 52 54 42 62 46 62 52 50 46 62 35 44 52 50 39 62 52 39 62 45 48 62 62 52 54 62 52 42 62 42 49 39 54 22 52 33 47 27 42 52 43 25 36 41 50 52 50 50 46 40 32 37 31 20 43 52 22 28 28 28 33 32 29 41 52 15 42 13 35 42 39 34 32 43 34 30 50 52 38 41 39 32 52 37 49 52 29 30 52 58 37 35 32 28 17 26 30 14 33 22 22 18 21 46 30 34 33 19 18 19 12 12 14 52 37 32 31 26 19 19 33 31 28 52 21 9 17 20 14 22 24 31 33 35 32 19 35 42 23 34 18 41 22 19 50 47 41 26 47 32 27 30 19 26 35 58 51 35 46 35 37 31 48 40 29 24 10 15 26 40 42 23 50 16 35 13 39 32 26 16 16 37 47 24 24 30 24 16 30 32 15 42 27 37 34 37 13 48 31 22 6 14 37 42 25 37 26 13 10 15 20 21 10 13 23 21 13 13 24 28 19 10 51 22 24 15 8 9 25 21 31 39 31 15 15 14 9 19 15 16 20 24 33 26	Open. Hide. 59 62 43 34 30 27 43 36 21 23 28 32 29 32 28 31 32 46 51 59 62 62 62 59 62 62 49 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 59 39 39 28 22 30 40 49 59 56 54 54 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 54 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 62 62 62 62 62 62 62 38 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_57650536_57651419
seq2: B6Ng01-247D01.b_660_751

seq1  CCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCAAGGCCAGT  50
      |||||||||| |||||||||||||||| ||||||||||||| ||||||| 
seq2  CCCAGCACTT-GGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGC  49

seq1  CTGGTCTACAGAGTGAGTTCCAGGATAGCCAGGGCTACACAGAGAAACCC  100
       ||||||||||| ||||||||||||   ||| |||||||||||       
seq2  TTGGTCTACAGAATGAGTTCCAGGACCACCAAGGCTACACAGA-------  92

seq1  TGTCTTGAAAAACCAGAAAAAAATTATTATTATTATTACTACTACTACTA  150
                                                        
seq2  --------------------------------------------------  92

seq1  CAACTGAGCATAATGGTTTAACTGGGGAAAACCCCTTAACCCAATTAGGT  200
                                                        
seq2  --------------------------------------------------  92

seq1  TGCAACACCCAGGTTGAGAACCATTAAGATAGAAAGTTCAAGACTAATCT  250
                                                        
seq2  --------------------------------------------------  92

seq1  ACGCTACAGACCATATGTTAAGCAACAAGACTCCAAGAACCCAATACTTT  300
                                                        
seq2  --------------------------------------------------  92

seq1  GAGGCAGATGTTGTAGCTCATGCCTGTAATTCCAGCACTGGGAAGTTGAA  350
                                                        
seq2  --------------------------------------------------  92

seq1  GCAGAATTGTCATGAGGTCCAGGCCAGCCTGAGCTGCAGAATGAGACCGT  400
                                                        
seq2  --------------------------------------------------  92

seq1  GTCCCTAAAGCACATATGAGCAACATACACCTCCCCTCGCTATACTTCAC  450
                                                        
seq2  --------------------------------------------------  92

seq1  CTACTTATCCAGAGCCAGGATATGCCAGAGATACACATGCCCACCTTTCC  500
                                                        
seq2  --------------------------------------------------  92

seq1  TTTCTTTTTCTTTTCTTTTTTTGGATTCGATTTTCTAGACAAAACAAAAC  550
                                                        
seq2  --------------------------------------------------  92

seq1  ACCACCAACAACAAAAACCAAGCAAGCAACCAACCAACCAACCAAACAAA  600
                                                        
seq2  --------------------------------------------------  92

seq1  CAAACAAAACCTAGCTCAGTAAATTCAAGCTTATCAGGTGGTGATAAAAG  650
                                                        
seq2  --------------------------------------------------  92

seq1  AATGTTGAAAATGTAAGTATGGATTTTGTTCTGTGGCTGTTTCTGTTCAC  700
                                                        
seq2  --------------------------------------------------  92

seq1  ATTTTTGGGTTCAGGGTCAGCTGATGTCAAAGAATCTAAATAAAGAGATA  750
                                                        
seq2  --------------------------------------------------  92

seq1  TAATAAGTAGCCAGGTGATGATGCCACACCTTTAATCCCAGTGCTCTGGA  800
                                                        
seq2  --------------------------------------------------  92

seq1  GGCAGAGGCAGGTGGATCTCTGAATTCAAAGCCAGCCTAGCCTGGTTTAC  850
                                                        
seq2  --------------------------------------------------  92

seq1  AGAGTGAATTTCAGGACAGCCAAGGCTACACAGA  884
                                        
seq2  ----------------------------------  92

seq1: chr7_117363692_117363959
seq2: B6Ng01-247D01.g_74_341 (reverse)

seq1  CCCTTCCCCCACACCCAGATAGAACATATTCTTATAGCTCTTTCTCTTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTCCCCCACACCCAGATAGAACATATTCTTATAGCTCTTTCTCTTTT  50

seq1  TATGATCACAATATTCCCTCTGCCCTTAAACTCATTGATGCAGCTTATTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGATCACAATATTCCCTCTGCCCTTAAACTCATTGATGCAGCTTATTC  100

seq1  TTTTTTTTTCTTTTTTTTTGACTCTTTCCAAATTAGTTTATCTCTCCTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTCTTTTTTTTTGACTCTTTCCAAATTAGTTTATCTCTCCTGT  150

seq1  CCCCTTTAAAATAAGACATATGTGGACATCAAGAAGTTTATTAATTTACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTTAAAATAAGACATATGTGGACATCAAGAAGTTTATTAATTTACA  200

seq1  GGCAGGGTTTCATTTAGTCCTGGCTAGCTTCAACCTCCATATGTAGCTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGGTTTCATTTAGTCCTGGCTAGCTTCAACCTCCATATGTAGCTAA  250

seq1  GGATGTCATTGGACTTCT  268
      ||||||||||||||||||
seq2  GGATGTCATTGGACTTCT  268

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information