MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-291K15
Chromosome	14 (Build37)
Map Location	52,824,787 - 52,825,990
singlet/doublet	singlet
Overlap gene	Chd8
Upstream gene	Ear11, LOC100042187, EG633215, LOC100042203, LOC633238, EG638695, Vmn2r-ps110, LOC100042224, Vmn2r88, LOC100042247, V2r10, LOC100043041, EG434459, LOC100043031, LOC667289, EG545047, Ear-ps3, Ang4, Ear-ps4, AY358078, Hn1l-ps1, Ear-ps5, Ear6, Mett11d1, Slc39a2, Ndrg2, Gm77, Rnase13, E130112L23Rik, Zfp219, G630016D24Rik, LOC100042276, Olfr221, LOC667348, LOC667352, Hnrpc, Rpgrip1, Supt16h
Downstream gene	Rab2b, Tox4, Mettl3, Sall2, Olfr1513, LOC193533, Olfr1512, Olfr1511, Olfr1510, OTTMUSG00000015242, Olfr1509, Olfr1508, Olfr1507, LOC671621, EG633692, LOC100042372, EG667441, LOC100042384, Trav5-1, EG667449, LOC671652, Trav6-2, LOC100042410, LOC546612, LOC627394, LOC100042419, Gm701, LOC382180, EG386506, LOC667476, LOC671927, LOC667481, LOC100042444, LOC640196, LOC627273, LOC100043177, LOC640931, EG627232, LOC100043186, LOC100042470, EG328482, LOC100042479, EG667525, LOC100043197, LOC100038850, LOC667542, EG667547, LOC100043214, EG667562, LOC100043202, LOC667574, Gm26, EG667583, Gm1489, C920008G01Rik, LOC667596, EG667604, LOC547329, LOC639655, LOC634322, EG636127, OTTMUSG00000015163, EG667626, LOC620297, LOC100042560, EG667635, LOC100043218, LOC100042568, LOC100043204, EG627424, LOC100043258, LOC100042574
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ear11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93726 MGI:1890465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG633215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633215 MGI:3649093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC633238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 19 Proteins pseudo : _no_value

name	EG638695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638695 MGI:3643454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r-ps110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Vmn2r88 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100042247 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V2r10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22301 MGI:1316707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043041 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG434459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434459 MGI:3646060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043031 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 5 ESTs, 4 Proteins

name	LOC667289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	EG545047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545047 MGI:3648769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497107 MGI:3528619
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 3 pseudo : _no_value

name	Ang4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219033 MGI:2656551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497108 MGI:3528621
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 4 pseudo : _no_value

name	AY358078 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:278676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hn1l-ps1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606510
definition	note : hematological and neurological expressed 1-like pseudogene 1 pseudo : _no_value

name	Ear-ps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503848 MGI:3528623
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 5 pseudo : _no_value

name	Ear6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93719 MGI:1890463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mett11d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52535 MGI:1098577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214922 MGI:2684326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndrg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29811 MGI:1352498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm77 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219038 MGI:2684923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins

name	Rnase13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497071 MGI:3528592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130112L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268739 MGI:2685515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69890 MGI:1917140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	G630016D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619301 MGI:3588246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042276 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Olfr221 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258420 MGI:3030055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins pseudo : _no_value

name	LOC667352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Hnrpc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15381 MGI:107795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpgrip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77945 MGI:1932134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt16h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114741 MGI:1890948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67772 MGI:1915022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76338 MGI:1923588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tox4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268741 MGI:1915389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mettl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56335 MGI:1927165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sall2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50524 MGI:1354373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258008 MGI:3031347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC193533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:193533
definition	note : proteasome alpha subunit C8 pseudogene pseudo : _no_value

name	Olfr1512 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258424 MGI:3031346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1511 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258268 MGI:3031345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1510 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258423 MGI:3031344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627171 MGI:3651476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Olfr1509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57271 MGI:3031343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1508 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57270 MGI:3031342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57269 MGI:3031341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG633692 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633692 MGI:3644290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC100042372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG667441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667441 MGI:3644489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins

name	LOC100042384 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Trav5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG667449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667449 MGI:3644497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC671652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	Trav6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100042410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	LOC546612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC627394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins

name	LOC100042419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Gm701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277146 MGI:2685547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC382180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG386506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386506 MGI:3647344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins

name	LOC667476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC671927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC667481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100042444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC640196 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC627273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 13 Proteins

name	LOC100043177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 25 Proteins

name	LOC640931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	EG627232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627232 MGI:3643503
definition	note : predicted gene, EG627232 pseudo : _no_value

name	LOC100043186 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100042470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG328482 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328482 MGI:3704129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins

name	LOC100042479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins

name	EG667525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667525 MGI:3647073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 651 ESTs, 8 Proteins

name	LOC100043197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins

name	LOC100038850 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667542 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	EG667547 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667547 MGI:3643151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100043214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins

name	EG667562 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667562 MGI:3643203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC667574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	Gm26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195296 MGI:2684872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	EG667583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667583 MGI:3704130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	Gm1489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385047 MGI:2686335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	C920008G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320734 MGI:2444626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins

name	LOC667596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	EG667604 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667604 MGI:3647760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC547329 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC639655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC634322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins

name	EG636127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636127 MGI:3644878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	OTTMUSG00000015163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279872 MGI:3649609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG667626 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667626 MGI:3647936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC620297 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC100042560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG667635 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667635 MGI:3644782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins

name	LOC100043218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 26 Proteins

name	LOC100042568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	LOC100043204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 11 Proteins

name	EG627424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627424 MGI:3645758
definition	note : predicted gene, EG627424 pseudo : _no_value

name	LOC100043258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100042574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Ear11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981459 GeneID:93726 MGI:1890465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 11 transcript_id : NM_053113.2

name	EG638695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986666 GeneID:638695 MGI:3643454
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG638695 transcript_id : NM_001039250.1

name	LOC100042224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265533 GeneID:100042224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Patatin-like phospholipase domain containing 4 transcript_id : XM_001477754.1

name	V2r10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678530 GeneID:22301 MGI:1316707
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 10 transcript_id : NM_009487.1

name	V2r10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376151 GeneID:22301 MGI:1316707
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 10 transcript_id : NM_009486.2

name	LOC100043041 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265651 GeneID:100043041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : similar to gag polyprotein transcript_id : XM_001479251.1

name	EG434459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000675 GeneID:434459 MGI:3646060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434459 transcript_id : NM_001013816.1

name	LOC100043031 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265648 GeneID:100043031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 5 ESTs, 4 Proteins product : hypothetical protein LOC100043031 transcript_id : XM_001479241.1

name	EG545047 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376804 GeneID:545047 MGI:3648769
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545047 transcript_id : NM_001034102.2

name	Ang4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803425 GeneID:219033 MGI:2656551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiogenin, ribonuclease A family, member 4 transcript_id : NM_177544.3

name	AY358078 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:39930560 GeneID:278676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY358078 transcript_id : NM_194347.1

name	Ear6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32891936 GeneID:93719 MGI:1890463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 6 transcript_id : NM_053111.2

name	Mett11d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725395 GeneID:52535 MGI:1098577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase 11 domain containing 1 transcript_id : NM_001029990.1

name	Slc39a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179303 GeneID:214922 MGI:2684326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 2 transcript_id : NM_001039676.1

name	Ndrg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305304 GeneID:29811 MGI:1352498
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-myc downstream regulated gene 2 transcript_id : NM_013864.1

name	Gm77 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265657 GeneID:219038 MGI:2684923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : gene model 77, (NCBI) transcript_id : XM_001479332.1

name	Rnase13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58743352 GeneID:497071 MGI:3528592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 13 (non-active) transcript_id : NM_001011687.1

name	E130112L23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349829 GeneID:268739 MGI:2685515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130112L23 gene transcript_id : NM_198249.3

name	Zfp219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794417 GeneID:69890 MGI:1917140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 219 transcript_id : NM_027248.1

name	G630016D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802807 GeneID:619301 MGI:3588246
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA G630016D24 gene transcript_id : NM_001033805.2

name	LOC100042276 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265537 GeneID:100042276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042276 transcript_id : XM_001477865.1

name	Olfr221 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227331 GeneID:258420 MGI:3030055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 221 transcript_id : NM_001001808.1

name	Hnrpc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354302 GeneID:15381 MGI:107795
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein C transcript_id : NM_016884.2

name	Rpgrip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350719 GeneID:77945 MGI:1932134
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinitis pigmentosa GTPase regulator interacting protein 1 transcript_id : NM_023879.2

name	Supt16h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368713 GeneID:114741 MGI:1890948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 16 homolog (S. cerevisiae) transcript_id : NM_033618.2

name	Chd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392063 GeneID:67772 MGI:1915022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 8 transcript_id : NM_201637.2

name	Rab2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369412 GeneID:76338 MGI:1923588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB2B, member RAS oncogene family transcript_id : NM_172601.2

name	Tox4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382428 GeneID:268741 MGI:1915389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TOX high mobility group box family member 4 transcript_id : NM_023434.2

name	Mettl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77627972 GeneID:56335 MGI:1927165
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase-like 3 transcript_id : NM_019721.2

name	Sall2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49087133 GeneID:50524 MGI:1354373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sal-like 2 (Drosophila) transcript_id : NM_015772.2

name	Olfr1513 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676584 GeneID:258008 MGI:3031347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1513 transcript_id : NM_001012269.1

name	Olfr1512 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239053 GeneID:258424 MGI:3031346
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1512 transcript_id : NM_146432.1

name	Olfr1511 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129740 GeneID:258268 MGI:3031345
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1511 transcript_id : NM_146271.1

name	Olfr1510 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239055 GeneID:258423 MGI:3031344
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1510 transcript_id : NM_146431.1

name	Olfr1509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11464992 GeneID:57271 MGI:3031343
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1509 transcript_id : NM_020514.1

name	Olfr1508 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821657 GeneID:57270 MGI:3031342
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1508 transcript_id : NM_020513.2

name	Olfr1507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048447 GeneID:57269 MGI:3031341
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1507 transcript_id : NM_020512.1

name	EG633692 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397073 GeneID:633692 MGI:3644290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : predicted gene, EG633692 transcript_id : XM_990534.1

name	LOC100042372 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265544 GeneID:100042372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to unnamed protein product transcript_id : XM_001478064.1

name	EG667449 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265546 GeneID:667449 MGI:3644497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG667449 transcript_id : XM_990610.2

name	LOC671652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265548 GeneID:671652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to TRAV7-1 transcript_id : XM_001478118.1

name	LOC100042410 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265551 GeneID:100042410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to TRAV7D-2 transcript_id : XM_001478136.1

name	LOC627394 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265670 GeneID:627394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins product : similar to T-cell receptor alpha precursor transcript_id : XM_207041.7

name	LOC100042419 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265554 GeneID:100042419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to T cell receptor alpha transcript_id : XM_001478155.1

name	LOC382180 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265558 GeneID:382180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to T-cell receptor alpha chain transcript_id : XM_001478172.1

name	EG386506 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82954105 GeneID:386506 MGI:3647344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : predicted gene, EG386506 transcript_id : XM_359354.4

name	LOC667476 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397082 GeneID:667476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to TRAV8D-1 transcript_id : XM_990762.1

name	LOC671927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265560 GeneID:671927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to TRAV9-1 transcript_id : XM_001478200.1

name	LOC667481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265562 GeneID:667481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to T cell receptor alpha MD13 transcript_id : XM_990789.2

name	LOC100042444 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265564 GeneID:100042444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to TRAV6-6 transcript_id : XM_001478230.1

name	LOC640196 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265566 GeneID:640196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to T-cell receptor alpha-chain precursor VJC transcript_id : XM_001478240.1

name	LOC100043177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265676 GeneID:100043177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 25 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_001479512.1

name	LOC640931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265568 GeneID:640931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : similar to TRAV13D-1 transcript_id : XM_001478254.1

name	LOC100043186 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265678 GeneID:100043186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : hypothetical protein LOC100043186 transcript_id : XM_001479521.1

name	LOC100042470 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265570 GeneID:100042470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100042470 transcript_id : XM_001478272.1

name	LOC100042479 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265572 GeneID:100042479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to T-cell receptor alpha chain (lysozyme peptide specific) - mouse transcript_id : XM_001478285.1

name	EG667525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397092 GeneID:667525 MGI:3647073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 651 ESTs, 8 Proteins product : predicted gene, EG667525 transcript_id : XM_991053.1

name	LOC100043197 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265682 GeneID:100043197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins product : similar to T cell receptor V alpha 8.5 transcript_id : XM_001479539.1

name	LOC100038850 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265365 GeneID:100038850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038850 transcript_id : XM_001471582.1

name	LOC667542 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265574 GeneID:667542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_991132.2

name	LOC100043214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265690 GeneID:100043214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins product : similar to T cell receptor alpha chain TCRalphaJ12A transcript_id : XM_001479584.1

name	LOC100043202 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265686 GeneID:100043202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : hypothetical protein LOC100043202 transcript_id : XM_001479551.1

name	LOC667574 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265695 GeneID:667574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to A430107P09Rik protein transcript_id : XM_991287.2

name	Gm26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51768682 GeneID:195296 MGI:2684872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : gene model 26, (NCBI) transcript_id : XM_111555.4

name	EG667583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397117 GeneID:667583 MGI:3704130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : predicted gene, EG667583 transcript_id : XM_991341.1

name	LOC667596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397119 GeneID:667596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to TRAV13-3 transcript_id : XM_991386.1

name	EG667604 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397121 GeneID:667604 MGI:3647760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG667604 transcript_id : XM_991409.1

name	LOC547329 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265575 GeneID:547329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to T-cell receptor alpha chain transcript_id : XM_001478379.1

name	LOC639655 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265577 GeneID:639655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to T-cell receptor alpha chain transcript_id : XM_916174.3

name	EG636127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265579 GeneID:636127 MGI:3644878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG636127 transcript_id : XM_911417.3

name	EG667626 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265583 GeneID:667626 MGI:3647936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG667626 transcript_id : XM_991545.2

name	LOC620297 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265585 GeneID:620297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to TRAV6D-6 transcript_id : XM_001478422.1

name	EG667635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397130 GeneID:667635 MGI:3644782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG667635, transcript variant 2 transcript_id : XM_991597.1

name	EG667635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265697 GeneID:667635 MGI:3644782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG667635, transcript variant 1 transcript_id : XM_001479619.1

name	LOC100043218 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265693 GeneID:100043218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 26 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_001479593.1

name	LOC100042568 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265587 GeneID:100042568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to TRAV13D-1 transcript_id : XM_001478435.1

name	LOC100043204 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265688 GeneID:100043204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 11 Proteins product : similar to T-cell receptor alpha transcript_id : XM_001479556.1

name	LOC100043258 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265699 GeneID:100043258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : hypothetical protein LOC100043258 transcript_id : XM_001479624.1

name	LOC100042574 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265591 GeneID:100042574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100042574 transcript_id : XM_001478450.1

name	Ear11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981460 CCDS:CCDS27041.1 GeneID:93726 MGI:1890465
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence ISS] codon_start : 1 note : eosinophil-associated ribonuclease 11 product : eosinophil-associated, ribonuclease A family, member 11 protein_id : NP_444343.2

name	EG638695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986667 GeneID:638695 MGI:3643454
definition	codon_start : 1 product : hypothetical protein LOC638695 protein_id : NP_001034339.1

name	LOC100042224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265534 GeneID:100042224
definition	codon_start : 1 product : similar to Patatin-like phospholipase domain containing 4 protein_id : XP_001477804.1

name	V2r10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678531 GeneID:22301 MGI:1316707
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; vomeronasal organ family 2, receptor, 10; vomeronasal 2, receptor, 11; vomeronasal organ family 2, receptor, 11 product : vomeronasal 2, receptor, 10 isoform 2 protein_id : NP_033513.1

name	V2r10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678529 GeneID:22301 MGI:1316707
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; vomeronasal organ family 2, receptor, 10; vomeronasal 2, receptor, 11; vomeronasal organ family 2, receptor, 11 product : vomeronasal 2, receptor, 10 isoform 1 protein_id : NP_033512.1

name	LOC100043041 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265652 GeneID:100043041
definition	codon_start : 1 product : similar to gag polyprotein protein_id : XP_001479301.1

name	EG434459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000676 GeneID:434459 MGI:3646060
definition	codon_start : 1 product : hypothetical protein LOC434459 protein_id : NP_001013838.1

name	LOC100043031 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265649 GeneID:100043031
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479291.1

name	EG545047 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539458 CCDS:CCDS27042.1 GeneID:545047 MGI:3648769
definition	codon_start : 1 product : hypothetical protein LOC545047 protein_id : NP_001029274.1

name	Ang4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789437 GeneID:219033 MGI:2656551
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] GO_process : GO:0019733 - antibacterial humoral response (sensu Vertebrata) [Evidence IDA]; GO:0042742 - defense response to bacterium [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy note : angiogenin 4 product : angiogenin, ribonuclease A family, member 4 protein_id : NP_808212.1

name	AY358078 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:39930561 GeneID:278676
definition	codon_start : 1 product : hypothetical protein LOC278676 protein_id : NP_919328.1

name	Ear6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426871 CCDS:CCDS27045.1 GeneID:93719 MGI:1890463
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence ISS] [Evidence IDA] codon_start : 1 note : eosinophil-associated ribonuclease 6 product : eosinophil-associated, ribonuclease A family, member 6 protein_id : NP_444341.1

name	Mett11d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725396 GeneID:52535 MGI:1098577
definition	codon_start : 1 product : D14Ertd209e protein protein_id : NP_001025161.1

name	Slc39a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179304 GeneID:214922 MGI:2684326
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0030001 - metal ion transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 exception : mismatches in translation product : solute carrier family 39 (zinc transporter), member 2 protein_id : NP_001034765.1

name	Ndrg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305305 CCDS:CCDS27047.1 GeneID:29811 MGI:1352498
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : N-myc downstream regulated 2 product : N-myc downstream regulated gene 2 protein_id : NP_038892.1

name	Gm77 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265658 GeneID:219038 MGI:2684923
definition	codon_start : 1 product : hypothetical protein LOC219038 protein_id : XP_001479382.1

name	Rnase13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58743353 CCDS:CCDS27048.1 GeneID:497071 MGI:3528592
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : ribonuclease 13 product : ribonuclease, RNase A family, 13 (non-active) protein_id : NP_001011687.1

name	E130112L23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625819 GeneID:268739 MGI:2685515
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC268739 protein_id : NP_937892.2

name	Zfp219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794418 GeneID:69890 MGI:1917140
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 219 protein_id : NP_081524.1

name	G630016D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702141 CCDS:CCDS27049.1 GeneID:619301 MGI:3588246
definition	codon_start : 1 product : hypothetical protein LOC619301 protein_id : NP_001028977.1

name	LOC100042276 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265538 GeneID:100042276
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477915.1

name	Olfr221 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227332 CCDS:CCDS27050.1 GeneID:258420 MGI:3030055
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02SYYB8M-929-258; olfactory receptor MOR205-1; olfactory receptor 221, pseudogene 1 product : olfactory receptor 221 protein_id : NP_001001808.1

name	Hnrpc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393544 GeneID:15381 MGI:107795
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0045120 - pronucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : heterogeneous nuclear ribonucleoprotein C1; heterogeneous nuclear ribonucleoprotein C2; hnRNP C1; hnRNP C2; snoRNA MBI-122; heterogeneous ribonucleoprotein C1/C2 product : heterogeneous nuclear ribonucleoprotein C protein_id : NP_058580.1

name	Rpgrip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13569852 GeneID:77945 MGI:1932134
definition	GO_component : GO:0005930 - axoneme [Evidence IDA]; GO:0005929 - cilium [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 product : retinitis pigmentosa GTPase regulator interacting protein 1 protein_id : NP_076368.1

name	Supt16h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809048 CCDS:CCDS27051.1 GeneID:114741 MGI:1890948
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008235 - metalloexopeptidase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : suppressor of Ty 16 homolog protein_id : NP_291096.1

name	Chd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392064 GeneID:67772 MGI:1915022
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004853 - uroporphyrinogen decarboxylase activity [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006779 - porphyrin biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : axis duplication inhibitor; helicase with SNF2 domain 1 product : chromodomain helicase DNA binding protein 8 protein_id : NP_963999.2

name	Rab2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30525051 CCDS:CCDS27052.1 GeneID:76338 MGI:1923588
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB2B protein protein_id : NP_766189.1

name	Tox4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963679 GeneID:268741 MGI:1915389
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : epidermal Langerhans cell protein LCP1 protein_id : NP_075923.1

name	Mettl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77627973 CCDS:CCDS27053.1 GeneID:56335 MGI:1927165
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016422 - mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0001734 - mRNA (N6-adenosine)-methyltransferase activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016556 - mRNA modification [Evidence ISS]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA]; GO:0001510 - RNA methylation [Evidence ISS] codon_start : 1 note : m6a methyltransferase product : methyltransferase-like 3 protein_id : NP_062695.2

name	Sall2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49087134 CCDS:CCDS27054.1 GeneID:50524 MGI:1354373
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : sal-like 2 protein_id : NP_056587.2

name	Olfr1513 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676585 CCDS:CCDS27055.1 GeneID:258008 MGI:3031347
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RJGY-644134-645075; GA_x5J8B7TYTVL-817-1341; olfactory receptor MOR223-7P product : olfactory receptor 1513 protein_id : NP_001012269.1

name	Olfr1512 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239054 CCDS:CCDS27056.1 GeneID:258424 MGI:3031346
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2RJGY-622120-623061; olfactory receptor MOR223-5 product : olfactory receptor 1512 protein_id : NP_666643.1

name	Olfr1511 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129741 CCDS:CCDS27057.1 GeneID:258268 MGI:3031345
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RJGY-608749-609705; olfactory receptor MOR223-9 product : olfactory receptor 1511 protein_id : NP_666383.1

name	Olfr1510 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239056 CCDS:CCDS27058.1 GeneID:258423 MGI:3031344
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2RJGY-583652-584608; olfactory receptor MOR223-6 product : olfactory receptor 1510 protein_id : NP_666642.1

name	OTTMUSG00000015242 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:627171 MGI:3651476
definition	codon_start : 1 exception : rearrangement required for product

name	Olfr1509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11464993 CCDS:CCDS27060.1 GeneID:57271 MGI:3031343
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR244-3; GA_x6K02T2RJGY-534312-533386; gene for odorant receptor MOR83 product : odorant receptor MOR83 protein_id : NP_065260.1

name	Olfr1508 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048450 CCDS:CCDS27061.1 GeneID:57270 MGI:3031342
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR244-2; GA_x6K02T2RJGY-520647-521579; gene for odorant receptor MOR10 product : odorant receptor MOR10 protein_id : NP_065259.1

name	Olfr1507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048448 CCDS:CCDS27062.1 GeneID:57269 MGI:3031341
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR244-1; GA_x6K02T2RJGY-491851-492792; gene for odorant receptor MOR28 product : odorant receptor MOR28 protein_id : NP_065258.1

name	EG633692 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397074 GeneID:633692 MGI:3644290
definition	codon_start : 1 product : similar to ATPase, H+ transporting, lysosomal accessory protein 2 protein_id : XP_995628.1

name	LOC100042372 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265545 GeneID:100042372
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478114.1

name	EG667441 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667441 MGI:3644489
definition	codon_start : 1 exception : rearrangement required for product

name	Trav5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:633740
definition	codon_start : 1 exception : rearrangement required for product

name	EG667449 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265547 GeneID:667449 MGI:3644497
definition	codon_start : 1 product : similar to T-cell receptor alpha-chain protein_id : XP_995704.2

name	LOC671652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265549 GeneID:671652
definition	codon_start : 1 product : similar to TRAV7-1 protein_id : XP_001478168.1

name	Trav6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:436539
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100042410 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265552 GeneID:100042410
definition	codon_start : 1 product : similar to TRAV7D-2 protein_id : XP_001478186.1

name	LOC627394 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82954113 GeneID:627394
definition	codon_start : 1 product : hypothetical protein protein_id : XP_207041.2

name	LOC100042419 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265555 GeneID:100042419
definition	codon_start : 1 product : similar to T cell receptor alpha protein_id : XP_001478205.1

name	Gm701 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:277146 MGI:2685547
definition	codon_start : 1 exception : rearrangement required for product

name	LOC382180 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265559 GeneID:382180
definition	codon_start : 1 product : similar to T-cell receptor alpha chain protein_id : XP_001478222.1

name	EG386506 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954106 GeneID:386506 MGI:3647344
definition	codon_start : 1 product : similar to Solute carrier family 45, member 4 protein_id : XP_359354.2

name	LOC667476 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397083 GeneID:667476
definition	codon_start : 1 product : similar to TRAV8D-1 protein_id : XP_995856.1

name	LOC671927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265561 GeneID:671927
definition	codon_start : 1 product : similar to TRAV9-1 protein_id : XP_001478250.1

name	LOC667481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265563 GeneID:667481
definition	codon_start : 1 product : similar to T cell receptor alpha MD13 protein_id : XP_995883.2

name	LOC100042444 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265565 GeneID:100042444
definition	codon_start : 1 product : similar to TRAV6-6 protein_id : XP_001478280.1

name	LOC640196 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265567 GeneID:640196
definition	codon_start : 1 product : similar to T-cell receptor alpha-chain precursor VJC protein_id : XP_001478290.1

name	LOC627273 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:627273
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265677 GeneID:100043177
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_001479562.1

name	LOC640931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265569 GeneID:640931
definition	codon_start : 1 product : similar to TRAV13D-1 protein_id : XP_001478304.1

name	LOC100043186 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265679 GeneID:100043186
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479571.1

name	LOC100042470 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265571 GeneID:100042470
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478322.1

name	EG328482 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:328482 MGI:3704129
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100042479 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265573 GeneID:100042479
definition	codon_start : 1 product : similar to T-cell receptor alpha chain (lysozyme peptide specific) - mouse protein_id : XP_001478335.1

name	EG667525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397093 GeneID:667525 MGI:3647073
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996147.1

name	LOC100043197 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265683 GeneID:100043197
definition	codon_start : 1 product : similar to T cell receptor V alpha 8.5 protein_id : XP_001479589.1

name	LOC100038850 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265366 GeneID:100038850
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471632.1

name	LOC667542 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397097 GeneID:667542
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_996226.1

name	LOC100043214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265691 GeneID:100043214
definition	codon_start : 1 product : similar to T cell receptor alpha chain TCRalphaJ12A protein_id : XP_001479634.1

name	LOC100043202 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265687 GeneID:100043202
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479601.1

name	LOC667574 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265696 GeneID:667574
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996381.2

name	Gm26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51768683 GeneID:195296 MGI:2684872
definition	codon_start : 1 product : similar to Tcell receptor alpha chain protein_id : XP_111555.4

name	EG667583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397118 GeneID:667583 MGI:3704130
definition	codon_start : 1 product : similar to TRAV5D-4 protein_id : XP_996435.1

name	Gm1489 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:385047 MGI:2686335
definition	codon_start : 1 exception : rearrangement required for product

name	C920008G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:320734 MGI:2444626
definition	codon_start : 1 exception : rearrangement required for product

name	LOC667596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397120 GeneID:667596
definition	codon_start : 1 product : similar to TRAV13-3 protein_id : XP_996480.1

name	EG667604 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397122 GeneID:667604 MGI:3647760
definition	codon_start : 1 product : similar to TRAV8-2 protein_id : XP_996503.1

name	LOC547329 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265576 GeneID:547329
definition	codon_start : 1 product : similar to T-cell receptor alpha chain protein_id : XP_001478429.1

name	LOC639655 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265578 GeneID:639655
definition	codon_start : 1 product : similar to T-cell receptor alpha chain protein_id : XP_921267.3

name	LOC634322 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:634322
definition	codon_start : 1 exception : rearrangement required for product

name	LOC634322 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:634322
definition	codon_start : 1 exception : rearrangement required for product

name	EG636127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265580 GeneID:636127 MGI:3644878
definition	codon_start : 1 product : similar to TRAV7D-4 protein_id : XP_916510.2

name	OTTMUSG00000015163 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:279872 MGI:3649609
definition	codon_start : 1 exception : rearrangement required for product note : overriding stop codons transl_except : (pos:53721935..53721937,aa:OTHER) transl_except : (pos:53721968..53721970,aa:OTHER)

name	EG667626 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265584 GeneID:667626 MGI:3647936
definition	codon_start : 1 product : similar to T cell receptor alpha chain protein_id : XP_996639.2

name	LOC620297 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265586 GeneID:620297
definition	codon_start : 1 product : similar to TRAV6D-6 protein_id : XP_001478472.1

name	EG667635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397131 GeneID:667635 MGI:3644782
definition	codon_start : 1 product : similar to T cell receptor alpha chain isoform 2 protein_id : XP_996691.1

name	EG667635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265698 GeneID:667635 MGI:3644782
definition	codon_start : 1 product : similar to T cell receptor alpha chain isoform 1 protein_id : XP_001479669.1

name	LOC100043218 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265694 GeneID:100043218
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_001479643.1

name	LOC100042568 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265588 GeneID:100042568
definition	codon_start : 1 product : similar to TRAV13D-1 protein_id : XP_001478485.1

name	LOC100043204 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265689 GeneID:100043204
definition	codon_start : 1 product : similar to T-cell receptor alpha protein_id : XP_001479606.1

name	LOC100043258 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265700 GeneID:100043258
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479674.1

name	LOC100042574 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265592 GeneID:100042574
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478500.1

name	LOC100042187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042187
definition	number : 1 pseudo : _no_value

name	EG633215 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633215
definition	number : 1 pseudo : _no_value

name	LOC100042203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042203
definition	number : 3 pseudo : _no_value

name	LOC100042203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042203
definition	number : 2 pseudo : _no_value

name	LOC100042203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042203
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671357
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671357
definition	number : 2 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 1 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 2 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 3 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 4 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 5 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 6 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 1 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 2 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 3 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 4 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 5 pseudo : _no_value

name	LOC667352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667352
definition	number : 3 pseudo : _no_value

name	LOC667352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667352
definition	number : 2 pseudo : _no_value

name	LOC667352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667352
definition	number : 1 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 4 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 3 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 2 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 1 pseudo : _no_value

name	LOC100042384 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042384
definition	number : 1 pseudo : _no_value

name	LOC100042384 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042384
definition	number : 2 pseudo : _no_value

name	LOC546612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546612
definition	number : 1 pseudo : _no_value

name	LOC546612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546612
definition	number : 2 pseudo : _no_value

name	EG667547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667547
definition	number : 1 pseudo : _no_value

name	EG667547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667547
definition	number : 2 pseudo : _no_value

name	EG667547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667547
definition	number : 3 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 4 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 3 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 2 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 1 pseudo : _no_value

name	LOC100042560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042560
definition	number : 1 pseudo : _no_value

name	LOC100042560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042560
definition	number : 2 pseudo : _no_value

name	Trav5-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins standard_name : Trav5-1

name	Trav6-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:436539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins standard_name : Trav6-2

name	LOC627273 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:627273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins standard_name : LOC627273

name	Gm1489 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins standard_name : Gm1489

name	LOC634322 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:634322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs standard_name : LOC634322

name	LOC634322 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:634322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins standard_name : LOC634322

name	OTTMUSG00000015242 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:627171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein standard_name : OTTMUSG00000015242

name	EG667441 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:667441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins standard_name : EG667441

name	Gm701 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:277146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins standard_name : Gm701

name	EG328482 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:328482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins standard_name : EG328482

name	C920008G01Rik (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:320734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins standard_name : C920008G01Rik

name	OTTMUSG00000015163 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:279872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins standard_name : OTTMUSG00000015163

name	LOC633238 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265650 GeneID:633238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 19 Proteins product : similar to cyclin-dependent kinase 8 pseudo : _no_value transcript_id : XR_034121.1

name	LOC667289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265536 GeneID:667289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : predicted gene, EG666524 pseudo : _no_value transcript_id : XR_035689.1

name	LOC667348 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265661 GeneID:667348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins product : similar to Ac2-210 pseudo : _no_value transcript_id : XR_034193.1

clone name	MSMg01-383P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154C08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-275F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-267L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-457F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-054H21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116D02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-465A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-107A12
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-094J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019G09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-291K15.b	B6Ng01-291K15.g
ACC	GA088493	GA088494
length	1,210	806
definition	B6Ng01-291K15.b	B6Ng01-291K15.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcacctgcctgcctcttgcttcccaagaggtgtgcaccaccatgcc cagaaaatttttattatacttgctttgtgtgcaagcatgtatatttttga catgtgtgtctagtgcccaataaggtcaggaatggcatttcccctggaac tggagttatggagagttgtttaccaccatgtgagtgctgggaaccaaacc tatgtcctctgcaaaagcaacaagtattcttaaccactaagccatctctc cagccccttatttattttttttaataaaaaaaaaaaaaaagaattcattg tgaaaaggatttagtataggtgtagacacagtgtctgagtcaaaggggat agcagaggcacgatgatgaaagtacctggcagttggcatgcactttataa gagagagctgcctgctgtcctcactgtaagtttcaggaattataaaccat ccacagcatagccaggtttcctgtcttctggtcaccattgctttcccttt ccctgtcacaggtggacaaggcgtgagcaaactgatttctaccgagtagt atctacctttggtgtggagtatgaccctgacaacatgcagtttcactggg atcgcttccgcacttttgctcgcctggacaaaaaaacagatgaaagcctt accaagtacttccatggttttgtggccatgtgtcgacaagtgtgccgcct tcccccagctgctggtgatggtgagatggtagagtctagggtaaacgggt ctgtgttgttaacacatcaacctttggttaatttcttttctcacctatgt tggttgcagaacctccagaccctaatctgttcattgagcccatcactgaa gagagagcctcgaggactctctaccgaattgagttgcttcgacgcttacg ggaacaagttttatgccaccccttttagaagatcggctggcattgtgtca gcctccaggtcttgaattgcccaaatggtgggatcctgtccgtcatgatg gggagctcctacgaggagcagcccgcatgggggtgagcaaacagactgca catcatgcaggacccagaacttctcttttttggctgcccgtatgaatata ttgcagaaaccattcaaggcggggagcatcagctgcattccctgttcccg aatgtttcacttccatgctgaacgagcatggtacttcacggtactgctta cacatcaccc	gaattcactggccccaaagaaggacaggaaagtcaccatggaaagagaga cagaggggagggggaagagaaagagagaaaatgcgtgcagagagagaaag aaaaagggggcagagaaatcaaaaaagtctgaattatgcagggaggagcc tctggggaaagcagctcagcccttgggttggaaagttcagggttggggtc tggatgtgccaagtagggactgggggatgctgggagaacctggagaccag gtcagcttcagtaagtaaaataaggacctcaggcccttgccccagtctga aaccaacaccatttttccctatctacttgtttagatctttgggggtttct ctgcgggtacattttattgctacgcttccaagtgcactgatcttttcttt tgcagtatctagtctgcaactgtttaatgcatattttcacttggacctgt cattttcatatctagattttgattgcatcgtcctctggtttccatttctt tgctcagtttttgtacctttcctttactgagaacagctgctttcatgtgc ttctgagctaacttgaacgtgtctgttctggcttgcctcatgcttcacta acctctttatgggtcatattttcctgtctctttacatgcctaataatttg ttgggatatgagatattgtgcattgtcacctcgtaggggctagatggttt tgtttcttttttgttgttgttgtgttttctaaaaggccaaggattttttt gtagaatgagatatggtgcagtgggaggggtgtcttggcaagctcatgct gaggca
quality values	Open. Hide. 62 41 32 31 62 37 26 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 30 62 62 62 43 49 43 33 28 30 28 28 31 28 43 59 59 59 62 62 62 62 59 59 62 59 62 62 62 59 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 51 51 51 41 59 56 56 62 59 48 59 59 54 48 62 62 62 62 62 62 62 59 59 62 62 62 56 56 62 62 62 56 62 56 62 56 59 46 56 59 51 59 49 43 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 43 62 56 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 59 56 38 62 45 49 32 49 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 56 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 49 52 62 62 62 62 62 62 62 62 54 62 58 54 58 58 58 58 58 43 45 58 58 54 54 54 58 52 54 58 39 58 58 54 54 54 45 52 54 54 54 52 58 52 58 58 58 52 58 52 58 58 58 52 54 54 54 58 54 39 54 52 54 54 54 52 46 58 54 52 58 58 52 54 54 58 58 54 52 46 46 58 58 58 58 37 41 51 49 58 58 58 50 51 49 51 50 50 54 58 50 51 49 44 48 52 42 53 58 49 45 49 51 39 50 58 58 58 47 49 49 50 50 39 54 41 49 58 54 54 36 37 51 52 52 50 49 49 46 53 53 41 52 53 51 48 35 46 50 42 58 58 46 58 58 48 49 41 58 37 20 44 35 52 54 53 51 50 50 52 52 39 41 58 44 50 50 50 50 42 53 40 42 43 50 30 28 42 44 50 52 31 32 40 52 53 50 34 51 49 42 53 53 28 52 49 25 44 50 32 35 27 54 47 27 45 31 54 39 37 42 38 32 29 33 23 15 29 52 42 39 39 54 54 33 40 52 54 40 39 41 37 45 32 40 20 45 40 37 33 29 45 39 43 40 33 54 40 54 37 51 54 42 19 22 49 30 54 47 47 40 54 53 41 35 26 32 29 32 51 31 40 30 34 31 32 41 53 31 32 45 32 29 18 37 29 12 22 32 29 33 29 24 47 17 40 32 31 40 29 31 30 32 37 26 9 18 25 31 27 31 32 31 31 45 31 28 36 20 30 28 31 27 44 26 17 41 21 26 18 29 20 31 33 30 31 32 31 24 31 31 17 31 31 31 31 34 28 23 28 14 32 33 32 33 31 36 32 36 30 26 28 34 41 32 10 30 13 17 31 32 36 35 32 31 48 27 32 32 31 18 30 21 38 48 46 17 13 14 33 34 31 15 19 32 32 31 31 46 46 13 11 7 25 35 9 33 24 20 27 20 23 34 28 21 11 25 37 25 22 16 27 27 25 21 16 32 29 36 19 26 21 15 16 25 28 19 23 25 17 15 22 19 27 14 13 14 12 31 16 22 29 23 10 19 40 10 15 7 29 11 15 21 10 23 20 32 12 14 19 21 22 21 32 37 48 31 10 17 8 23 30 11 29 25 27 27 9 30 17 8 33 10 32 28 24 20 29 21 3 3 5 12 19 29 17 17 8 6 5 9 6 16 7 34 18 4 4 5 12 8 24 14 8 18 6 7 6 6 9 20 16 7 18 15 10 28 9 28 13 9 5 5 14 6 24 11 6 26 7 19 47 27 17 6 3 4 13 13 21 15 10 30 11 11 4 4 9 17 13 12 3 3 8 8 4 7 9 16 20 5 5 22 16 6 16 5 4 13 13 6 4 15 12 10 16 24 28 5 9 4 7 6 9 5 14 4 7 3 5 12 17 9 16 13 8 17 6 18 8 11 5 10 5 5 5 13 6 21 8 5 5 6 5 7 5 5 19 4 4 4 7 4 8 6 4 5 9 4 7 8 5 5 1 4 7 6 5 5 3 6 5 6 12 7 5 10 10 4 3 4 4 4 7 4 5 4 7 6 8 4 8 8 14 12	Open. Hide. 62 38 62 45 62 54 62 49 62 62 35 62 56 56 47 18 26 26 21 38 34 38 62 47 56 62 62 62 49 62 62 62 62 62 62 59 59 59 62 62 43 46 62 62 62 62 62 62 62 59 56 62 62 59 59 62 62 62 54 62 62 54 54 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 54 62 59 62 59 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 54 59 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 59 62 54 54 62 62 62 62 54 62 56 46 42 42 54 54 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 56 62 56 56 62 62 62 47 47 46 30 30 40 56 62 62 62 62 62 62 62 56 62 49 62 62 49 62 62 62 62 62 54 42 53 62 62 53 50 62 52 62 62 62 62 54 62 62 52 62 52 52 58 58 58 32 58 58 58 54 49 52 54 47 54 58 50 54 42 52 42 42 58 42 58 52 46 54 43 58 49 52 34 43 48 52 54 37 39 54 12 58 41 48 54 54 54 52 47 39 58 54 21 58 58 46 54 38 31 43 54 28 58 58 58 58 49 34 25 45 45 22 51 54 38 42 58 35 58 37 58 58 23 50 33 41 58 58 49 26 30 27 26 23 53 33 58 36 30 58 58 58 58 58 32 50 40 52 11 58 46 34 46 50 30 41 28 50 33 51 51 50 48 37 46 42 24 36 30 38 41 17 58 58 40 41 51 32 31 25 12 10 12 18 18 20 58 19 30 17 28 32 38 34 52 38 50 21 17 7 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_52824787_52825990
seq2: B6Ng01-291K15.b_50_1259 (reverse)

seq1  GGGTGATGGTGAAGCAGTA-CGTGAGGTACACTGCTGGTGCAGCAGTGGA  49
      ||||||||   |||||||| ||||| ||||  |||| || |||||  | |
seq2  GGGTGATGTGTAAGCAGTACCGTGAAGTACCATGCTCGTTCAGCATGGAA  50

seq1  GTGGAGCA-TCGCG-ACAGGG-ATGCAGCTGATGCT-CCCGCCT--GATG  93
      ||| | || ||| | |||||| |||||||||||||| |||||||   |||
seq2  GTGAAACATTCGGGAACAGGGAATGCAGCTGATGCTCCCCGCCTTGAATG  100

seq1  G-TTCTGCATATA-ATTCATACGGGCAGCCAGAAAAGAGAAG-TCTGGGT  140
      | ||||||| ||| ||||||||||||||||| |||||||||| |||||||
seq2  GTTTCTGCA-ATATATTCATACGGGCAGCCAAAAAAGAGAAGTTCTGGGT  149

seq1  CCTGCATGATGTTGCAGTCTGTTTGGCTCACCCCATGGCGGGCTGCTCCT  190
      ||||||||||| |||||||||||| |||||||||   |||||||||||||
seq2  CCTGCATGATG-TGCAGTCTGTTT-GCTCACCCCCATGCGGGCTGCTCCT  197

seq1  CGTAGGAGCTCCCCATCATGACGGACAGGTTCCCACCATTTGGGCAATTC  240
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  CGTAGGAGCTCCCCATCATGACGGACAGGATCCCACCATTTGGGCAATTC  247

seq1  AAGACCTGGAGGCTGACACAATGCCAGCCGATCTTCTAAAAGGGGGTGGC  290
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  AAGACCTGGAGGCTGACACAATGCCAGCCGATCTTCTAAAA-GGGGTGGC  296

seq1  ATAAAACTTGTTCCCGTAAGCGTCGAAGCAACTCAATTCGGTAGAGAGTC  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAACTTGTTCCCGTAAGCGTCGAAGCAACTCAATTCGGTAGAGAGTC  346

seq1  CTCGAGGCTCTCTCTTCAGTGATGGGCTCAATGAACAGATTAGGGTCTGG  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGAGGCTCTCTCTTCAGTGATGGGCTCAATGAACAGATTAGGGTCTGG  396

seq1  AGGTTCTGCAACCAACATAGGTGAGAAAAGAAATTAACCAAAGGTTGATG  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTCTGCAACCAACATAGGTGAGAAAAGAAATTAACCAAAGGTTGATG  446

seq1  TGTTAACAACACAGACCCGTTTACCCTAGACTCTACCATCTCACCATCAC  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAACAACACAGACCCGTTTACCCTAGACTCTACCATCTCACCATCAC  496

seq1  CAGCAGCTGGGGGAAGGCGGCACACTTGTCGACACATGGCCACAAAACCA  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGCTGGGGGAAGGCGGCACACTTGTCGACACATGGCCACAAAACCA  546

seq1  TGGAAGTACTTGGTAAGGCTTTCATCTGTTTTTTTGTCCAGGCGAGCAAA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAGTACTTGGTAAGGCTTTCATCTGTTTTTTTGTCCAGGCGAGCAAA  596

seq1  AGTGCGGAAGCGATCCCAGTGAAACTGCATGTTGTCAGGGTCATACTCCA  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCGGAAGCGATCCCAGTGAAACTGCATGTTGTCAGGGTCATACTCCA  646

seq1  CACCAAAGGTAGATACTACTCGGTAGAAATCAGTTTGCTCACGCCTTGTC  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAAAGGTAGATACTACTCGGTAGAAATCAGTTTGCTCACGCCTTGTC  696

seq1  CACCTGTGACAGGGAAAGGGAAAGCAATGGTGACCAGAAGACAGGAAACC  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTGTGACAGGGAAAGGGAAAGCAATGGTGACCAGAAGACAGGAAACC  746

seq1  TGGCTATGCTGTGGATGGTTTATAATTCCTGAAACTTACAGTGAGGACAG  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTATGCTGTGGATGGTTTATAATTCCTGAAACTTACAGTGAGGACAG  796

seq1  CAGGCAGCTCTCTCTTATAAAGTGCATGCCAACTGCCAGGTACTTTCATC  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCAGCTCTCTCTTATAAAGTGCATGCCAACTGCCAGGTACTTTCATC  846

seq1  ATCGTGCCTCTGCTATCCCCTTTGACTCAGACACTGTGTCTACACCTATA  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGTGCCTCTGCTATCCCCTTTGACTCAGACACTGTGTCTACACCTATA  896

seq1  CTAAATCCTTTTCACAATGAATTCTTTTTTTTTTTTTTTATTAAAAAAAA  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATCCTTTTCACAATGAATTCTTTTTTTTTTTTTTTATTAAAAAAAA  946

seq1  TAAATAAGGGGCTGGAGAGATGGCTTAGTGGTTAAGAATACTTGTTGCTT  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATAAGGGGCTGGAGAGATGGCTTAGTGGTTAAGAATACTTGTTGCTT  996

seq1  TTGCAGAGGACATAGGTTTGGTTCCCAGCACTCACATGGTGGTAAACAAC  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAGAGGACATAGGTTTGGTTCCCAGCACTCACATGGTGGTAAACAAC  1046

seq1  TCTCCATAACTCCAGTTCCAGGGGAAATGCCATTCCTGACCTTATTGGGC  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCATAACTCCAGTTCCAGGGGAAATGCCATTCCTGACCTTATTGGGC  1096

seq1  ACTAGACACACATGTCAAAAATATACATGCTTGCACACAAAGCAAGTATA  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAGACACACATGTCAAAAATATACATGCTTGCACACAAAGCAAGTATA  1146

seq1  ATAAAAATTTTCTGGGCATGGTGGTGCACACCTCTTGGGAAGCAAGAGGC  1190
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAATTTTCTGGGCATGGTGGTGCACACCTCTTGGGAAGCAAGAGGC  1196

seq1  AGGCAGGTGAATTC  1204
      ||||||||||||||
seq2  AGGCAGGTGAATTC  1210

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information