MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-292I01
Chromosome	14 (Build37)
Map Location	3,516,758 - 3,517,884
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100040452, LOC100040657, LOC100040671, LOC100040682, LOC100040697, LOC544990, D830030K20Rik, LOC236565, LOC100040740, LOC100040755, LOC100040767, LOC100040779, LOC100038846
Downstream gene	EG666890, LOC100040544, LOC100040797, LOC100040555, LOC100040565, LOC100040578, LOC100040807, LOC100040859, LOC100040870, LOC100040880, LOC100040615, LOC100040923, LOC100040621, LOC100040641, LOC100040652, LOC100040935, LOC100040852, LOC100040674, LOC100040906, LOC100040688, LOC100040701, LOC100040897, LOC100041012, LOC100041019, ENSMUSG00000068790, LOC100041054, LOC666442, LOC100040793, LOC100041076, LOC100040801, LOC666336, LOC100041100, LOC100040808, LOC100041119, 2610042L04Rik, LOC100041139
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040657 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 8 Proteins

name	LOC100040671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein pseudo : _no_value

name	LOC100040682 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 165 ESTs, 7 Proteins

name	LOC100040697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 7 Proteins pseudo : _no_value

name	LOC544990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 29 ESTs, 9 Proteins

name	D830030K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320333 MGI:2443830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC236565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100040740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	LOC100040755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein pseudo : _no_value

name	LOC100040779 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein pseudo : _no_value

name	LOC100038846 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666890 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666890 MGI:3646129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 1 Protein pseudo : _no_value

name	LOC100040544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040797 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040797
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 10 Proteins

name	LOC100040555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100040578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040807 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein pseudo : _no_value

name	LOC100040870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 23 ESTs, 10 Proteins

name	LOC100040880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 1 Protein pseudo : _no_value

name	LOC100040615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 10 Proteins

name	LOC100040621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040935 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040852 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein pseudo : _no_value

name	LOC100040674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040906 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins pseudo : _no_value

name	LOC100040688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100040897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 9 Proteins

name	LOC100041012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 1 Protein pseudo : _no_value

name	LOC100041019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 16 Proteins

name	ENSMUSG00000068790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545007 MGI:3704420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041054 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 8 ESTs, 11 Proteins

name	LOC666442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein pseudo : _no_value

name	LOC100040793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100041076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 25 ESTs, 9 Proteins

name	LOC100040801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC666336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 143 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 15 Proteins pseudo : _no_value

name	LOC100040808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 25 ESTs, 9 Proteins

name	2610042L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:554327 MGI:1914305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 7 Proteins

name	LOC100041139 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 7 Proteins

name	LOC100040452 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264826 GeneID:100040452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001474699.1

name	LOC100040657 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264828 GeneID:100040657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 8 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475283.1

name	LOC100040682 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264831 GeneID:100040682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 165 ESTs, 7 Proteins product : similar to sid478p transcript_id : XM_001475316.1

name	LOC544990 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264836 GeneID:544990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001475376.1

name	LOC544990 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396534 GeneID:544990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 27 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_619179.3

name	LOC544990 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264838 GeneID:544990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001475404.1

name	D830030K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801589 GeneID:320333 MGI:2443830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D830030K20 gene transcript_id : NM_177135.3

name	LOC100040740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264840 GeneID:100040740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001475419.1

name	LOC100038846 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264822 GeneID:100038846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038846 transcript_id : XM_001471755.1

name	LOC100040797 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264848 GeneID:100040797
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 10 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475600.1

name	LOC100040870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264857 GeneID:100040870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001475695.1

name	LOC100040870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264855 GeneID:100040870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 21 ESTs, 9 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001475669.1

name	LOC100040870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264859 GeneID:100040870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001475731.1

name	LOC100040923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264869 GeneID:100040923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 10 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475847.1

name	LOC100040701 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264834 GeneID:100040701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100040701 transcript_id : XM_001475101.1

name	LOC100040897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264864 GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001475800.1

name	LOC100040897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264862 GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 8 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001475780.1

name	LOC100040897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264866 GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001475818.1

name	LOC100041019 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264877 GeneID:100041019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 16 Proteins product : hypothetical protein LOC100041019 transcript_id : XM_001475922.1

name	ENSMUSG00000068790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480141 GeneID:545007 MGI:3704420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, ENSMUSG00000068790 transcript_id : NM_001029930.1

name	LOC100041054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264882 GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001475992.1

name	LOC100041054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264880 GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 10 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001475976.1

name	LOC100041054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264884 GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001476009.1

name	LOC100040793 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264846 GeneID:100040793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to diacylglycerol kinase, eta transcript_id : XM_001475278.1

name	LOC100041076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264888 GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476049.1

name	LOC100041076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264886 GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476025.1

name	LOC100041076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264890 GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001476064.1

name	LOC100040801 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264850 GeneID:100040801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100040801 transcript_id : XM_001475295.1

name	LOC100041119 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264896 GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001476132.1

name	LOC100041119 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264894 GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 8 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001476114.1

name	LOC100041119 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264898 GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001476147.1

name	LOC100041139 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264903 GeneID:100041139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001476172.1

name	LOC100040452 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264827 GeneID:100040452
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001474749.1

name	LOC100040657 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264829 GeneID:100040657
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475333.1

name	LOC100040682 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264832 GeneID:100040682
definition	codon_start : 1 product : similar to sid478p protein_id : XP_001475366.1

name	LOC544990 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264839 GeneID:544990
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001475454.1

name	LOC544990 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264837 GeneID:544990
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001475426.1

name	LOC544990 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63660096 GeneID:544990
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_619179.1

name	D830030K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080205 GeneID:320333 MGI:2443830
definition	codon_start : 1 product : hypothetical protein LOC320333 protein_id : NP_796109.1

name	LOC100040740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264841 GeneID:100040740
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475469.1

name	LOC100038846 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264823 GeneID:100038846
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471805.1

name	LOC100040797 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264849 GeneID:100040797
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475650.1

name	LOC100040870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264860 GeneID:100040870
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001475781.1

name	LOC100040870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264858 GeneID:100040870
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001475745.1

name	LOC100040870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264856 GeneID:100040870
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001475719.1

name	LOC100040923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264870 GeneID:100040923
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475897.1

name	LOC100040701 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264835 GeneID:100040701
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475151.1

name	LOC100040897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264867 GeneID:100040897
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001475868.1

name	LOC100040897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264865 GeneID:100040897
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001475850.1

name	LOC100040897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264863 GeneID:100040897
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001475830.1

name	LOC100041019 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264878 GeneID:100041019
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475972.1

name	ENSMUSG00000068790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480142 GeneID:545007 MGI:3704420
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC545007 protein_id : NP_001025101.1

name	LOC100041054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264885 GeneID:100041054
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476059.1

name	LOC100041054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264883 GeneID:100041054
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476042.1

name	LOC100041054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264881 GeneID:100041054
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476026.1

name	LOC100040793 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264847 GeneID:100040793
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475328.1

name	LOC100041076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264891 GeneID:100041076
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001476114.1

name	LOC100041076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264889 GeneID:100041076
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476099.1

name	LOC100041076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264887 GeneID:100041076
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476075.1

name	LOC100040801 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264851 GeneID:100040801
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475345.1

name	LOC100041119 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264899 GeneID:100041119
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476197.1

name	LOC100041119 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264897 GeneID:100041119
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476182.1

name	LOC100041119 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264895 GeneID:100041119
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476164.1

name	LOC100041139 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264904 GeneID:100041139
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001476222.1

name	LOC236565 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236565
definition	number : 2 pseudo : _no_value

name	LOC236565 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236565
definition	number : 1 pseudo : _no_value

name	LOC100040544 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040544
definition	number : 4 pseudo : _no_value

name	LOC100040544 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040544
definition	number : 3 pseudo : _no_value

name	LOC100040544 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040544
definition	number : 2 pseudo : _no_value

name	LOC100040544 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040544
definition	number : 1 pseudo : _no_value

name	LOC100040555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040555
definition	number : 1 pseudo : _no_value

name	LOC100040565 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040565
definition	number : 1 pseudo : _no_value

name	LOC100040578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040578
definition	number : 5 pseudo : _no_value

name	LOC100040578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040578
definition	number : 4 pseudo : _no_value

name	LOC100040578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040578
definition	number : 3 pseudo : _no_value

name	LOC100040578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040578
definition	number : 2 pseudo : _no_value

name	LOC100040578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040578
definition	number : 1 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 4 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 3 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 2 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 1 pseudo : _no_value

name	LOC100040621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040621
definition	number : 1 pseudo : _no_value

name	LOC100040641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040641
definition	number : 1 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 5 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 4 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 3 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 2 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 1 pseudo : _no_value

name	LOC100040674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040674
definition	number : 3 pseudo : _no_value

name	LOC100040674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040674
definition	number : 2 pseudo : _no_value

name	LOC100040674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040674
definition	number : 1 pseudo : _no_value

name	LOC100040688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040688
definition	number : 2 pseudo : _no_value

name	LOC100040688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040688
definition	number : 1 pseudo : _no_value

name	LOC100040808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040808
definition	number : 2 pseudo : _no_value

name	LOC100040808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040808
definition	number : 1 pseudo : _no_value

name	LOC100040671 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264830 GeneID:100040671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032179.1

name	LOC100040697 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264833 GeneID:100040697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 100 ESTs, 7 Proteins product : hypothetical protein LOC100040697 pseudo : _no_value transcript_id : XR_032195.1

name	LOC100040755 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264842 GeneID:100040755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 pseudo : _no_value transcript_id : XR_032249.1

name	LOC100040767 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264843 GeneID:100040767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein product : hypothetical protein LOC100040767 pseudo : _no_value transcript_id : XR_032259.1

name	LOC100040779 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264844 GeneID:100040779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein product : hypothetical protein LOC100040779 pseudo : _no_value transcript_id : XR_032271.1

name	EG666890 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264845 GeneID:666890 MGI:3646129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 1 Protein product : predicted gene, EG666890 pseudo : _no_value transcript_id : XR_032314.1

name	LOC100040807 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264852 GeneID:100040807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 pseudo : _no_value transcript_id : XR_032339.1

name	LOC100040859 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264854 GeneID:100040859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein product : hypothetical protein LOC100040859 pseudo : _no_value transcript_id : XR_032363.1

name	LOC100040880 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264861 GeneID:100040880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032411.1

name	LOC100040935 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264873 GeneID:100040935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 pseudo : _no_value transcript_id : XR_032473.1

name	LOC100040852 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264853 GeneID:100040852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein product : hypothetical protein LOC100040852 pseudo : _no_value transcript_id : XR_032351.1

name	LOC100040906 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264868 GeneID:100040906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032452.1

name	LOC100041012 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264876 GeneID:100041012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 1 Protein product : hypothetical protein LOC100041012 pseudo : _no_value transcript_id : XR_032479.1

name	LOC666442 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264879 GeneID:666442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein product : hypothetical LOC666442 pseudo : _no_value transcript_id : XR_032500.1

name	LOC666336 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264892 GeneID:666336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 143 ESTs, 6 Proteins product : hypothetical LOC666336 pseudo : _no_value transcript_id : XR_032547.1

name	LOC100041100 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264893 GeneID:100041100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 15 Proteins product : hypothetical protein LOC100041100 pseudo : _no_value transcript_id : XR_032556.1

name	2610042L04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264900 GeneID:554327 MGI:1914305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 7 Proteins product : RIKEN cDNA 2610042L04 gene transcript_id : XR_032590.1

clone name	B6Ng01-341P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-292I01.b	B6Ng01-292I01.g
ACC	GA089125	GA089126
length	1,222	1,122
definition	B6Ng01-292I01.b	B6Ng01-292I01.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcacacaaggagaggtttgtgtcacaggcgccggcgggagccttct tggctccgggactccgtggagggcaggctgcacgggagaccgtgtggaat acagaggccagccgtttctgggacgggcgaaagtcgcagagcttctgggg cggtgccatcttcgtatccagacaaccggccaccttcctggcgagagcca cagagcttctgaggcggcaacatcttcgactccagacaaccggccacctt cctggccaaagcagcacagcttctgggaaagatcctgttttgggccttca ccctcagccaggaggaggtccaaacaccagataactgtacaccttccccg aaagaggagagcttgcctgcagagactgctctgaccactgaaactcagag gagagagcttgtctcccacgcctgctgattgagggtaacaaaatcaacag aggaacaatctcttaacaaagacaactataacaactaactccagagattg ccagatggcgaaaggtaaacgtaagaatcctactaacagaaaccaggacc actcaccatcatcagaacccagaacgcccacttcgcccagtccaggacac cctaacacacctgaaaaggtagacctggatttaaaaggatatctcatgat gatggtagaggacataaagaaggaattcaataactcacttaaagagatac agggaaacactgctaaagagttacaagtccttaaagaaaaataggaaaac actgctaaagagttacaagtccttaaagaaaaacaggaaaacacaaccaa acaggtagaagtccttatagaaaaacaggaaaacacatacaaacaggtga tggaaatgaacaaaaccatactagacctaaaaagggaagtagacacaata aagaaaacccaaagtgaggcaacactgggagatagaaaccctaagaaaga aatctgggaaccatagatgctcagcatcagcaacagaatacaagagatgg gaagaagagaatctcaaggtgcagaagactccatagagaacatcggccac aacaattaaagaaaatggaaaatgcaaaaaagatccttaactaaaaacat ccaggaaatccaggacacacattggagaaggatcatccttacgggaataa atagggattggatggaatgagacttcactcgaagacagccaaaacatctt tctacaaccaaatattattttg	gaattcacactgctgtgcacaaacccacacacagacacagacacccaagt gaaaaaagtcaaaaaatgtaacaacatgcttgaaaaacagcagttcactt ctggtctgggatagctcagttggcctagaggaatgaagggctgggtttga gtgagccccagtgttcatctgtgatcccagtgctgaggtaaaggcagcat ggtcagaatgatggagatctgtgagttatcatctggctgctaactaaaag caagggaggaacttgtagactgctcactcaccccacttaaccctcattca aagtaaatgaaggacaggctacttaggcagcaggtaagaggccactgaac aaagcatagtcacaaacaaagaggacccaacattccaaggcccctttaaa ggagagattcaggaatgcaaatctagtcagtcaagtcacagaaagtgagg gctggaaaccatccagtggcttagctctctccacaatccttagtgacctt tatatgtgtagctccagtggaatattagccttggaagttagtatgacttg ggagcatgctggatcaagtacgtgttttgaattttcggtttcaaaacgtg tgaatgcatctgtctaccagactaagggccaggagatgcaggagtctgaa gtccatgagagaggaaatgatccatgcaaatgcagtcactcctctgtttg caactagatggaaactgtctccacagctagtaaagatgatttcagaaaag atgattgaaaaacttgctagttgcaattttcattttctttttcccagaga gcagcaggagagacagttgacatttgagctgtctctgaactgcccctgtc cctaatttgagttgagagctcacagggaaccacagacctgctccttagct ggttttcttttcacaaaatctttcagccatagaaaatgaacaaaagcagg gctccccagccagcccagccagacatcccagctgccagaatagtgcttgg gagcagctcaggggcgcaaagcacacccttgctctgttgagcaggtactg ttcctgggccatgctcagctcagctcaggaggccatcacctggagcttac aggcaacccgagcaaggaatgc
quality values	Open. Hide. 58 36 32 34 58 28 20 48 38 54 45 54 62 54 47 54 54 62 47 39 62 62 49 49 49 62 47 42 62 47 62 62 50 36 56 56 29 37 38 56 62 49 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 59 59 59 62 54 59 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 59 59 59 59 62 62 59 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 49 42 62 62 62 45 41 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 54 58 58 58 45 58 58 58 58 58 58 58 49 58 58 54 58 58 58 58 44 58 54 54 58 54 41 45 52 58 58 58 54 54 43 52 58 54 58 58 58 54 58 58 54 54 58 58 58 54 58 58 54 54 54 58 43 47 48 58 58 49 51 54 58 54 48 51 47 48 43 44 48 58 46 49 51 51 58 58 54 50 48 49 52 51 52 58 58 58 58 58 58 58 43 54 58 40 51 51 39 37 58 58 58 58 37 39 58 54 35 58 58 58 48 58 48 35 35 41 53 58 53 50 58 58 46 43 58 54 52 58 54 52 54 54 58 51 58 39 24 42 46 42 58 58 51 58 51 22 58 43 44 50 54 50 52 58 51 37 50 49 54 50 51 50 58 58 37 54 51 54 51 42 35 37 40 50 44 49 49 26 33 54 40 40 44 51 51 54 51 46 27 54 44 44 51 41 47 49 37 49 32 41 53 53 42 51 52 53 32 54 45 45 47 54 54 54 38 52 40 30 46 44 49 54 37 52 32 39 51 45 45 34 20 54 47 33 33 25 33 35 37 33 46 51 37 32 28 34 39 36 31 49 41 32 40 49 47 40 27 32 32 35 52 46 32 40 25 25 20 32 13 52 47 32 27 40 36 40 24 21 49 27 34 38 46 40 17 33 33 34 36 35 23 40 31 38 45 47 41 51 31 31 32 29 51 30 41 41 27 37 31 31 31 38 28 45 28 51 31 45 26 26 46 27 31 28 24 32 32 41 47 31 34 36 31 31 30 15 46 41 41 31 31 23 42 32 31 30 26 42 42 25 27 29 28 46 46 46 31 31 47 36 32 28 25 31 27 31 30 21 12 32 10 36 39 21 46 38 31 33 44 29 28 23 29 8 9 31 19 28 31 30 29 14 34 18 19 24 24 11 21 21 11 44 14 31 20 32 31 32 28 30 31 22 26 28 24 28 10 9 16 7 41 31 18 27 48 25 25 27 34 19 48 22 20 18 10 24 24 38 22 32 27 26 27 9 7 14 14 16 20 6 24 17 19 15 29 9 11 29 24 27 37 32 21 17 21 11 29 27 21 6 17 24 21 39 14 26 18 15 20 7 4 4 13 21 26 19 21 27 10 7 8 26 13 16 32 24 16 24 26 28 14 16 7 20 8 26 13 24 13 15 28 24 27 27 12 9 28 9 15 6 9 9 8 25 6 14 13 7 13 12 13 7 24 10 7 9 32 21 21 18 15 18 8 47 40 24 13 28 7 7 31 34 34 27 8 11 11 13 10 14 8 9 23 15 26 10 7 20 26 27 10 23 10 25 8 16 12 11 17 9 25 12 6 6 16 10 6 6 4 4 5 5 5 3 4 3 4 6 7 13 7 15 24 5 8 21 6 3 5 2 5 13 4 15 9 22 5 26 4 8 7 9 8 20 8 15 5 11 15 7 7 5 7 6 3 2 3 7 4 5 3 1 2 3 4 2 1 5 3 5 9 4 4 2 3 3 9 10 3 3 3 5 4 13 18 17 23 7 5 3 8 4 3 11 14 6 4 4 4 6 7 4 4 24 28 13 6 4 13 4 7 6 21 8 8 7	Open. Hide. 62 47 37 39 62 47 35 62 56 54 62 49 56 62 44 35 35 35 56 59 59 62 62 62 62 59 62 62 62 62 62 62 59 54 54 62 62 62 62 59 54 62 62 62 54 59 62 62 59 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 33 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 51 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 52 58 54 58 58 58 58 58 58 58 54 58 58 45 34 49 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 50 58 58 58 58 58 58 54 54 42 58 58 54 58 58 58 58 58 58 58 58 52 58 47 52 52 58 54 54 58 58 49 58 58 58 58 58 58 46 58 50 51 58 51 58 58 58 51 46 51 51 51 51 58 51 51 58 58 58 58 58 58 58 58 51 50 50 58 58 58 51 58 58 43 58 58 49 51 58 58 58 47 58 51 58 49 58 58 53 39 58 50 50 51 53 58 58 53 52 58 32 44 44 41 53 58 48 58 47 39 26 58 44 40 41 39 52 58 44 31 39 32 51 51 46 29 58 51 25 51 53 53 54 51 58 39 53 50 43 50 53 46 58 32 58 40 53 30 52 53 54 41 37 53 37 33 50 49 37 52 54 49 40 54 52 53 51 39 52 45 52 53 42 53 52 40 49 53 53 41 52 31 54 50 41 37 37 39 42 53 39 37 34 37 39 35 37 54 30 36 45 54 45 53 52 41 49 32 53 37 32 53 47 45 40 41 37 54 45 37 39 34 36 42 31 51 44 41 36 33 51 49 49 51 32 32 32 45 41 29 38 47 53 53 52 51 32 32 39 47 52 31 36 32 28 33 35 33 32 18 27 31 51 51 45 31 30 40 46 46 32 31 43 47 51 51 31 32 51 38 31 36 51 30 42 30 32 41 28 42 31 11 46 31 19 46 29 31 23 30 31 31 42 32 31 16 26 33 48 31 30 46 28 42 31 43 31 43 31 27 31 31 33 32 27 30 37 31 46 32 23 25 31 30 31 46 25 27 21 33 33 48 33 20 39 27 33 33 32 42 25 38 29 27 31 31 29 31 24 19 46 14 8 14 19 24 22 37 24 35 38 29 32 33 31 37 33 22 24 22 21 30 20 22 30 31 31 27 44 44 26 30 31 48 47 27 32 27 27 31 44 43 21 28 34 34 48 32 27 32 11 25 17 21 32 21 20 31 47 47 19 20 32 22 24 28 26 48 48 37 21 34 14 17 32 22 27 37 22 36 31 19 22 24 16 25 23 19 26 30 15 20 18 15 18 21 20 25 14 16 32 24 33 22 20 10 28 20 11 15 11 20 6 11 24 9 5 19 3 10 27 27 27 28 34 19 19 8 21 14 8 22 21 16 6 9 31 30 5 5 8 16 18 27 28 19 20 15 4 4 3 25 11 16 10 13 12 16 16 14 8 5 22 7 13 5 16 6 7 11 11 22 20 16 23 9 8 13 14 15 13 4 19 3 4 3 3 3 5 6 18 5 12 5 5 6 10 5 15 17 13 11 9 4 11 9 25 5 5 22 4 9 5 7 14 9 12 7 11 8 16 4 9 8 20 10 15 23 10 5 7 7 11 17 4 3 2 2 2 5 6 2 2 2 4 3 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_3516758_3517884
seq2: B6Ng01-292I01.g_67_1188

seq1  GAATTCACACTGCTGTGCACAAACCCACACACAGACACAGACACCCAAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACACTGCTGTGCACAAACCCACACACAGACACAGACACCCAAGT  50

seq1  GAAAAAAGTCAAAAAATGTAACAACATGCTTGAAAAACAGCAGTTCACTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAAAGTCAAAAAATGTAACAACATGCTTGAAAAACAGCAGTTCACTT  100

seq1  CTGGTCTGGGATAGCTCAGTTGGCCTAGAGGAATGAAGGGCTGGGTTTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTCTGGGATAGCTCAGTTGGCCTAGAGGAATGAAGGGCTGGGTTTGA  150

seq1  GTGAGCCCCAGTGTTCATCTGTGATCCCAGTGCTGAGGTAAAGGCAGCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGCCCCAGTGTTCATCTGTGATCCCAGTGCTGAGGTAAAGGCAGCAT  200

seq1  GGTCAGAATGATGGAGATCTGTGAGTTATCATCTGGCTGCTAACTAAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCAGAATGATGGAGATCTGTGAGTTATCATCTGGCTGCTAACTAAAAG  250

seq1  CAAGGGAGGAACTTGTAGACTGCTCACTCACCCCACTTAACCCTCATTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGGAGGAACTTGTAGACTGCTCACTCACCCCACTTAACCCTCATTCA  300

seq1  AAGTAAATGAAGGACAGGCTACTTAGGCAGCAGGTAAGAGGCCACTGAAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAAATGAAGGACAGGCTACTTAGGCAGCAGGTAAGAGGCCACTGAAC  350

seq1  AAAGCATAGTCACAAACAAAGAGGACCCAACATTCCAAGGCCCCTTTAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCATAGTCACAAACAAAGAGGACCCAACATTCCAAGGCCCCTTTAAA  400

seq1  GGAGAGATTCAGGAATGCAAATCTAGTCAGTCAAGTCACAGAAAGTGAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGATTCAGGAATGCAAATCTAGTCAGTCAAGTCACAGAAAGTGAGG  450

seq1  GCTGGAAACCATCCAGTGGCTTAGCTCTCTCCACAATCCTTAGTGACCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGAAACCATCCAGTGGCTTAGCTCTCTCCACAATCCTTAGTGACCTT  500

seq1  TATATGTGTAGCTCCAGTGGAATATTAGCCTTGGAAGTTAGTATGACTTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATGTGTAGCTCCAGTGGAATATTAGCCTTGGAAGTTAGTATGACTTG  550

seq1  GGAGCATGCTGGATCAAGTACGTGTTTTGAATTTTCGGTTTCAAAACGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCATGCTGGATCAAGTACGTGTTTTGAATTTTCGGTTTCAAAACGTG  600

seq1  TGAATGCATCTGTCTACCAGACTAAGGGCCAGGAGATGCAGGAGTCTGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATGCATCTGTCTACCAGACTAAGGGCCAGGAGATGCAGGAGTCTGAA  650

seq1  GTCCATGAGAGAGGAAATGATCCATGCAAATGCAGTCACTCCTCTGTTTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCATGAGAGAGGAAATGATCCATGCAAATGCAGTCACTCCTCTGTTTG  700

seq1  CAACTAGATGGAAACTGTCTCCACAGCTAGTAAAGATGATTTCAGAAAAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTAGATGGAAACTGTCTCCACAGCTAGTAAAGATGATTTCAGAAAAG  750

seq1  ATGATTGAAAAACTTGCTAGTTGCAATTTTCATTTTCTTTTTCCCAGAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATTGAAAAACTTGCTAGTTGCAATTTTCATTTTCTTTTTCCCAGAGA  800

seq1  GCAGCAGGAGAGACAGTTGACATTTGAGCTGTCTCTGAACTGCCCCTGTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAGGAGAGACAGTTGACATTTGAGCTGTCTCTGAACTGCCCCTGTC  850

seq1  CCTAATTTGAGTTGAGAGCTCACAGGGAACCACAGACCTGCTCCTTAGCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAATTTGAGTTGAGAGCTCACAGGGAACCACAGACCTGCTCCTTAGCT  900

seq1  GGTTTTCTTTTCACAAAATCTTTCAGCCATAGAAAATGAACAAAAGCAGG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTTCTTTTCACAAAATCTTTCAGCCATAGAAAATGAACAAAAGCAGG  950

seq1  GCTCCCCAGCCAGCCCAGCCAGACATCCCAGCTGCCAGAATAGGTGCTTG  1000
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GCTCCCCAGCCAGCCCAGCCAGACATCCCAGCTGCCAGAATA-GTGCTTG  999

seq1  GGAGCAGCTCAGGGGCGCAAAGCACAACCTTGCTCTGTTGAAGCCAGGTA  1050
      |||||||||||||||||||||||||| ||||||||||||||   ||||||
seq2  GGAGCAGCTCAGGGGCGCAAAGCACACCCTTGCTCTGTTGA--GCAGGTA  1047

seq1  CTG-TCCTGGGCAATTGGCTCCAGGCTCAGCTCAGGAGGCAACCACCTGG  1099
      ||| |||||||| ||  ||||   |||||||||||||||| | |||||||
seq2  CTGTTCCTGGGCCAT--GCTC--AGCTCAGCTCAGGAGGCCATCACCTGG  1093

seq1  AGC-TACAGGC-ACCCGAGGCAAGGAATGC  1127
      ||| ||||||| |||||| |||||||||||
seq2  AGCTTACAGGCAACCCGA-GCAAGGAATGC  1122

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information