MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-186J20
Chromosome	14 (Build37)
Map Location	26,519,470 - 26,519,691
singlet/doublet	singlet
Overlap gene	Ppif
Upstream gene	LOC669315, LOC100039411, Zmiz1, I920194n01, LOC100039007, 4931406H21Rik
Downstream gene	2310047A01Rik, Anxa11, Plac9, D14Ertd449e, Cphx, 1110051B16Rik, LOC100039468, LOC100039484, LOC100039175, LOC100039192, LOC100039213, LOC100039227, LOC100039503, LOC100039246, LOC100039257, LOC100039280, LOC100039293, LOC100039527, LOC100039538, 4933413J09Rik, Slmap, LOC100039353, LOC665279, A630054L15Rik, Arf4, E430028B21Rik, 4921531P07Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC669315 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100039411 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Zmiz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328365 MGI:3040693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	I920194n01 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100039007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4931406H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77592 MGI:1924842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105675 MGI:2145814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71918 MGI:1919168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 134 ESTs, 2 Proteins

name	Anxa11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11744 MGI:108481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plac9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211623 MGI:2663998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D14Ertd449e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66039 MGI:1196450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cphx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105594 MGI:2145733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110051B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278672 MGI:1916048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100039484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins

name	LOC100039175 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins

name	LOC100039192 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 204 ESTs, 5 Proteins

name	LOC100039213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins

name	LOC100039227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 24 ESTs, 1 Protein

name	LOC100039503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 4 Proteins

name	LOC100039246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins

name	LOC100039257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 197 ESTs, 5 Proteins

name	LOC100039280 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins

name	LOC100039293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 1 Protein

name	LOC100039527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC100039538 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4933413J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71106 MGI:1918356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Slmap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83997 MGI:1933549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039353 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC665279 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 7 Proteins pseudo : _no_value

name	A630054L15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211922 MGI:2442980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11843 MGI:99433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E430028B21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211948 MGI:2443226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921531P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207778 MGI:2685130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC669315 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265351 GeneID:669315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to C33G8.2 transcript_id : XM_001472822.1

name	Zmiz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41053863 GeneID:328365 MGI:3040693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MIZ-type containing 1 transcript_id : NM_183208.2

name	I920194n01 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265325 GeneID:328364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : RIKEN cDNA I920194N01gene transcript_id : XM_001472051.1

name	LOC100039007 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265323 GeneID:100039007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039007 transcript_id : XM_001472026.1

name	4931406H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350685 GeneID:77592 MGI:1924842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931406H21 gene transcript_id : NM_175264.3

name	Ppif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527309 GeneID:105675 MGI:2145814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase F (cyclophilin F) transcript_id : NM_134084.1

name	2310047A01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265327 GeneID:71918 MGI:1919168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 134 ESTs, 2 Proteins product : RIKEN cDNA 2310047A01 gene transcript_id : XM_975187.2

name	Anxa11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304884 GeneID:11744 MGI:108481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A11 transcript_id : NM_013469.1

name	Plac9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402208 GeneID:211623 MGI:2663998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placenta specific 9 transcript_id : NM_207229.1

name	D14Ertd449e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313631 GeneID:66039 MGI:1196450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 14, ERATO Doi 449, expressed transcript_id : NM_025311.1

name	Cphx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802126 GeneID:105594 MGI:2145733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoplasmic polyadenylated homeobox transcript_id : NM_175342.3

name	1110051B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34419644 GeneID:278672 MGI:1916048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110051B16 gene transcript_id : NM_183389.1

name	LOC100039468 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265353 GeneID:100039468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : similar to Ubtf protein transcript_id : XM_001472941.1

name	LOC100039484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265355 GeneID:100039484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins product : similar to Annexin A11 transcript_id : XM_001472963.1

name	LOC100039175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265328 GeneID:100039175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins product : similar to Placenta specific 9 transcript_id : XM_001472394.1

name	LOC100039192 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265330 GeneID:100039192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 187 ESTs, 4 Proteins product : similar to D14Ertd449e protein, transcript variant 1 transcript_id : XM_001472492.1

name	LOC100039192 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265332 GeneID:100039192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 106 ESTs, 1 Protein product : similar to D14Ertd449e protein, transcript variant 2 transcript_id : XM_001472510.1

name	LOC100039213 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265334 GeneID:100039213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins product : hypothetical protein LOC100039213 transcript_id : XM_001472528.1

name	LOC100039227 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265336 GeneID:100039227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 24 ESTs, 1 Protein product : similar to RIKEN cDNA 1110051B16 gene transcript_id : XM_001472554.1

name	LOC100039503 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265357 GeneID:100039503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 4 Proteins product : similar to Annexin A11 transcript_id : XM_001473015.1

name	LOC100039246 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265338 GeneID:100039246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins product : similar to Placenta specific 9 transcript_id : XM_001472576.1

name	LOC100039257 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265340 GeneID:100039257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 180 ESTs, 4 Proteins product : similar to D14Ertd449e protein, transcript variant 1 transcript_id : XM_001472657.1

name	LOC100039257 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265342 GeneID:100039257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 105 ESTs, 1 Protein product : similar to D14Ertd449e protein, transcript variant 2 transcript_id : XM_001472673.1

name	LOC100039280 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265344 GeneID:100039280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins product : hypothetical protein LOC100039280 transcript_id : XM_001472694.1

name	LOC100039293 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265346 GeneID:100039293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 1 Protein product : similar to RIKEN cDNA 1110051B16 gene transcript_id : XM_001472720.1

name	LOC100039527 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265359 GeneID:100039527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to Ubtf protein transcript_id : XM_001473058.1

name	LOC100039538 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265361 GeneID:100039538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039538 transcript_id : XM_001473075.1

name	4933413J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396734 GeneID:71106 MGI:1918356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 4933413J09 gene transcript_id : XM_354798.4

name	Slmap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605991 GeneID:83997 MGI:1933549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sarcolemma associated protein transcript_id : NM_032008.3

name	LOC100039353 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265348 GeneID:100039353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Ribosomal protein L34 transcript_id : XM_001472758.1

name	A630054L15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802933 GeneID:211922 MGI:2442980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630054L15 gene transcript_id : NM_145969.2

name	Arf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131062 GeneID:11843 MGI:99433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor 4 transcript_id : NM_007479.3

name	E430028B21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538841 GeneID:211948 MGI:2443226
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E430028B21 gene transcript_id : NM_178668.3

name	4921531P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396736 GeneID:207778 MGI:2685130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 4921531P07 gene transcript_id : XM_908445.2

name	LOC669315 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265352 GeneID:669315
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472872.1

name	I920194n01 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265326 GeneID:328364
definition	codon_start : 1 product : hypothetical protein LOC328364 protein_id : XP_001472101.1

name	LOC100039007 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265324 GeneID:100039007
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472076.1

name	Zmiz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41053864 CCDS:CCDS26873.1 GeneID:328365 MGI:3040693
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : retinoic acid induced 17 protein_id : NP_899031.2

name	4931406H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424914 GeneID:77592 MGI:1924842
definition	codon_start : 1 product : hypothetical protein LOC77592 protein_id : NP_780473.1

name	Ppif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527310 CCDS:CCDS26874.1 GeneID:105675 MGI:2145814
definition	EC_number : 5.2.1.8 GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : rotamase; cyclophilin F; peptidyl-prolyl cis-trans isomerase; cyclophilin D product : peptidylprolyl isomerase F protein_id : NP_598845.1

name	2310047A01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396733 GeneID:71918 MGI:1919168
definition	codon_start : 1 product : hypothetical protein LOC71918 protein_id : XP_980281.1

name	Anxa11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304885 CCDS:CCDS26875.1 GeneID:11744 MGI:108481
definition	GO_component : GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0008429 - phosphatidylethanolamine binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] codon_start : 1 exception : mismatches in translation note : annexin XI product : annexin A11 protein_id : NP_038497.1

name	Plac9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402209 GeneID:211623 MGI:2663998
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : placenta specific 9 protein_id : NP_997112.1

name	D14Ertd449e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313632 CCDS:CCDS26876.1 GeneID:66039 MGI:1196450
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66039 protein_id : NP_079587.1

name	Cphx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425034 CCDS:CCDS26877.1 GeneID:105594 MGI:2145733
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cytoplasmic polyadenylated homeobox protein_id : NP_780551.1

name	1110051B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34419645 CCDS:CCDS26878.1 GeneID:278672 MGI:1916048
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC278672 protein_id : NP_899245.1

name	LOC100039468 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265354 GeneID:100039468
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472991.1

name	LOC100039484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265356 GeneID:100039484
definition	codon_start : 1 product : similar to Annexin A11 protein_id : XP_001473013.1

name	LOC100039175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265329 GeneID:100039175
definition	codon_start : 1 product : similar to Placenta specific 9 protein_id : XP_001472444.1

name	LOC100039192 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265331 GeneID:100039192
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472542.1

name	LOC100039192 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265333 GeneID:100039192
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472560.1

name	LOC100039213 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265335 GeneID:100039213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472578.1

name	LOC100039227 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265337 GeneID:100039227
definition	codon_start : 1 product : similar to RIKEN cDNA 1110051B16 gene protein_id : XP_001472604.1

name	LOC100039503 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265358 GeneID:100039503
definition	codon_start : 1 product : similar to Annexin A11 protein_id : XP_001473065.1

name	LOC100039246 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265339 GeneID:100039246
definition	codon_start : 1 product : similar to Placenta specific 9 protein_id : XP_001472626.1

name	LOC100039257 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265341 GeneID:100039257
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472707.1

name	LOC100039257 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265343 GeneID:100039257
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472723.1

name	LOC100039280 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265345 GeneID:100039280
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472744.1

name	LOC100039293 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265347 GeneID:100039293
definition	codon_start : 1 product : similar to RIKEN cDNA 1110051B16 gene protein_id : XP_001472770.1

name	LOC100039527 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265360 GeneID:100039527
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473108.1

name	LOC100039538 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265362 GeneID:100039538
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473125.1

name	4933413J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396735 GeneID:71106 MGI:1918356
definition	codon_start : 1 product : hypothetical protein LOC71106 protein_id : XP_354798.3

name	Slmap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605992 CCDS:CCDS26880.1 GeneID:83997 MGI:1933549
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA] GO_function : GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : sarcolemmal-associated protein product : sarcolemma associated protein protein_id : NP_114397.3

name	LOC100039353 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265349 GeneID:100039353
definition	codon_start : 1 product : similar to Ribosomal protein L34 protein_id : XP_001472808.1

name	A630054L15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122407 GeneID:211922 MGI:2442980
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC211922 protein_id : NP_666081.1

name	Arf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680720 CCDS:CCDS26881.1 GeneID:11843 MGI:99433
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ADP-ribosylation factor 4 protein_id : NP_031505.1

name	E430028B21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538842 CCDS:CCDS26882.1 GeneID:211948 MGI:2443226
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA] codon_start : 1 product : 2'-phosphodiesterase protein_id : NP_848783.3

name	4921531P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82953611 GeneID:207778 MGI:2685130
definition	codon_start : 1 product : similar to hCG1779312 protein_id : XP_913538.1

name	LOC100039411 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039411
definition	number : 1 pseudo : _no_value

name	LOC665279 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265350 GeneID:665279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 7 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_030865.1

clone name	MSMg01-388L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-462I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-278A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340J10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-126B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025D20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-186J20.T7 (MSMg01no186_j20.b1)	MSMg01-186J20.TJ (MSMg01no186_j20.g1)
ACC	AG378241	AG378242
length	750	783
length of high quality (start - end)	318 (45 - 362)	281 (78 - 358)
definition	CHROMAT_FILE: MSMg01no186_j20.b1 PHD_FILE: MSMg01no186_j20.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:01:39 2005	CHROMAT_FILE: MSMg01no186_j20.g1 PHD_FILE: MSMg01no186_j20.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:01:39 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCAAGAACTGTCTGGTCTACTTCATGAAGCCCTGTCTTAAATACAACA ATAATAACAAAGAAACAAAAACACTAACATGGGGTTGCCCTCCTCTTTGT CATCCTTGTCCTCCCTCTTCCTCCTCCTCCTGCTAAGTCCTCTTCCTCCT TCTCTCCCCTTTTTCTCTTACTCTTTTAACTCCTCCCCCTACTTCCTCTT TTTTGAGATAAGGTGTCACTTATCTGTGGCCCAGGCTGACTTTGAACTCG TGACAACCTTCCTGCCACCGATTCTGGGATTACTGCTATGAAGCCACCAT GCTTTGTTCCTGTTANTTAGTTTCTCCAGGCCCCCCCACGNNTCCCTTCA GCTCGAATCCCTTTTGGTGCCCCCCCAAAAAAAAAAAAAAAATGNGGTGG GGGGGGGGTTTTTTCTTTTCTTTTTTTTTTCTTTNTTTTGTTTTTTTTTT TGTTCCTGTTCCCGCGCTTCGTTCTTTTGTTTTCTTTTTCTTTTTTTTTT TCTTCTTTCCCCTCTCTTTTTTGTTCCCCTTTTCCCCTTTTTTTTGCTTT TTCCCCTTTACCTTTTTTTTTTTCCTTCTTTTTTTTTCCCCTTTTCTTCT CCCCCTTTCTCCTTTTTCTCCCTCCCTTTATTTTTCTGCCCTCTTTTTCC CTTCCCCCCCTCCTTTTCTTCTTTTTTTCTCATTCTTATGCCACCACCTT	CGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXAAGATCTCATCGAAACAAAGCTG TGACACTCATGGCACTGTCCGTGTGTGACCTGTGTTGCTGTGACACTCAT GGCACTGTCCATGTGTGACCTGTGTTGCTGTGACACTCACGGCACTGTCC ATGTGTGACCTGAGTTGGCACAAGCCACAGACACCCCCAACCCCCCCACC TCCCAGCCTGGCTTCTGAGACATCACTCAGGGCTCTTGTGAAAGTCCCAG CGTCAATGCCTTCCCTCCTGTTCACTGTGAATCCTGCTGGCTGCTGCTGT GATTTTTGTTTTTTTTTTGACCCCCCCCCCCCCCATGACCTGGTAACAGA CCTGTGAGCCCTTTCCCCCCCCACAAAGAAAATACCCGTGGTGAAAACTT ATAGACACTGCCTGACCTCCTGCTGCTCTCATTACCCTAACATTCTTCTG CAAAGATTAGCTAATTATGATATTCCCCTTACCTTAAACCTATCTATTTA CCCTTCTATACCCCAATATACCTCTCCTTTATACCCCCTCTTTCACTTCG CTTTTTATATATCCATTTCCCCTTTTTTTCACTCTCTCTTTCATCCCATC TTTTCACCCATATTTTTACCCCCTATACCAATCCAATTATTCCAAATATT TCCCCCCCCTTTATTTTTTCCCCCTTTTATCCCTTTTTTCCCATTTACCA TATTTTTATCCTAATTATCTTTAACTCCCACCC
quality values	Open. Hide. 8 10 8 9 9 10 13 21 34 29 33 32 32 28 28 37 23 19 10 10 9 21 21 41 33 33 33 33 33 36 53 57 53 57 57 57 57 57 57 23 24 10 11 11 26 34 57 57 47 47 42 42 68 47 47 47 47 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 51 51 51 50 50 51 51 68 68 68 51 51 51 51 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 59 59 59 59 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 50 50 50 53 53 53 53 57 57 59 59 59 59 57 57 53 53 50 50 50 59 59 34 30 21 12 11 11 12 21 25 37 59 47 50 50 50 50 50 59 57 57 57 57 57 57 59 59 57 57 57 50 50 59 59 59 59 59 27 27 11 12 12 6 3 0 3 6 6 6 6 9 10 9 7 7 7 6 6 6 6 7 7 15 9 9 8 8 7 3 0 0 3 22 23 39 39 39 37 33 37 39 47 47 43 48 48 48 48 48 47 47 47 30 21 11 11 9 9 9 16 15 12 10 12 12 8 8 9 12 13 13 26 35 32 23 23 23 23 18 16 9 9 3 0 3 6 6 6 9 9 16 15 16 28 9 9 10 10 10 8 13 9 9 9 6 6 6 7 13 15 13 10 8 8 8 11 18 28 30 21 16 8 3 0 3 6 10 10 8 8 8 8 8 8 8 8 12 19 15 15 10 8 8 8 9 9 9 9 9 12 9 8 6 6 6 6 8 10 9 9 8 8 8 10 10 8 10 10 13 15 14 11 11 10 15 10 13 11 10 10 11 16 15 9 10 10 10 8 8 8 8 8 8 15 16 21 15 14 12 11 9 9 9 9 9 15 28 23 25 15 10 8 8 8 8 8 11 11 12 8 8 8 8 10 10 12 17 17 14 10 16 13 18 10 10 8 8 8 8 10 10 13 11 11 11 12 18 12 9 9 10 15 15 20 24 14 14 12 19 15 14 8 8 8 10 10 14 10 12 13 21 13 10 10 10 10 10 15 15 13 10 8 8 8 8 8 8 8 10 11 10 10 7 7 6 6 6 8 10 10 11 10 10 11 9 9 9 9 8 10 6 7 8 10 10 8 8 8 12 10 8 8 8 8 8 8 8 8 10 9 14 19 23 15 12 11 11 11 8 8 8 8 9 13 15 15 18 14 14 8 8 8 8 10 10 8 8 6 6 7 11 15 18 19 12 10 10 10 10 9 9 9 10 8 8 8 8 6 8 8 9 9 8 10 9 9 9 9 9	Open. Hide. 11 11 9 13 15 8 8 8 7 8 15 19 35 32 36 37 37 37 37 37 41 50 53 53 53 53 53 53 57 57 48 57 48 48 48 48 57 48 43 42 28 36 36 48 30 57 68 68 68 54 51 50 50 50 50 51 68 68 68 68 54 48 42 41 41 50 50 50 59 68 68 50 50 50 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 50 50 50 51 51 51 51 51 68 68 68 68 68 44 57 52 43 43 36 32 18 18 18 22 36 44 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 52 57 57 57 57 52 52 57 57 57 57 57 57 57 57 57 57 52 52 57 57 57 59 59 59 57 57 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 57 57 57 57 57 57 68 57 59 57 57 43 43 43 44 59 59 59 54 54 54 59 59 68 68 68 57 57 57 54 46 46 46 46 57 59 47 57 54 54 54 59 59 68 68 68 68 57 41 32 15 15 11 15 15 24 24 29 32 42 43 42 42 42 48 57 48 40 40 24 24 18 25 30 59 43 43 32 30 18 17 17 26 30 37 32 17 13 10 10 11 10 13 13 16 21 12 13 6 6 6 6 7 7 15 18 23 23 35 34 25 22 15 13 16 12 13 13 13 24 19 26 13 13 13 15 30 32 25 25 25 25 25 30 30 21 21 12 12 12 12 11 11 15 17 19 18 26 28 23 11 15 9 10 8 15 13 10 10 10 13 18 10 10 10 10 11 8 8 8 6 6 8 10 13 16 11 10 10 10 10 8 8 8 8 8 10 13 11 12 12 24 25 30 30 25 25 15 15 14 14 14 13 16 9 9 9 9 9 9 12 11 12 12 19 10 10 10 9 10 9 9 9 9 9 10 10 10 8 8 8 8 8 8 8 10 11 8 8 10 10 10 10 10 11 11 11 6 8 8 8 8 8 8 8 8 10 13 12 10 10 10 10 10 10 10 8 8 8 10 15 8 8 8 9 12 10 10 10 10 10 9 13 10 10 9 9 8 10 9 6 6 6 11 11 11 12 11 8 8 8 10 10 10 10 8 8 7 7 8 8 10 9 8 8 16 9 8 8 8 8 12 12 10 10 9 9 10 8 6 6 6 8 10 10 9 9 11 12 15 10 8 8 8 6 6 8 10 6 6 8 8 10 10 11 13 13 11 11 11 11 10 8 8 8 8 11 8 8 8 8 8 10 11 11 10 10 8 8 8 8 8 9 8 12 10 10 10 10 8 8 8 10 12 17 15 11 11 11 14 12 10 8 11 8 8 8 8 8 8 8 8 10 10 10 8 10 10 10 10 10 16 16 11 11 11 8 10 9 8 8 8 8 9 9 14 9 8 8 10 10 9 8 9 9 9 14 13 14 14 15 18 19 20 20 20 10 10 10 10 8 8 8 6 6 6 8 9 10 10 10 9 9 11 9 10 8 8 8 8 8 8 8 8 10 12 10 8 8 8 8 8 11 11 8 8 6 6 6 8 8 10 8 8 7 7 8 8 8 9 9 11 16 11

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no186_j20.g1 MSMg01no186_j20.g1 CHROMAT_FILE:
MSMg01no186_j20.g1 PHD_FILE: MSMg01no186_j20.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:01:39 2005
         (281 letters)



>mm_chr14_26519251_26519931
          Length = 681

 Score =  414 bits (214), Expect = e-120
 Identities = 220/222 (99%)
 Strand = Plus / Plus

                                                                       
Query: 60  gctgtgacactcatggcactgtccatgtgtgacctgtgttgctgtgacactcacggcact 119
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 220 gctgtgacactcatggcactgtccgtgtgtgacctgtgttgctgtgacactcacggcact 279

                                                                       
Query: 120 gtccatgtgtgacctgagttggcacaagccacagacacccccaacccccccacctcccag 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 280 gtccatgtgtgacctgagttggcacaagccacagacacccccaacccccccacctcccag 339

                                                                       
Query: 180 cctggcttctgagacatcactcagggctcttgtgaaagtcccagcgtcaatgccttccct 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 cctggcttctgagacatcactcagggctcttgtgaaagtcccagcgtcaatgccttccct 399

                                                     
Query: 240 cctgttcactgtgaatcctgctggctgctgctgtgatttttg 281
           |||| |||||||||||||||||||||||||||||||||||||
Sbjct: 400 cctggtcactgtgaatcctgctggctgctgctgtgatttttg 441


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 2
Number of HSP's successfully gapped: 1
Length of query: 281
Length of database: 681
Length adjustment: 9
Effective length of query: 272
Effective length of database: 672
Effective search space:   182784
Effective search space used:   182784
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information