MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-474C12
Chromosome	14 (Build37)
Map Location	76,344,788 - 76,345,025
singlet/doublet	singlet
Overlap gene	Gtf2f2
Upstream gene	Lrch1, LOC100043169, 5031414D18Rik, 4921509B22Rik, LOC100043176, Lcp1, Cpb2, Zc3h13, Gm912, Spert, 4930564B18Rik, Cog3, Slc25a30, LOC100043189, Tpt1, LOC100038852, LOC668504
Downstream gene	Kctd4, 1200011I18Rik, Nufip1, LOC100043752, 2900040C04Rik, Tsc22d1, 2810032E02Rik, LOC100043753
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lrch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380916 MGI:2443390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043169 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	5031414D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271221 MGI:2685590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921509B22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70859 MGI:1918109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins

name	LOC100043176 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Lcp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18826 MGI:104808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56373 MGI:1891837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67302 MGI:1914552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm912 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380918 MGI:2685758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 12 Proteins

name	Spert (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67926 MGI:1915176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930564B18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75272 MGI:1922522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Cog3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338337 MGI:2450151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67554 MGI:1914804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043189 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22070 MGI:104890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038852 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68705 MGI:1915955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 ESTs, 13 Proteins pseudo : _no_value

name	Kctd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67516 MGI:1914766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200011I18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67467 MGI:1914717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nufip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27275 MGI:1351474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 1291 ESTs, 8 Proteins

name	2900040C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72893 MGI:1920143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tsc22d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21807 MGI:109127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2810032E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72661 MGI:1919911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 4 Proteins

name	LOC100043753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Lrch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90991703 GeneID:380916 MGI:2443390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and calponin homology (CH) domain containing 1 transcript_id : NM_001033439.2

name	LOC100043169 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265672 GeneID:100043169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043169 transcript_id : XM_001479669.1

name	5031414D18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348521 GeneID:271221 MGI:2685590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5031414D18 gene transcript_id : NM_198642.1

name	4921509B22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397251 GeneID:70859 MGI:1918109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : RIKEN cDNA 4921509B22 gene, transcript variant 2 transcript_id : XM_895010.2

name	LOC100043176 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265674 GeneID:100043176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100043176 transcript_id : XM_001479681.1

name	Lcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130633 GeneID:18826 MGI:104808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte cytosolic protein 1 transcript_id : NM_008879.3

name	Cpb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982711 GeneID:56373 MGI:1891837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase B2 (plasma) transcript_id : NM_019775.2

name	Zc3h13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61742809 GeneID:67302 MGI:1914552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 13 transcript_id : NM_026083.2

name	Gm912 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397261 GeneID:380918 MGI:2685758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 12 Proteins product : gene model 912, (NCBI) transcript_id : XM_354829.4

name	Spert (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385951 GeneID:67926 MGI:1915176
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatid associated transcript_id : NM_026457.1

name	4930564B18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397263 GeneID:75272 MGI:1922522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4930564B18 gene transcript_id : XM_127749.4

name	Cog3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392069 GeneID:338337 MGI:2450151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : component of oligomeric golgi complex 3 transcript_id : NM_177381.3

name	Slc25a30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803227 GeneID:67554 MGI:1914804
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 30 transcript_id : NM_026232.2

name	LOC100043189 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265680 GeneID:100043189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043189 transcript_id : XM_001479710.1

name	Tpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59276013 GeneID:22070 MGI:104890
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor protein, translationally-controlled 1 transcript_id : NM_009429.2

name	LOC100038852 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265368 GeneID:100038852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038852 transcript_id : XM_001471928.1

name	Gtf2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351202 GeneID:68705 MGI:1915955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIF, polypeptide 2 transcript_id : NM_026816.3

name	Kctd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50980304 GeneID:67516 MGI:1914766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 4 transcript_id : NM_026214.3

name	1200011I18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043962 GeneID:67467 MGI:1914717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200011I18 gene transcript_id : NM_026177.3

name	Nufip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369325 GeneID:27275 MGI:1351474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear fragile X mental retardation protein interacting protein 1 transcript_id : NM_013745.3

name	LOC100043752 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265802 GeneID:100043752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 1291 ESTs, 8 Proteins product : similar to ribosomal protein S2 transcript_id : XM_001480887.1

name	2900040C04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265804 GeneID:72893 MGI:1920143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 2900040C04 gene transcript_id : XM_001480889.1

name	Tsc22d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559425 GeneID:21807 MGI:109127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSC22 domain family, member 1 transcript_id : NM_207652.1

name	Tsc22d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47777349 GeneID:21807 MGI:109127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSC22 domain family, member 1 transcript_id : NM_009366.2

name	2810032E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265684 GeneID:72661 MGI:1919911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 4 Proteins product : RIKEN cDNA 2810032E02 gene transcript_id : XM_894566.3

name	LOC100043753 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265806 GeneID:100043753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043753 transcript_id : XM_001480898.1

name	Lrch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90991704 GeneID:380916 MGI:2443390
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : calponin homology (CH) domain containing 1 product : leucine-rich repeats and calponin homology (CH) domain containing 1 protein_id : NP_001028611.2

name	LOC100043169 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265673 GeneID:100043169
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479719.1

name	5031414D18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400840 GeneID:271221 MGI:2685590
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC271221 protein_id : NP_941044.2

name	4921509B22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954305 GeneID:70859 MGI:1918109
definition	codon_start : 1 product : hypothetical protein LOC70859 isoform 2 protein_id : XP_900103.1

name	LOC100043176 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265675 GeneID:100043176
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479731.1

name	Lcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543113 CCDS:CCDS27276.1 GeneID:18826 MGI:104808
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0001891 - phagocytic cup [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0009611 - response to wounding [Evidence ISS] codon_start : 1 note : plastin 2, L product : lymphocyte cytosolic protein 1 protein_id : NP_032905.2

name	Cpb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982712 CCDS:CCDS27277.1 GeneID:56373 MGI:1891837
definition	EC_number : 3.4.17.20 GO_function : GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0050425 - carboxypeptidase B activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 function : carboxypeptidase note : carboxypeptidase U; carboxypeptidase R; thrombin-activatable fibrinolysis inhibitor product : carboxypeptidase B2 (plasma) protein_id : NP_062749.2

name	Zc3h13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61742810 CCDS:CCDS27278.1 GeneID:67302 MGI:1914552
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA 3110050K21 protein_id : NP_080359.2

name	Gm912 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397262 GeneID:380918 MGI:2685758
definition	codon_start : 1 product : hypothetical protein protein_id : XP_354829.4

name	Spert (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385952 CCDS:CCDS27279.1 GeneID:67926 MGI:1915176
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : novel leucine zipper testicular protein product : testis-specific leucine zipper protein nurit protein_id : NP_080733.1

name	4930564B18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20876980 GeneID:75272 MGI:1922522
definition	codon_start : 1 product : hypothetical protein LOC75272 protein_id : XP_127749.1

name	Cog3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392070 GeneID:338337 MGI:2450151
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005801 - Golgi cis face [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : component of oligomeric golgi complex 2 product : component of oligomeric golgi complex 3 protein_id : NP_796355.2

name	Slc25a30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385736 CCDS:CCDS27281.1 GeneID:67554 MGI:1914804
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 30 protein_id : NP_080508.1

name	LOC100043189 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265681 GeneID:100043189
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479760.1

name	LOC100038852 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265369 GeneID:100038852
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471978.1

name	Tpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678437 GeneID:22070 MGI:104890
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005771 - multivesicular body [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA] codon_start : 1 note : fortilin; 21 kDa polypeptide under translational control; snoRNA MBI-161; translationally regulated transcript (21 kDa) product : tumor protein, translationally-controlled 1 protein_id : NP_033455.1

name	Gtf2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930425 GeneID:68705 MGI:1915955
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : general transcription factor IIF, polypeptide 2 protein_id : NP_081092.1

name	Kctd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50980305 CCDS:CCDS27282.1 GeneID:67516 MGI:1914766
definition	codon_start : 1 product : potassium channel tetramerisation domain containing 4 protein_id : NP_080490.3

name	1200011I18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754089 CCDS:CCDS27283.1 GeneID:67467 MGI:1914717
definition	codon_start : 1 product : hypothetical protein LOC67467 protein_id : NP_080453.2

name	Nufip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305335 CCDS:CCDS27284.1 GeneID:27275 MGI:1351474
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA]; GO:0005726 - perichromatin fibrils [Evidence ISS]; GO:0048786 - presynaptic active zone [Evidence ISS]; GO:0008023 - transcription elongation factor complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : nuclear FMRP interacting protein product : nuclear fragile X mental retardation protein interacting protein protein_id : NP_038773.1

name	LOC100043752 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265803 GeneID:100043752
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480937.1

name	2900040C04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265805 GeneID:72893 MGI:1920143
definition	codon_start : 1 product : hypothetical protein LOC72893 protein_id : XP_001480939.1

name	Tsc22d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559426 CCDS:CCDS27285.1 GeneID:21807 MGI:109127
definition	GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; transforming growth factor beta 1 induced transcript 4 product : transforming growth factor beta 1 induced transcript 4 isoform 1 protein_id : NP_997535.1

name	Tsc22d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678315 CCDS:CCDS27286.1 GeneID:21807 MGI:109127
definition	GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transforming growth factor beta 1 induced transcript 4 product : transforming growth factor beta 1 induced transcript 4 isoform 2 protein_id : NP_033392.1

name	2810032E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265685 GeneID:72661 MGI:1919911
definition	codon_start : 1 product : hypothetical protein LOC72661 protein_id : XP_899659.3

name	LOC100043753 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265807 GeneID:100043753
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480948.1

name	LOC668504 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265801 GeneID:668504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 ESTs, 13 Proteins product : similar to SVH protein pseudo : _no_value transcript_id : XR_034885.1

clone name	MSMg01-447O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164H17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025L08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-474C12.T7 (MSMg01no474_c12.b1)	MSMg01-474C12.TJ (MSMg01no474_c12.g1)
ACC	AG556284	AG556285
length	1,867	754
length of high quality (start - end)	---	239 (73 - 311)
definition	CHROMAT_FILE: MSMg01no474_c12.b1 PHD_FILE: MSMg01no474_c12.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:52:30 2005	CHROMAT_FILE: MSMg01no474_c12.g1 PHD_FILE: MSMg01no474_c12.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:52:30 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	AACTTAAACAAATTTCATAGAGNTNNCTGGGNGGNGTANGCGGTGCNTGT NNCAGTGTGGAGCGGATCAAGCGCGATATCTATCTATCTCGCGAGCAGAG GAGGCGTGAGTGACTGCGTGCGATCGACATGAGAGTGCGGTGTATATGTG TTAGCCTCGTTTNAGGNAGAAAGTGNGAGGCACGAGCAGGTGCTTCNCTG CATCTCATGCNTATAGAGGAGGCTCAGCAGTCGTTTGATGTGAACGATGC ACGTACCNNTAACTGCACTTATCGTGTGATGGTCTTNGAAGAGGTAGTGT GCGGCAGTGATGTATGATGAGGGCTGCGTGTGTTGTCGACAGACATGCGC ATGTCGCTCAGCCTGAGTTCATGTATANTGATACGNCTGCTAAGGNTGTC GTCGTCGTGATAGTCTCGAGTGTCGCGTTCGATGTTGGTGTCGTCGTGTG TGCTATGGCTGACGTACTCGCTGGCTCATAAGACGATATCGNGTGATAGT GCTGCGTGTAGGTTGATACGAGTACGAGTTGAGTAGTCTCGAGGCTGGTG CGTGTGGCATGANGTCGTAGTTACGCATATAGTCTAGTAGTGTGATGATA GTGTCGGCGCCGATGTGTGGCATCTGATCTGTATGGCGCGTGCTCGCACT ATACTACGGTCGGCGAGTTTGTATGCGTATCGCTCAGAGTGAAGTACAGA CGTGATGATACTACGATGAAGAGATGAGAAGTTATCGCGCGAGTGCAGAT AGTGAGGCCGAACTGTAGCATAGACGACTNCGAACATAGTATGATATCGT TCTATCTCATACACGTACGTTGCTCGTCTCTCTTATCACATCACAGCGTA TCCCTCTGCATTCTTCTACTATTGTGTGAAGAGGAGGATCNCGTAACGCT AGCGGATGGCAAGGTCGTGCATGTATATGAGGGTAGCATGCATCGANTGA ACGTCGCGAGTGTCGGTCGCGTCACACACGCTTCGTGTGTACTACACGGA GCGGCTAAGCAGAGACGCGTATATGCATGATCTGTGTTATCGTCATTACC GCATAGATAGATCCTTTTACATACGATCACGGTAACGTGGTGACGTGACG CGGTTATGTGACGGATAGGGCGCGGTCGATGTGGAGCGAATAGTTCCTAG NAGGGCAGCAGTGACGATACATATCTCTCATCGTGTTACTATCTCGCGTA CGTGATCCAGCTCCTCGAATACGTGTCGATGCCACTCATATGTGCATAGC NGTGATATTTGATATATTGTCTGTGTACCAGTATTGTTCGGCACATATAT GCGAGTTGACCACTACTTAACTTCGCACAGAACTTCTGCTCTTCTGCTCA AGACGTGCGACGGACGTGNATGGCTATTACGGGACTAGACGAGTTGCGGG TGCANTACGCGTGTGTANTCTGGATCAGTTCAGAAGTGCTACGACGTGAA TNTGAGTGCGGNCGTTATATACGCCGCGCCGCGTAGTAGACGATATTACA TCATCCGATCTATCACAGAGAATAATAGAACATCATAGCGTGAGTCACTG GAGCGCGAATCGTGAAAGGATCTACTACATATAGCTGGATATAGTGTGCG GGCTGATGCAGTCGATATACGGCGCGNTTGTATGTGACTCATGATGACGA TCGCGTGATTGCGTGTACCTCGTTGTCATACACGTATTACTGACGATGAT GCGTATGATACATTCGACGACTATNATCATGCACTACAGGTANCGAANGT ATCATATACGAGTATGANATAGAGAGTATGACGATCGTGGAGACAGTGAT CGTCTGTGNTCAGATGTATGNGCTGCTTAGCATAGCACCACGACTGTACG GAATGAAACAGTAGTAN	CCCATGAAGTGGTAGCCTGGNGGNCGCCTGGTTTCAAACCTAGGTGAACT ATAGAAGGTTACGAAAACATCCAGATGTAGGTAACATTGAAGCAGAAGTA TTTGAGAGCTGAATTGGCAAGAGGGATCTCCCACACCTCAGAATTACACA TATGATTGGATTCTTCAGGCACTCTATGACCGTGTTTCACTTCTTCAGCC GCAGGCACACCTGCCATCCTAATGTATTTTCTTACAGGAAAGTCATTGTC TGCACTGGGGTCTTCTACATGCTTAACTCATCTGAAAGTACTTGTCACAA CAGGTTTTCTTCTGAGTGNCGAAAGATGTCTCAGTGGGTGAAGGTGCTTG CCACGGAACCTGGCTTCAGTTCCTAAGAACCACAGAACCACATGGCCAAA GAAAAGAACAGATTTTTTTTTAAGTATATTTTTAATTCTGTGGATGTGTG TGGTTTTTTACTCTCCTCCTTCCTCCCTCCCTACTCTATACTTAACCTCT TTCCTGCTCCTTCTACCTCCCCCCTATTTGCACCTCTATTCCCATATTTC CCCTCTTTCTCTCCTTCTTTCCCTTTACTCCGTTTTTTTTACCCTTTTCC CTATTCTTTCCATTTATCTACTTTTTCCTCTCTTCTCTCCAACTTCATCT CCTCCTTTCTTTTTTTTTTTTTTTCCCAACACTCCCTTATCTTAATTCTC TCTCTCTTTTCTTCATTCCTTTTCCTTCCTTTCATCCCGTCTTCTCTTAT CCCT
quality values	Open. Hide. 6 6 6 6 6 6 6 6 6 6 7 6 6 6 6 7 8 8 9 12 12 3 0 3 0 0 3 8 8 8 3 0 3 3 0 3 9 3 0 3 6 6 15 19 9 3 0 3 6 3 0 0 3 9 9 6 6 6 6 8 6 6 6 6 6 6 8 7 7 7 9 9 8 6 6 6 6 8 8 10 10 10 10 11 9 9 9 11 12 10 10 10 8 8 8 8 8 6 6 6 7 7 11 11 11 11 12 13 11 8 6 6 6 6 6 6 6 6 6 6 6 8 11 11 10 8 8 8 6 8 6 6 6 8 8 8 8 8 6 7 6 6 8 8 8 8 8 8 8 8 6 8 6 6 8 8 10 10 6 6 6 3 0 3 10 3 0 3 12 10 8 8 6 8 3 0 3 6 6 6 6 9 9 9 9 9 10 8 8 8 7 7 7 9 9 3 0 3 10 10 9 6 6 6 6 8 8 10 12 3 0 3 6 8 8 8 8 8 8 8 12 11 8 8 6 6 8 6 6 6 6 6 6 6 8 13 13 12 13 10 8 8 8 8 8 6 6 6 6 6 6 6 8 8 8 8 3 0 0 3 8 6 10 6 6 6 6 6 7 7 7 7 8 9 10 10 8 8 8 8 8 8 8 9 9 3 0 3 11 10 10 10 8 8 8 10 8 8 8 8 8 8 8 8 6 6 8 8 11 10 10 10 9 10 8 8 6 6 7 6 6 6 8 8 10 8 8 8 8 8 8 8 8 10 8 8 9 10 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 10 12 10 7 6 8 8 9 8 8 6 6 6 6 6 6 8 8 9 9 3 0 3 6 8 8 10 13 3 0 3 7 8 8 6 6 6 6 3 0 3 6 6 6 6 8 7 6 6 8 11 17 13 13 11 11 11 12 12 10 10 9 9 8 8 8 8 8 8 10 10 15 10 10 10 6 6 6 6 8 8 10 8 8 8 8 8 8 10 11 13 19 19 11 10 10 10 8 8 8 8 10 11 11 9 9 9 9 8 8 13 8 6 6 6 8 8 9 9 9 10 10 13 13 8 8 7 7 7 8 8 8 10 10 3 0 3 8 7 8 9 11 9 10 6 9 9 6 10 8 10 8 8 10 10 10 10 9 12 12 9 9 10 11 9 6 6 6 6 6 8 6 6 6 6 6 6 6 10 10 9 10 9 8 6 8 8 8 8 8 8 8 8 8 8 8 13 9 10 10 9 10 10 11 11 3 0 3 10 10 9 9 9 10 10 10 8 8 8 8 8 10 10 9 9 10 10 13 12 10 10 9 9 9 9 13 10 6 6 6 8 8 10 10 10 10 11 8 8 8 8 8 8 10 8 8 10 9 9 8 8 6 6 6 6 8 6 6 6 8 8 7 8 8 6 6 8 6 8 8 8 8 8 6 6 6 6 6 6 8 8 10 10 10 10 11 10 10 8 8 6 7 7 6 6 6 6 6 6 6 6 6 7 6 6 6 6 8 9 9 9 9 9 8 8 8 8 8 6 6 6 6 6 6 6 6 8 6 6 8 6 6 6 6 6 8 8 8 8 8 8 8 8 6 6 6 6 6 8 8 8 8 8 8 8 8 8 7 9 6 6 6 6 8 8 8 8 8 8 6 6 6 6 10 6 10 8 10 10 10 11 11 10 8 8 6 6 6 6 6 8 8 6 7 6 6 6 6 7 6 6 6 8 8 6 6 8 8 8 8 6 6 3 0 3 6 8 7 6 8 6 6 6 8 6 8 8 10 10 8 8 8 8 8 7 7 7 8 8 8 8 8 8 7 6 6 6 6 6 6 6 8 8 9 9 8 8 8 8 8 8 8 10 19 10 6 6 6 6 6 6 6 7 9 8 7 6 6 6 6 8 8 10 9 8 8 8 6 6 6 8 6 6 10 10 10 6 6 6 6 8 8 10 10 8 9 9 8 10 8 8 8 8 8 8 9 6 8 8 6 6 6 8 3 0 3 6 6 6 6 6 6 6 6 6 10 10 10 6 6 6 6 6 6 8 6 6 6 7 7 6 6 6 8 11 10 8 8 8 6 6 6 6 6 6 8 8 9 10 10 10 8 8 8 8 8 8 7 7 3 0 3 8 8 10 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 8 11 10 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 6 8 8 8 8 8 8 10 10 11 11 11 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 8 10 11 8 8 8 8 8 6 6 6 6 9 9 11 11 10 10 10 8 8 6 6 6 6 8 6 6 7 7 6 6 6 6 6 6 6 10 11 6 6 6 6 6 8 8 7 6 6 7 8 6 7 9 6 6 6 6 6 6 6 8 6 9 9 8 8 10 10 10 10 11 10 8 8 8 8 8 6 7 8 8 8 10 8 8 8 12 8 8 8 8 8 8 11 10 8 8 8 8 8 8 8 6 6 6 6 8 8 9 9 9 10 10 8 9 6 6 6 6 6 6 8 8 8 8 8 8 8 10 3 0 3 7 6 6 10 8 10 10 8 8 8 7 7 6 8 8 8 8 8 6 6 6 6 8 8 8 7 8 6 6 6 6 8 11 9 8 10 10 8 8 8 8 8 8 8 8 8 8 6 6 10 8 8 8 8 6 6 6 6 8 6 8 9 9 9 9 9 9 9 8 8 8 8 6 8 6 6 8 8 8 8 8 9 9 9 8 8 8 8 8 8 8 6 6 6 6 6 8 3 0 3 6 6 6 6 6 6 8 12 12 12 9 6 6 6 6 8 10 8 8 8 8 8 8 11 8 8 8 6 6 6 10 10 12 12 8 8 8 8 8 8 8 10 10 10 8 10 10 10 8 6 7 6 6 6 6 8 8 8 8 8 8 6 6 6 8 7 7 6 6 6 6 8 9 11 8 10 10 10 7 7 10 12 6 6 6 8 8 6 9 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 8 8 8 8 10 8 10 8 8 10 9 3 0 3 6 8 8 9 10 10 10 13 12 14 8 8 8 8 8 8 8 8 8 8 9 13 9 9 10 10 8 8 8 8 8 8 8 3 0 3 9 9 9 9 9 9 8 8 8 8 3 0 3 8 6 6 6 6 6 6 8 11 8 8 8 8 6 6 6 6 8 6 7 7 7 8 8 11 8 9 9 9 10 10 3 0 3 6 8 11 11 10 8 8 3 0 3 6 6 8 13 15 8 8 6 6 6 8 8 8 10 8 8 8 8 8 8 10 8 8 8 9 10 8 8 8 6 8 7 7 7 6 6 8 8 6 8 8 8 8 8 6 6 6 6 6 8 10 13 10 8 8 8 8 8 8 8 11 9 10 7 8 8 6 6 6 6 6 6 8 6 6 6 8 8 8 8 8 8 8 8 8 8 8 7 7 7 9 9 7 8 8 8 8 9 9 8 8 7 7 6 6 6 7 7 7 9 6 6 6 6 6 6 10 10 8 8 8 8 6 6 6 8 10 9 10 9 8 8 8 8 10 8 8 8 8 8 8 8 8 8 6 6 6 6 8 6 6 6 6 6 6 8 6 8 7 7 7 8 3 0 3 6 6 8 8 9 9 12 9 7 6 6 6 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 6 6 6 7 15 11 9 8 8 8 8 8 10 10 10 10 11 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 9 8 8 8 8 8 10 8 7 7 9 3 0 3 8 8 8 8 8 11 10 8 8 6 6 6 7 7 8 3 0 3 8 8 3 0 3 8 8 8 8 8 8 8 6 6 6 6 8 8 6 6 6 6 3 0 3 9 9 10 8 8 6 6 8 6 6 8 6 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 6 6 6 6 6 6 9 9 11 12 12 3 0 3 6 8 6 6 6 6 10 9 9 3 0 3 6 6 6 6 8 9 9 9 9 9 9 9 9 9 9 9 9 9 9 11 13 13 16 10 6 6 6 6 10 8 8 8 8 8 8 8 8 8 8 6 6 6 6 3 0	Open. Hide. 9 9 9 13 17 13 10 10 9 19 19 19 13 15 14 18 22 23 23 3 0 3 3 0 3 17 19 12 18 12 9 6 10 8 9 7 8 6 6 6 8 8 8 18 19 21 21 22 33 33 50 42 41 25 25 9 7 7 7 7 7 7 9 9 9 6 6 7 7 8 10 10 13 16 22 34 41 41 53 53 53 53 57 57 53 53 53 53 59 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 48 48 48 41 29 28 24 12 12 12 12 12 15 21 34 36 47 47 50 47 50 57 57 57 57 57 68 68 68 68 68 68 51 51 50 50 57 57 57 68 68 68 57 50 38 36 20 20 32 20 22 25 38 42 48 57 57 57 54 57 57 59 68 68 68 68 68 57 57 57 68 57 57 59 68 68 68 57 57 57 57 57 57 57 57 57 57 57 48 59 59 54 59 59 57 57 68 68 68 68 68 68 68 68 57 57 54 54 54 54 57 53 57 57 57 57 57 57 57 57 57 59 57 57 43 47 44 48 50 50 59 50 41 37 37 30 20 13 10 8 8 8 7 10 11 25 25 43 43 50 50 59 59 59 59 50 53 53 53 53 53 50 53 57 57 57 59 59 59 59 59 57 57 57 59 59 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 48 48 59 41 41 29 22 11 13 9 9 6 6 6 3 0 3 7 7 8 10 21 34 40 40 41 59 50 43 43 40 39 39 43 43 48 48 57 57 57 59 59 59 59 59 59 43 32 24 19 12 12 13 13 18 26 28 24 9 9 9 9 14 24 40 39 46 43 46 46 47 43 43 47 47 46 57 47 44 44 43 57 57 57 57 57 57 48 44 42 42 35 35 33 28 28 33 33 30 42 42 47 43 43 47 47 44 42 36 30 28 30 32 35 41 47 37 42 28 32 32 43 43 57 59 68 59 59 54 42 42 32 24 24 18 18 11 23 20 28 28 32 30 35 32 32 24 20 20 11 12 10 12 11 8 8 8 12 14 11 9 9 9 7 7 8 8 8 8 10 8 9 9 10 10 8 8 8 8 8 8 11 8 8 6 6 8 8 8 8 8 6 8 6 6 8 10 10 13 8 8 8 9 10 10 11 8 8 8 8 10 10 9 9 8 12 8 8 8 9 10 10 10 10 10 10 10 8 10 10 10 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 9 9 9 9 10 8 9 6 10 6 7 8 10 12 14 10 8 8 8 10 8 8 10 10 10 10 10 10 10 10 8 8 8 8 8 13 10 15 10 13 13 15 13 9 10 10 10 10 8 11 8 8 8 10 10 9 9 8 8 8 8 8 10 10 10 9 8 8 8 8 8 8 10 8 8 8 8 10 10 6 6 8 8 8 10 9 9 12 17 10 9 9 9 12 12 14 16 12 9 8 8 8 9 11 11 16 11 12 24 27 37 27 19 9 8 8 8 8 9 9 9 9 9 9 11 11 12 8 8 8 8 7 8 8 8 8 6 6 6 6 10 8 10 10 12 10 10 8 8 9 8 8 6 6 8 8 8 9 10 10 10 10 10 8 10 8 8 10 10 13 10 8 8 6 8 8 8 8 8 8 8 8 8 7 12 8 8 10 8 10 8 11 11 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no474_c12.g1 MSMg01no474_c12.g1 CHROMAT_FILE:
MSMg01no474_c12.g1 PHD_FILE: MSMg01no474_c12.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:52:30 2005
         (239 letters)



>mm_chr14_76344588_76345225
          Length = 638

 Score =  447 bits (231), Expect = e-130
 Identities = 237/239 (99%), Gaps = 1/239 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   agatgtaggtaacattgaagcagaagtatttgagagctgaattggcaagagggatctccc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 438 agatgtaggtaacattgaagcagaagtatttgagagctgaattggcaagagggatctccc 379

                                                                       
Query: 61  acacctcagaattacacatatgattggattcttcaggcactctatgaccgtgtttcactt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 acacctcagaattacacatatgattggattcttcaggcactctatgaccgtgtttcactt 319

                                                                       
Query: 121 cttcagccgcaggcacacctgccatcctaatgtattttcttacaggaaagtcattgtctg 180
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
Sbjct: 318 cttcagccgcaggcacacctgccatcctaatgtattttcttacaggaaagtcattg-cag 260

                                                                      
Query: 181 cactggggtcttctacatgcttaactcatctgaaagtacttgtcacaacaggttttctt 239
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 259 cactggggtcttctacatgcttaactcatctgaaagtacttgtcacaacaggttttctt 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 239
Length of database: 638
Length adjustment: 9
Effective length of query: 230
Effective length of database: 629
Effective search space:   144670
Effective search space used:   144670
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information