MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-484I17
Chromosome	14 (Build37)
Map Location	54,940,817 - 54,941,072
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100042621, LOC100043319, EG547328, LOC100043308, LOC328483, EG667765, EG630061, LOC630086, EG436467, LOC100043322, OTTMUSG00000015124, A430107P09Rik, OTTMUSG00000015049, LOC100043325, A730076H11Rik, LOC627777, A630038E17Rik, EG626545, Dad1, Abhd4, Olfr49, EG666623
Downstream gene	LOC667819, LOC100042642, 5330426L24Rik, Oxa1l, Slc7a7, Mrpl52, Mmp14, Lrp10, Rem2, Prmt5, D14Ertd500e, Jub, 4931414P19Rik, Psmb5, 5830406J20Rik, Cdh24, Acin1, LOC667711, 1700123O20Rik, LOC100042676, Cebpe, Slc7a8, LOC667893, Homez, Ppp1r3e, Bcl2l2, Pabpn1, Slc22a17, Efs, Il25, Cmtm5, Myh6, Myh7, Ngdn, Zfhx2, Thtpa, Ap1g2, Jph4, LOC667938, Dhrs2, LOC100042720
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins

name	LOC100043319 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG547328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547328 MGI:3645598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100043308 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 10 Proteins

name	LOC328483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins

name	EG667765 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667765 MGI:3704132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	EG630061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630061 MGI:3648929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC630086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	EG436467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436467 MGI:3646773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100043322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins

name	OTTMUSG00000015124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667567 MGI:3702149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 8 Proteins

name	A430107P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320898 MGI:2444988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213480 MGI:3702133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	LOC100043325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	A730076H11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211027 MGI:2684925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	LOC627777 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	A630038E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219065 MGI:2444676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 2 Proteins

name	EG626545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626545 MGI:3704133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Dad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13135 MGI:101912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105501 MGI:1915938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18348 MGI:1333764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666623 MGI:3643351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	LOC100042642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	5330426L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78285 MGI:1925535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST

name	Oxa1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69089 MGI:1916339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20540 MGI:1337120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68836 MGI:1916086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17387 MGI:101900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65107 MGI:1929480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rem2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140743 MGI:2155260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prmt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27374 MGI:1351645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D14Ertd500e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219072 MGI:1261794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jub (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16475 MGI:1341886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931414P19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74359 MGI:1921609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19173 MGI:1194513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830406J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73902 MGI:1921152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239096 MGI:1928330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56215 MGI:1891824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 3 Proteins pseudo : _no_value

name	1700123O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58248 MGI:1920893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cebpe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110794 MGI:103572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50934 MGI:1355323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 4 Proteins pseudo : _no_value

name	Homez (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239099 MGI:2678023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105651 MGI:2145790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 2 Proteins

name	Bcl2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12050 MGI:108052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pabpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54196 MGI:1859158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59049 MGI:1926225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13644 MGI:105311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140806 MGI:2155888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67272 MGI:2447164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17888 MGI:97255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140781 MGI:2155600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngdn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68966 MGI:1916216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfhx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239102 MGI:2686934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thtpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105663 MGI:2446078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11766 MGI:1328307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jph4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319984 MGI:2443113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dhrs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71412 MGI:1918662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042720 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042621 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265600 GeneID:100042621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins product : similar to T-cell receptor alpha chain V region transcript_id : XM_001478512.1

name	LOC100043319 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265723 GeneID:100043319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043319 transcript_id : XM_001479729.1

name	EG547328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82954146 GeneID:547328 MGI:3645598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG547328 transcript_id : XM_622800.2

name	LOC100043308 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265715 GeneID:100043308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 10 Proteins product : similar to TCR V alpha chain transcript_id : XM_001479692.1

name	LOC328483 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265722 GeneID:328483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins product : similar to T-cell receptor alpha chain V region CTL-F3 precursor transcript_id : XM_283255.7

name	LOC630086 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265720 GeneID:630086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_001479712.1

name	LOC100043322 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265725 GeneID:100043322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to T cell receptor V alpha 8.5 transcript_id : XM_001479731.1

name	OTTMUSG00000015124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397106 GeneID:667567 MGI:3702149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 8 Proteins product : predicted gene, OTTMUSG00000015124, transcript variant 2 transcript_id : XM_994498.1

name	A430107P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801826 GeneID:320898 MGI:2444988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430107P09 gene transcript_id : NM_177288.4

name	LOC100043325 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265727 GeneID:100043325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043325 transcript_id : XM_001479735.1

name	LOC627777 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265711 GeneID:627777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC627777 transcript_id : XM_001479684.1

name	EG626545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397123 GeneID:626545 MGI:3704133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG626545, transcript variant 2 transcript_id : XM_900951.2

name	Dad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351016 GeneID:13135 MGI:101912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defender against cell death 1 transcript_id : NM_010015.3

name	Abhd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527301 GeneID:105501 MGI:1915938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 4 transcript_id : NM_134076.1

name	Olfr49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754931 GeneID:18348 MGI:1333764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 49 transcript_id : NM_010991.1

name	Oxa1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343620 GeneID:69089 MGI:1916339
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidase assembly 1-like transcript_id : NM_026936.2

name	Slc7a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370571 GeneID:20540 MGI:1337120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 transcript_id : NM_011405.3

name	Mrpl52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387454 GeneID:68836 MGI:1916086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L52 transcript_id : NM_026851.2

name	Mmp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982190 GeneID:17387 MGI:101900
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 14 (membrane-inserted) transcript_id : NM_008608.2

name	Lrp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58530883 GeneID:65107 MGI:1929480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low-density lipoprotein receptor-related protein 10 transcript_id : NM_022993.3

name	Rem2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362987 GeneID:140743 MGI:2155260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rad and gem related GTP binding protein 2 transcript_id : NM_080726.3

name	Prmt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802506 GeneID:27374 MGI:1351645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 5 transcript_id : NM_013768.2

name	D14Ertd500e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703915 GeneID:219072 MGI:1261794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 14, ERATO Doi 500, expressed transcript_id : NM_145462.1

name	Jub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802579 GeneID:16475 MGI:1341886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ajuba transcript_id : NM_010590.3

name	4931414P19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130539 GeneID:74359 MGI:1921609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931414P19 gene transcript_id : NM_028890.2

name	Psmb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755203 GeneID:19173 MGI:1194513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 5 transcript_id : NM_011186.1

name	5830406J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803161 GeneID:73902 MGI:1921152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830406J20 gene transcript_id : NM_175204.3

name	Cdh24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054975 GeneID:239096 MGI:1928330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin-like 24 transcript_id : NM_199470.1

name	Acin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963562 GeneID:56215 MGI:1891824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptotic chromatin condensation inducer 1 transcript_id : NM_023190.1

name	Acin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9625005 GeneID:56215 MGI:1891824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptotic chromatin condensation inducer 1 transcript_id : NM_019567.1

name	1700123O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946805 GeneID:58248 MGI:1920893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700123O20 gene transcript_id : NM_021437.1

name	LOC100042676 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265604 GeneID:100042676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to lethal (3) IX-14 CG3953-PA transcript_id : XM_001478627.1

name	Cebpe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369478 GeneID:110794 MGI:103572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCAAT/enhancer binding protein (C/EBP), epsilon transcript_id : NM_207131.1

name	Slc7a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254562 GeneID:50934 MGI:1355323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 transcript_id : NM_016972.2

name	Homez (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301480 GeneID:239099 MGI:2678023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain leucine zipper-encoding gene transcript_id : NM_183174.2

name	Ppp1r3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397162 GeneID:105651 MGI:2145790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 2 Proteins product : protein phosphatase 1, regulatory (inhibitor) subunit 3E transcript_id : XM_993154.1

name	Bcl2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680773 GeneID:12050 MGI:108052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-like 2 transcript_id : NM_007537.1

name	Pabpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506944 GeneID:54196 MGI:1859158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A) binding protein, nuclear 1 transcript_id : NM_019402.1

name	Slc22a17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385256 GeneID:59049 MGI:1926225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 17 transcript_id : NM_021551.3

name	Efs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801691 GeneID:13644 MGI:105311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : embryonal Fyn-associated substrate transcript_id : NM_010112.3

name	Il25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131057 GeneID:140806 MGI:2155888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 25 transcript_id : NM_080729.2

name	Cmtm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365114 GeneID:67272 MGI:2447164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 5 transcript_id : NM_026066.2

name	Myh6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802865 GeneID:17888 MGI:97255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 6, cardiac muscle, alpha transcript_id : NM_010856.3

name	Myh7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131045 GeneID:140781 MGI:2155600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 7, cardiac muscle, beta transcript_id : NM_080728.2

name	Ngdn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037132 GeneID:68966 MGI:1916216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroguidin, EIF4E binding protein transcript_id : NM_026890.1

name	Zfhx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986588 GeneID:239102 MGI:2686934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger homeobox 2 transcript_id : NM_001039198.1

name	Thtpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375828 GeneID:105663 MGI:2446078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thiamine triphosphatase transcript_id : NM_153083.3

name	Ap1g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801694 GeneID:11766 MGI:1328307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-1, gamma 2 subunit transcript_id : NM_007455.2

name	Jph4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254386 GeneID:319984 MGI:2443113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 4 transcript_id : NM_177049.4

name	Jph4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892540 GeneID:319984 MGI:2443113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 4 transcript_id : NM_001003829.2

name	Dhrs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386259 GeneID:71412 MGI:1918662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase member 2 transcript_id : NM_027790.1

name	LOC100042621 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265601 GeneID:100042621
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478562.1

name	EG547328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954147 GeneID:547328 MGI:3645598
definition	codon_start : 1 product : similar to TRAV13-3 protein_id : XP_622800.2

name	LOC100043319 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265724 GeneID:100043319
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479779.1

name	LOC100043308 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265716 GeneID:100043308
definition	codon_start : 1 product : similar to TCR V alpha chain protein_id : XP_001479742.1

name	LOC328483 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:28480975 GeneID:328483
definition	codon_start : 1 product : hypothetical protein protein_id : XP_283255.1

name	EG667765 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667765 MGI:3704132
definition	codon_start : 1 exception : rearrangement required for product

name	EG630061 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:630061 MGI:3648929
definition	codon_start : 1 exception : rearrangement required for product

name	LOC630086 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265721 GeneID:630086
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_001479762.1

name	EG436467 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:436467 MGI:3646773
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043322 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265726 GeneID:100043322
definition	codon_start : 1 product : similar to T cell receptor V alpha 8.5 protein_id : XP_001479781.1

name	OTTMUSG00000015124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397107 GeneID:667567 MGI:3702149
definition	codon_start : 1 product : similar to T cell receptor Va 2.5 isoform 2 protein_id : XP_999592.1

name	A430107P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626020 GeneID:320898 MGI:2444988
definition	codon_start : 1 note : T-cell receptor alpha chain; T cell receptor, variable region product : hypothetical protein LOC320898 protein_id : NP_796262.2

name	OTTMUSG00000015049 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:213480 MGI:3702133
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043325 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265728 GeneID:100043325
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479785.1

name	LOC627777 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265712 GeneID:627777
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479734.1

name	A630038E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:219065 MGI:2444676
definition	codon_start : 1 exception : rearrangement required for product

name	EG626545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954055 GeneID:626545 MGI:3704133
definition	codon_start : 1 product : similar to TRDV5 isoform 2 protein_id : XP_906044.1

name	Dad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753598 CCDS:CCDS27084.1 GeneID:13135 MGI:101912
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] codon_start : 1 product : defender against cell death 1 protein_id : NP_034145.1

name	Abhd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527302 GeneID:105501 MGI:1915938
definition	GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : abhydrolase domain containing 4 protein_id : NP_598837.1

name	Olfr49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754932 CCDS:CCDS27085.1 GeneID:18348 MGI:1333764
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR118-1; GA_x6K02T2QVSB-39745261-39746202 product : olfactory receptor 49 protein_id : NP_035121.1

name	Oxa1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037139 CCDS:CCDS27086.1 GeneID:69089 MGI:1916339
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0051205 - protein insertion into membrane [Evidence IEA] codon_start : 1 product : oxidase assembly 1-like protein_id : NP_081212.1

name	Slc7a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625647 CCDS:CCDS27087.1 GeneID:20540 MGI:1337120
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 protein_id : NP_035535.2

name	Mrpl52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348981 CCDS:CCDS27088.1 GeneID:68836 MGI:1916086
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : mitochondrial ribosomal protein L52 protein_id : NP_081127.1

name	Mmp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982191 GeneID:17387 MGI:101900
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Membrane type 1-MMP; type 1 matrix metalloprotease 14 product : matrix metalloproteinase 14 (membrane-inserted) protein_id : NP_032634.2

name	Lrp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981254 CCDS:CCDS27089.1 GeneID:65107 MGI:1929480
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IDA]; GO:0006869 - lipid transport [Evidence IDA] codon_start : 1 product : low-density lipoprotein receptor-related protein 10 precursor protein_id : NP_075369.2

name	Rem2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18141557 CCDS:CCDS27090.1 GeneID:140743 MGI:2155260
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : rad and gem related GTP binding protein 2 protein_id : NP_542764.1

name	Prmt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28395025 CCDS:CCDS27091.1 GeneID:27374 MGI:1351645
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0008469 - histone-arginine N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0035246 - peptidyl-arginine N-methylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Jak-binding protein 1; SKB1 homolog product : protein arginine N-methyltransferase 5 protein_id : NP_038796.1

name	D14Ertd500e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703916 CCDS:CCDS27092.1 GeneID:219072 MGI:1261794
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC219072 protein_id : NP_663437.1

name	Jub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981662 CCDS:CCDS27093.1 GeneID:16475 MGI:1341886
definition	GO_component : GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0048041 - focal adhesion formation [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IMP]; GO:0030334 - regulation of cell migration [Evidence IDA] [Evidence IMP]; GO:0043087 - regulation of GTPase activity [Evidence IMP]; GO:0035313 - wound healing, spreading of epidermal cells [Evidence IMP] codon_start : 1 product : ajuba protein_id : NP_034720.2

name	4931414P19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077031 CCDS:CCDS27094.1 GeneID:74359 MGI:1921609
definition	codon_start : 1 product : hypothetical protein LOC74359 protein_id : NP_083166.1

name	Psmb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755204 CCDS:CCDS27095.1 GeneID:19173 MGI:1194513
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004263 - chymotrypsin activity [Evidence IDA]; GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0043161 - proteasomal ubiquitin-dependent protein catabolism [Evidence IDA]; GO:0006979 - response to oxidative stress [Evidence IDA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : proteasome beta type subunit 5 product : proteasome (prosome, macropain) subunit, beta type 5 protein_id : NP_035316.1

name	5830406J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424826 GeneID:73902 MGI:1921152
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73902 protein_id : NP_780413.1

name	Cdh24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054976 GeneID:239096 MGI:1928330
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005911 - intercellular junction [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : EY-cadherin; cadherin 14-like product : cadherin-like 24 protein_id : NP_955764.1

name	Acin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963563 CCDS:CCDS27097.1 GeneID:56215 MGI:1891824
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030263 - apoptotic chromosome condensation [Evidence ISS]; GO:0008632 - apoptotic program [Evidence ISS]; GO:0030218 - erythrocyte differentiation [Evidence ISS]; GO:0045657 - positive regulation of monocyte differentiation [Evidence ISS] codon_start : 1 exception : mismatches in translation function : involved in apoptotic chromatin condensation note : isoform 2 is encoded by transcript variant 2; apoptotic chromatin condensation inducer in the nucleus product : apoptotic chromatin condensation inducer 1 isoform 2 protein_id : NP_075679.1

name	Acin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625006 CCDS:CCDS27098.1 GeneID:56215 MGI:1891824
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence ISS]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030263 - apoptotic chromosome condensation [Evidence ISS]; GO:0008632 - apoptotic program [Evidence ISS]; GO:0030218 - erythrocyte differentiation [Evidence ISS]; GO:0045657 - positive regulation of monocyte differentiation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; apoptotic chromatin condensation inducer in the nucleus product : apoptotic chromatin condensation inducer 1 isoform 1 protein_id : NP_062513.1

name	1700123O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946806 CCDS:CCDS27099.1 GeneID:58248 MGI:1920893
definition	codon_start : 1 product : hypothetical protein LOC58248 protein_id : NP_067412.1

name	LOC100042676 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265605 GeneID:100042676
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478677.1

name	Cebpe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369479 CCDS:CCDS27100.1 GeneID:110794 MGI:103572
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0042089 - cytokine biosynthesis [Evidence IMP]; GO:0042742 - defense response to bacterium [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence IMP]; GO:0006909 - phagocytosis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : C/EBP-related protein 1; C/EBPepsilon product : CCAAT/enhancer binding protein epsilon protein_id : NP_997014.1

name	Slc7a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394325 CCDS:CCDS27101.1 GeneID:50934 MGI:1355323
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0015359 - amino acid permease activity [Evidence IEA]; GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence ISS]; GO:0015179 - L-amino acid transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence ISS]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 8 (cationic amino acid transporter, y+ system), member 7 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 protein_id : NP_058668.1

name	Homez (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301481 CCDS:CCDS27102.1 GeneID:239099 MGI:2678023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeodomain leucine zipper-encoding protein_id : NP_898997.2

name	Ppp1r3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397163 GeneID:105651 MGI:2145790
definition	codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 3E protein_id : XP_998248.1

name	Bcl2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680774 CCDS:CCDS27103.1 GeneID:12050 MGI:108052
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IDA] codon_start : 1 product : Bcl2-like 2 protein_id : NP_031563.1

name	Pabpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506945 CCDS:CCDS27104.1 GeneID:54196 MGI:1859158
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008143 - poly(A) binding [Evidence TAS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006378 - mRNA polyadenylation [Evidence TAS]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : poly(A) binding protein II product : poly(A) binding protein, nuclear 1 protein_id : NP_062275.1

name	Slc22a17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999479 GeneID:59049 MGI:1926225
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : organic cation transporter BOCT; 24p3 receptor product : solute carrier family 22 (organic cation transporter), member 17 protein_id : NP_067526.2

name	Efs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981787 GeneID:13644 MGI:105311
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : embryonal Fyn-associated substrate protein_id : NP_034242.2

name	Il25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18141561 GeneID:140806 MGI:2155888
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0030380 - interleukin-17E receptor binding [Evidence ISS] GO_process : GO:0030222 - eosinophil differentiation [Evidence IDA]; GO:0006954 - inflammatory response [Evidence IDA] [Evidence IMP]; GO:0009620 - response to fungus [Evidence IDA]; GO:0009624 - response to nematode [Evidence IDA] codon_start : 1 product : interleukin 17E protein_id : NP_542767.1

name	Cmtm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21617843 CCDS:CCDS27105.1 GeneID:67272 MGI:2447164
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : chemokine-like factor super family five variant 4; chemokine-like factor super family 5 product : chemokine-like factor superfamily 5 protein_id : NP_080342.1

name	Myh6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754774 GeneID:17888 MGI:97255
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA]; GO:0005863 - striated muscle thick filament [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007512 - adult heart development [Evidence IMP]; GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0002027 - cardiac chronotropy [Evidence IMP]; GO:0002026 - cardiac inotropy [Evidence IMP]; GO:0048739 - cardiac muscle fiber development [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0045214 - sarcomere organization [Evidence IMP]; GO:0006941 - striated muscle contraction [Evidence IMP] [Evidence IEA]; GO:0007522 - visceral muscle development [Evidence IMP] codon_start : 1 note : myosin heavy chain, cardiac muscle, adult; alpha myosin; alpha cardiac MHC; cardiomyopathy, hypertrophic 1 product : myosin, heavy polypeptide 6, cardiac muscle, alpha protein_id : NP_034986.1

name	Myh7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18859641 CCDS:CCDS27106.1 GeneID:140781 MGI:2155600
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin heavy chain, cardiac muscle, fetal; cardiac myosin heavy chain beta product : myosin, heavy polypeptide 7, cardiac muscle, beta protein_id : NP_542766.1

name	Ngdn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037133 GeneID:68966 MGI:1916216
definition	codon_start : 1 product : neuroguidin, EIF4E binding protein protein_id : NP_081166.1

name	Zfhx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986589 CCDS:CCDS27107.1 GeneID:239102 MGI:2686934
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger homeobox 2 protein_id : NP_001034287.1

name	Thtpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346499 CCDS:CCDS27108.1 GeneID:105663 MGI:2446078
definition	EC_number : 3.6.1.28 GO_function : GO:0004016 - adenylate cyclase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] [Evidence ISS]; GO:0050333 - thiamin-triphosphatase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006171 - cAMP biosynthesis [Evidence IEA]; GO:0006091 - generation of precursor metabolites and energy [Evidence ISS]; GO:0006772 - thiamin metabolism [Evidence ISS] [Evidence IEA] codon_start : 1 product : thiamine triphosphatase protein_id : NP_694723.1

name	Ap1g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671555 GeneID:11766 MGI:1328307
definition	EC_number : 3.6.1.28 GO_component : GO:0030121 - AP-1 adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS]; GO:0005798 - Golgi-associated vesicle [Evidence ISS]; GO:0016020 - membrane [Evidence ISS]; GO:0030133 - transport vesicle [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : gamma 2-adaptin product : adaptor protein complex AP-1, gamma 2 subunit protein_id : NP_031481.1

name	Jph4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982212 CCDS:CCDS27109.1 GeneID:319984 MGI:2443113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant a product : junctophilin 4 isoform a protein_id : NP_796023.2

name	Jph4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491827 GeneID:319984 MGI:2443113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant b product : junctophilin 4 isoform b protein_id : NP_001003829.1

name	Dhrs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386260 CCDS:CCDS27110.1 GeneID:71412 MGI:1918662
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dehydrogenase/reductase member 2 protein_id : NP_082066.1

name	EG666623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666623
definition	number : 1 pseudo : _no_value

name	LOC100042642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042642
definition	number : 1 pseudo : _no_value

name	LOC100042642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042642
definition	number : 2 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 1 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 2 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 3 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 4 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 5 pseudo : _no_value

name	LOC667938 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667938
definition	number : 6 pseudo : _no_value

name	LOC100042720 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042720
definition	number : 1 pseudo : _no_value

name	EG667765 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins standard_name : EG667765

name	EG630061 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:630061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA standard_name : EG630061

name	EG436467 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:436467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs standard_name : EG436467

name	OTTMUSG00000015049 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:213480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins standard_name : OTTMUSG00000015049

name	A630038E17Rik (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:219065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 2 Proteins standard_name : A630038E17Rik

name	A730076H11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265719 GeneID:211027 MGI:2684925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : RIKEN cDNA A730076H11 gene transcript_id : XR_034339.1

name	LOC667819 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265602 GeneID:667819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to hCG26831 pseudo : _no_value transcript_id : XR_033747.1

name	5330426L24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265731 GeneID:78285 MGI:1925535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST product : RIKEN cDNA 5330426L24 gene transcript_id : XR_035439.1

name	LOC667711 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265734 GeneID:667711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 3 Proteins product : similar to hCG24487 pseudo : _no_value transcript_id : XR_034438.1

name	LOC667893 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265606 GeneID:667893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 4 Proteins product : similar to interferon-inducible protein 16 pseudo : _no_value transcript_id : XR_033805.1

clone name	MSMg01-504E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-278K12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-191I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-123K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122M15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-484I17.T7 (MSMg01no484_i17.b1)	MSMg01-484I17.TJ (MSMg01no484_i17.g1)
ACC	AG564205	AG564206
length	746	1,523
length of high quality (start - end)	246 (80 - 325)	---
definition	CHROMAT_FILE: MSMg01no484_i17.b1 PHD_FILE: MSMg01no484_i17.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:06:09 2005	CHROMAT_FILE: MSMg01no484_i17.g1 PHD_FILE: MSMg01no484_i17.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:06:09 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NCCCACCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTCAAGAGGAG CCGCGGAATTCCAGGCTTTCCAGAACAAGATGGTAAGACCTTGTATAAAA TAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAAA TAAAATAAAATAAAATACCATAAACACAATTGGTACTAATTATCTTATAT AAGTTCCAGAAGCCAAAAACAATTCAAGTTTCTTCAGGACTTTCCTGAGC CTTACTAGAATATTCTAGATCAGACCTGTCTGACATCAACCATCCCTGAA GAACTGGAGAGATGGCTTGGCAGTTAGCTTTGACTGCTTTTCCAGAGGAC CCAGGTTCCACTCTCAACATTCACATGGCAGTTCATAATTCTGTCACTTC ATTCCTTGGGGGATATGTCCCTGTCTGGCCTCCAATGTCACCGCATGCAT GTGGTATACAGACATATATGCAGGCAATACTTCATTACATATAAAAGAAA ATTTATAGAAGTAAATTAAAGGGCACTGGAGTAGTGCAGTATCTCTTCTT TCTACCATGAAATGTGTTAAAAACATTCCTAAAAATGAAAATTTTAAAAT TCACTTACAAAGGGGGGGGGGGCATGCACAATAGCAGGCTGGGGGGGGGC ATAGCTTGCCCCCCCTTAAAATTGGGGAACCCAAAGGAAAAAGGGGGGAA ACCAAAATTTCCTCTGCCCTTAAAAGGGGGTTCCACGGACACCAAA	TCTTCTTGCGAATTAGTGCTCTGCCACATCATTTGGTGCGGCGGAGAGCC GCCATTACCTTCTCCATCCCACGCGTGATGAGTGCTACGAGCACACGATG AAGTCCGCTGTAGTCACTGACTGATAATTTGTTAGCTCACGTTATTCGAC GTCATTAGACGGCGAGGCAGTAGTTAGGGCAAGTGTAATTTTGCGTCANA CCATATGCGCAGTCTCTCGCGACACTACTCACTCAGTACTAGTTATAGAG AATAGAGTACTCTCATAATAACGCACTATATATAGCCTTACTCGGCGCTA GCTCGATCGCGAGGCCCATCTGAAGCGAGTACTCAAGGCCGACAGTGCAG CGTACGACACGTCATCATCATACCAGCGAGCACATAGACGAGGGAAGTCT AGACGGGAGAGAACGTGGTCGAGCGAACCGCTTGATCGTGAAGCGTTAAG AGCGCTATATTATCATTCATATGTAGTTCACGCTACGTTTCATGCGTGTG ATACTGTCGACACATACCGCTGCCTCTCATGGCGCGTCTGACTTCGCGAT GACCTGAGGACTTTTAAGCAGCGCATCGTAACGTACTTAGTGCCGTGTAA CTCGTATATGTCGTGTAAGTGCATGGTCTAACGGACGTGGAAATTCGTCG CGTAGTGAACCGTGTGCGACGAGCACGANATATAACCCGTGTACGACCTN ANTGGTCGCGCGCTTGATATCGTTAAGCAAGCGATCTATCATCTGTAGCT ACTCCACACCACATTTACGCTCTGGTGTAGTCTGACNCCGCGACTTGGTA TCGCGGCGCGGCGTCTGCGAGCGTCTGCGCTGTCCAAGTTCTCGATGCCG CTACANGTTNGTTTATCGATATTTATAGGAAGGCACACGCTGTTACAAGC TCACATCATTCAGATCCGCGCTAGTTTGTGCTTTGCGGCCCGACGTCAAT CTAGTTATGTATACGCGGTAAGACTCGCTGTGGATGCGCGCAGACCCACC TCGTTATTGAGCTACCATCTCCACTCATCGACGTCCATTTCATCTGTTTC ACTATTATTACTACCTCGTATGCTCACTCACTGCTGACGCGCCTGTCCGT CTGCATCGCGACGCCCTGCCCGCCTCGTTGCAGCGCGTTACTTATTATAA GGCCGTAGTAGCGCGGACGCGAGTCGGAGCCCGTAGAACGCAGAGCGTGC GCGTTACGGCGCACGTGACTGATCTACGTTGATACATTCACCGTCGCGAT CTACGAGCATATGACGCTGTCTCATCTCCTCAGAGAANGCGCGNTACTCT CATACATCTTCATCTCACGTGAGTGGTATGCGCGTGATGCGTGACTACCG CTGTCGCCGCGAACGATCTATCGTAGTAGTCGTGTATGTACGCTGTGCAC ACTACCAANCTAGAGATGAATAGAGGAGTACGTGACGACACGCTGCCAGC GGCATTGCNTACACGAGACTATAGTGACGACGATGTACGCTGTGANTCTA CGCGTATCGCGAGCCGTGCGCAN
quality values	Open. Hide. 0 3 7 6 6 8 12 16 12 10 10 10 12 14 24 34 39 39 39 37 34 37 37 30 26 24 25 30 30 41 41 28 22 21 19 15 9 11 6 6 6 7 7 6 10 10 10 10 10 10 10 10 12 33 33 31 31 31 31 33 33 33 21 21 9 9 9 9 6 6 6 6 6 8 8 8 8 8 10 14 21 22 28 41 50 50 53 53 53 53 53 59 57 57 57 57 59 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 54 43 43 28 23 23 23 24 24 19 16 19 21 24 32 43 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 51 51 50 50 68 68 68 68 68 68 68 57 57 50 54 54 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 50 50 53 53 53 57 59 59 59 59 59 59 59 59 59 50 50 50 34 27 15 11 11 12 12 15 22 30 26 59 50 50 50 50 53 53 57 57 57 57 57 59 59 59 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 57 57 53 53 53 50 57 57 53 53 50 59 57 59 47 47 47 47 47 41 48 50 50 42 39 39 35 20 17 9 6 6 6 6 7 6 10 10 11 22 30 59 59 59 59 44 53 47 47 47 50 57 57 48 48 43 44 43 57 57 59 53 53 53 53 53 47 44 43 37 33 30 30 30 37 37 41 41 41 41 39 36 36 44 44 44 41 41 41 42 50 50 59 59 59 59 59 48 48 48 48 46 42 42 39 39 39 39 41 32 18 11 11 11 11 17 22 15 20 20 34 34 41 34 39 27 31 25 28 28 39 34 31 29 29 34 29 31 34 32 37 36 36 37 37 31 34 41 43 47 47 46 39 39 36 36 31 25 20 22 12 19 19 21 12 14 12 18 18 31 28 32 32 37 34 37 35 31 31 28 24 24 28 30 33 21 21 13 13 13 12 15 10 10 10 13 11 10 10 11 8 8 10 14 16 17 20 20 11 10 10 10 10 11 10 10 11 8 8 8 8 8 8 20 31 25 16 11 9 9 9 9 10 11 9 9 9 10 11 11 12 17 12 11 11 11 16 11 14 10 13 11 12 9 10 8 8 8 8 7 6 9 10 11 13 11 9 10 9 9 8 8 8 8 8 8 10 8 8 9 9 11 11 10 11 10 13 10 10 8 8 10 16 8 8 6 6 6 6 8 8 9 9 8 8 10 9 11 10 8 8 8 8 8 8 12 16 17 25 14 14 14 11 11 9 9 8 8 9 9 8 8 8 6 6 6 6 6 6 8 8 8 8 8 8 8 8 13 14 16 12 19 19 9 9 9 9 9 9 8 8 8 8 8 8 10 11 12 9 10 16 11 11 6 6 6 6 6 6 10 10 10 10 10 10 12 12 11 11 10 10 10 11 13 19 14 15 15 19 26 21 17 14 13 10 9 9 9 9 12 11 14 14 14 10 10 10 10 11 11 11 11 12 14 8 8 8 6 7 7 7 9 10 16 8 8 8 8 8 8 8 8 6 6 7 6 7 7 8 8 8	Open. Hide. 6 8 8 8 7 7 6 6 8 8 10 10 8 10 6 6 8 6 11 9 8 8 8 8 8 8 8 8 9 9 9 12 14 11 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 9 9 9 9 8 10 10 10 10 6 6 6 7 11 8 8 8 8 8 10 11 11 10 10 10 10 6 6 6 6 8 8 8 8 8 8 6 6 8 8 15 18 12 11 8 8 8 8 8 10 6 6 6 6 8 8 8 8 8 8 7 6 6 6 8 8 8 8 8 8 8 8 8 8 8 10 6 8 6 6 8 8 8 6 6 8 8 6 6 6 6 8 8 8 8 6 6 6 6 10 10 8 8 6 6 8 6 8 8 8 8 8 8 6 6 8 6 6 8 6 9 9 9 9 12 6 6 6 6 6 6 8 12 9 9 8 8 6 6 8 8 8 3 0 3 10 6 6 6 6 8 6 9 9 9 9 8 8 8 8 8 8 10 6 6 6 6 6 6 8 8 8 8 8 8 11 8 9 6 6 6 6 6 8 8 8 6 6 6 6 8 8 6 6 7 9 10 11 9 9 7 6 8 6 8 6 6 7 8 8 8 8 8 8 8 8 8 8 8 10 8 8 7 6 8 8 10 10 10 10 10 11 10 9 9 8 10 8 8 6 6 6 6 8 8 8 8 8 8 9 9 10 10 8 11 11 8 8 8 9 8 10 8 8 8 8 6 7 8 6 6 6 8 9 8 8 8 8 8 10 7 10 7 6 8 8 8 8 8 8 8 8 7 6 7 6 8 8 8 8 8 8 8 8 8 8 10 8 6 6 6 6 6 6 8 8 8 8 8 8 8 8 6 6 8 6 8 8 8 9 8 8 8 8 8 8 8 7 6 6 8 6 6 6 6 8 6 9 9 6 6 6 6 8 6 7 7 6 6 8 8 9 9 9 10 10 10 9 10 6 6 6 6 8 8 6 8 6 6 8 6 8 8 8 8 8 8 8 10 8 8 8 8 6 6 6 8 8 8 8 10 7 7 8 8 8 8 6 6 6 6 8 6 8 8 6 6 7 8 8 8 8 8 8 8 6 6 6 6 6 6 8 8 9 9 9 9 11 10 10 8 6 8 6 6 6 8 6 6 6 7 8 10 8 8 8 8 10 10 10 8 9 9 9 9 8 8 8 6 6 6 6 6 6 6 6 8 8 6 8 6 6 8 8 8 10 10 12 13 10 9 9 10 10 8 8 6 6 8 8 10 13 14 14 13 13 11 8 8 10 10 8 8 8 8 8 8 8 9 10 8 8 6 6 6 8 9 9 10 11 11 8 8 6 7 7 10 10 10 10 9 9 9 10 8 8 12 10 8 8 8 8 8 9 8 6 8 6 6 6 8 10 6 8 6 6 9 8 7 8 8 8 10 10 9 9 8 8 8 8 8 8 10 10 8 8 8 6 6 8 10 6 6 8 8 6 6 6 8 8 8 8 8 8 8 8 10 17 10 14 10 10 8 8 6 6 6 6 6 7 6 8 3 0 3 8 8 8 8 8 8 8 8 10 10 10 8 8 8 8 8 8 8 3 0 3 0 3 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 8 8 8 8 10 12 15 10 10 8 8 8 6 8 6 6 11 10 10 10 9 9 10 8 10 10 10 8 8 6 6 8 10 8 8 8 8 8 8 10 8 8 7 7 7 10 10 10 9 9 9 13 8 8 6 6 8 6 8 8 3 0 3 6 6 6 7 6 8 8 10 8 6 6 8 8 6 6 6 6 6 6 13 10 13 10 10 10 7 6 6 7 7 10 10 6 6 6 6 8 8 10 6 6 6 6 8 8 10 6 6 8 6 8 6 8 6 6 8 8 21 11 11 9 9 9 10 10 10 3 0 3 8 3 0 3 6 8 8 8 8 8 8 8 10 8 8 10 8 8 8 6 6 8 8 6 6 10 11 9 9 10 9 9 12 10 8 8 8 8 8 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 8 6 6 8 8 10 10 8 8 8 8 8 8 8 8 8 6 6 6 6 6 8 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 10 10 10 10 10 8 8 6 6 6 6 8 8 8 8 8 8 8 8 9 9 8 8 8 8 8 8 6 6 6 6 6 6 11 12 12 12 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 8 6 8 10 10 8 8 8 8 8 10 10 10 10 11 10 9 9 8 8 8 8 10 8 8 8 8 8 8 8 9 10 8 10 9 9 10 9 10 10 8 8 8 8 8 8 8 6 6 6 6 8 8 6 6 6 6 7 10 10 8 6 6 7 6 6 8 8 8 8 8 6 6 6 6 6 6 7 6 8 8 7 11 6 6 6 8 6 6 8 8 8 8 8 8 8 8 6 6 6 8 6 8 8 8 8 8 8 9 10 10 10 9 8 10 8 8 8 8 10 10 10 7 6 8 6 7 6 6 6 6 6 6 8 6 6 6 6 7 8 8 6 6 6 8 8 8 8 8 8 8 8 9 9 10 10 10 9 9 9 8 8 8 8 8 8 8 8 8 9 12 10 9 9 9 9 9 11 11 6 6 6 6 6 6 8 8 9 6 6 6 7 6 6 6 8 8 6 6 6 8 6 6 6 8 6 10 9 9 8 8 8 10 8 8 6 6 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 8 8 14 14 12 11 10 7 7 6 6 3 0 3 6 6 6 3 0 3 10 8 7 9 9 8 8 6 6 6 8 6 8 8 6 6 6 6 6 6 6 6 6 8 6 8 6 8 13 10 11 10 8 8 8 8 8 8 9 9 9 10 10 10 6 6 8 8 8 8 6 6 6 8 8 6 6 8 10 13 14 8 8 8 8 8 8 6 6 8 6 7 8 8 11 12 10 6 6 6 6 8 6 6 6 6 6 8 8 8 8 8 8 10 10 8 6 6 6 6 6 6 8 8 8 6 6 8 6 8 6 6 3 0 3 6 6 6 8 8 11 11 8 10 8 8 11 8 8 8 6 6 6 6 8 9 10 10 15 8 8 6 6 6 6 8 8 8 8 6 8 6 6 12 8 9 9 9 11 6 6 6 3 0 3 16 8 8 8 8 8 6 6 6 6 6 8 8 7 9 7 8 6 8 8 8 10 10 10 10 8 6 6 8 8 8 8 8 8 3 0 3 10 9 9 9 9 10 10 9 9 9 9 9 9 9 9 9 9 9 9 9 6 6 6 6 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no484_i17.b1 MSMg01no484_i17.b1 CHROMAT_FILE:
MSMg01no484_i17.b1 PHD_FILE: MSMg01no484_i17.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:06:09 2005
         (246 letters)



>mm_chr14_54940529_54941174
          Length = 646

 Score =  445 bits (230), Expect = e-129
 Identities = 245/256 (95%), Gaps = 10/256 (3%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggtaagaccttgt----------ataaaataaaataaaataaaataaaataaaataaa 50
           |||||||||||||||          |||||||||||||||||||||||||||||||||||
Sbjct: 544 atggtaagaccttgtataaaataaaataaaataaaataaaataaaataaaataaaataaa 485

                                                                       
Query: 51  ataaaataaaataaaataaaataaaataaaataaaataccataaacacaattggtactaa 110
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 484 ataaaataaaataaaataaaataaaataaaataaaataccataaacacaattggtactaa 425

                                                                       
Query: 111 ttatcttatataagttccagaagccaaaaacaattcaagtttcttcaggactttcctgag 170
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 424 ttatcttatataagttccagaagccaaaaacaattcaagtttcttcaggactttcctgag 365

                                                                       
Query: 171 ccttactagaatattctagatcagacctgtctgacatcaaccatccctgaagaactggag 230
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 364 ccttactagaagattctagatcagacctgtctgacatcaaccatccctgaagaactggag 305

                           
Query: 231 agatggcttggcagtt 246
           ||||||||||||||||
Sbjct: 304 agatggcttggcagtt 289


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 48
Number of extensions: 22
Number of successful extensions: 21
Number of sequences better than 10.0: 1
Number of HSP's gapped: 17
Number of HSP's successfully gapped: 1
Length of query: 246
Length of database: 646
Length adjustment: 9
Effective length of query: 237
Effective length of database: 637
Effective search space:   150969
Effective search space used:   150969
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information