MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-072F19
Chromosome	15 (Build37)
Map Location	74,551,337 - 74,552,399
singlet/doublet	singlet
Overlap gene	4930572J05Rik
Upstream gene	pPtp4a3, Gm628, LOC100041273, EG625276, LOC100040966, EG666113, LOC100041307, LOC100040984, Bai1, 1700016M24Rik, Arc, Jrk, 4933427E11Rik, Psca
Downstream gene	Slurp1, Lypd2, 2300005B03Rik, Lynx1, Ly6d, D730001G18Rik, Ly6k, Gml, Hemt1, Cyp11b1, Cyp11b2, 2010109I03Rik, LOC625653, Ly6e, Ly6i, LOC666240, LOC100041528, Ly6a, Ly6c, LOC546642, EG625737, LOC100041546, I830127L07Rik, LOC100041070, LOC546644, LOC100041087, BC025446, LOC100041092, Ly6f, LOC100041652, LOC100041107, 9030619P08Rik, Ly6h, Gpihbp1, Zfp41, 2810039B14Rik, Top1mt, Rhpn1
Link	Open Mouse BAC browser

Click to get alignment info.

name	pPtp4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19245 MGI:1277098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm628 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268816 MGI:2685474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 225 ESTs, 4 Proteins

name	EG625276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625276 MGI:3647277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG666113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666113 MGI:3646370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 164 ESTs, 9 Proteins

name	LOC100041307 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 902 ESTs, 23 Proteins

name	LOC100040984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Bai1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107831 MGI:1933736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69439 MGI:1916689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 2 Proteins

name	Arc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11838 MGI:88067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16469 MGI:106214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933427E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66769 MGI:1914019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 5 ESTs

name	Psca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72373 MGI:1919623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930572J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223626 MGI:1925301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slurp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57277 MGI:1930923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lypd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68311 MGI:1915561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2300005B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69462 MGI:1916712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lynx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23936 MGI:1345180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17068 MGI:96881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D730001G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78725 MGI:1925975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76486 MGI:1923736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625599 MGI:3644767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Hemt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15202 MGI:1341831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp11b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110115 MGI:88583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp11b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13072 MGI:88584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010109I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67038 MGI:1914288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625653 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ly6e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17069 MGI:106651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57248 MGI:1888480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666240 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	LOC100041528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ly6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110454 MGI:107527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17067 MGI:96882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG625737 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625737 MGI:3647407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 110 ESTs, 12 Proteins

name	I830127L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546643 MGI:3612406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 12 Proteins

name	LOC100041070 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC546644 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100041087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	BC025446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223631 MGI:2385015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041092 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Ly6f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17071 MGI:109441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	9030619P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105892 MGI:3612405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23934 MGI:1346030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpihbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68453 MGI:1915703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22701 MGI:99186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2810039B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72665 MGI:1919915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	Top1mt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72960 MGI:1920210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14787 MGI:1098783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	pPtp4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543526 GeneID:19245 MGI:1277098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase 4a3 transcript_id : NM_008975.2

name	Gm628 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803126 GeneID:268816 MGI:2685474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 628, (NCBI) transcript_id : NM_001033365.2

name	LOC100041273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266668 GeneID:100041273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 225 ESTs, 4 Proteins product : similar to NADH dehydrogenase 1 beta subcomplex 4 transcript_id : XM_001476571.1

name	EG625276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398717 GeneID:625276 MGI:3647277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG625276 transcript_id : XM_898698.2

name	EG666113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266670 GeneID:666113 MGI:3646370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 164 ESTs, 9 Proteins product : predicted gene, EG666113 transcript_id : XM_981687.2

name	LOC100041307 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266673 GeneID:100041307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 902 ESTs, 23 Proteins product : similar to high-mobility group box 1 transcript_id : XM_001476607.1

name	LOC100040984 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266644 GeneID:100040984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to T-SNARE domain containing 1 transcript_id : XM_001475612.1

name	Bai1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110032 GeneID:107831 MGI:1933736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1 transcript_id : NM_174991.3

name	1700016M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398720 GeneID:69439 MGI:1916689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 2 Proteins product : RIKEN cDNA 1700016M24 gene transcript_id : XM_128161.5

name	Arc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86604725 GeneID:11838 MGI:88067
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activity regulated cytoskeletal-associated protein transcript_id : NM_018790.2

name	Jrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802891 GeneID:16469 MGI:106214
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jerky transcript_id : NM_008415.4

name	Psca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312315 GeneID:72373 MGI:1919623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostate stem cell antigen transcript_id : NM_028216.1

name	4930572J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348459 GeneID:223626 MGI:1925301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930572J05 gene transcript_id : NM_198607.1

name	Slurp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048457 GeneID:57277 MGI:1930923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted Ly6/Plaur domain containing 1 transcript_id : NM_020519.1

name	Lypd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625682 GeneID:68311 MGI:1915561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/Plaur domain containing 2 transcript_id : NM_026671.1

name	2300005B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517475 GeneID:69462 MGI:1916712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2300005B03 gene transcript_id : NM_001081961.1

name	Lynx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802112 GeneID:23936 MGI:1345180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/neurotoxin 1 transcript_id : NM_011838.3

name	Ly6d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754583 GeneID:17068 MGI:96881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus D transcript_id : NM_010742.1

name	D730001G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367552 GeneID:78725 MGI:1925975
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D730001G18 gene transcript_id : NM_172433.2

name	Ly6k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54144476 GeneID:76486 MGI:1923736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus K transcript_id : NM_029627.1

name	Gml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266681 GeneID:625599 MGI:3644767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : GPI anchored molecule like protein, transcript variant 1 transcript_id : XM_001476885.1

name	Gml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266683 GeneID:625599 MGI:3644767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : GPI anchored molecule like protein, transcript variant 2 transcript_id : XM_001476898.1

name	Hemt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662775 GeneID:15202 MGI:1341831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic cell transcript 1 transcript_id : NM_010416.2

name	Cyp11b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803200 GeneID:110115 MGI:88583
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 11, subfamily b, polypeptide 1 transcript_id : NM_001033229.2

name	Cyp11b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845247 GeneID:13072 MGI:88584
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 11, subfamily b, polypeptide 2 transcript_id : NM_009991.2

name	2010109I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842381 GeneID:67038 MGI:1914288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010109I03 gene transcript_id : NM_025929.2

name	Ly6e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982210 GeneID:17069 MGI:106651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus E transcript_id : NM_008529.2

name	Ly6i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21356650 GeneID:57248 MGI:1888480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus I transcript_id : NM_020498.1

name	LOC100041528 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266690 GeneID:100041528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100041528 transcript_id : XM_001477057.1

name	Ly6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981636 GeneID:110454 MGI:107527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus A transcript_id : NM_010738.2

name	Ly6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331141 GeneID:17067 MGI:96882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus C transcript_id : NM_010741.2

name	EG625737 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398723 GeneID:625737 MGI:3647407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG625737 transcript_id : XM_898914.2

name	LOC100041546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266694 GeneID:100041546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 109 ESTs, 12 Proteins product : similar to Lymphocyte antigen 6C precursor (Ly-6C), transcript variant 2 transcript_id : XM_001477088.1

name	LOC100041546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266692 GeneID:100041546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 106 ESTs, 12 Proteins product : similar to Lymphocyte antigen 6C precursor (Ly-6C), transcript variant 1 transcript_id : XM_001477071.1

name	I830127L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266696 GeneID:546643 MGI:3612406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 12 Proteins product : RIKEN cDNA I830127L07 gene transcript_id : XM_001477102.1

name	LOC100041070 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266652 GeneID:100041070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041070 transcript_id : XM_001475740.1

name	LOC546644 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266654 GeneID:546644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Lymphocyte antigen 6G precursor (Ly-6G) (Ly-6G.1) transcript_id : XM_001475753.1

name	Ly6f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922617 GeneID:17071 MGI:109441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus F transcript_id : NM_008530.2

name	LOC100041107 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266657 GeneID:100041107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CDNA sequence BC025446 transcript_id : XM_001475809.1

name	9030619P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886450 GeneID:105892 MGI:3612405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030619P08 gene transcript_id : NM_001039720.1

name	Ly6h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625648 GeneID:23934 MGI:1346030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus H transcript_id : NM_011837.2

name	Gpihbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037120 GeneID:68453 MGI:1915703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GPI-anchored HDL-binding protein 1 transcript_id : NM_026730.1

name	Zfp41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113462003 GeneID:22701 MGI:99186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 41 transcript_id : NM_011759.2

name	Zfp41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113462001 GeneID:22701 MGI:99186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 41 transcript_id : NM_001044718.1

name	2810039B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266661 GeneID:72665 MGI:1919915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : RIKEN cDNA 2810039B14 gene transcript_id : XM_001475872.1

name	Top1mt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801374 GeneID:72960 MGI:1920210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA topoisomerase 1, mitochondrial transcript_id : NM_028404.2

name	Rhpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680084 GeneID:14787 MGI:1098783
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhophilin, Rho GTPase binding protein 1 transcript_id : NM_008164.1

name	pPtp4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543527 CCDS:CCDS27519.1 GeneID:19245 MGI:1277098
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase 4a3 protein_id : NP_033001.2

name	Gm628 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701862 CCDS:CCDS27520.1 GeneID:268816 MGI:2685474
definition	codon_start : 1 product : hypothetical protein LOC268816 protein_id : NP_001028537.1

name	LOC100041273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266669 GeneID:100041273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476621.1

name	EG625276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957475 GeneID:625276 MGI:3647277
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903791.1

name	EG666113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398719 GeneID:666113 MGI:3646370
definition	codon_start : 1 product : similar to Splicing factor 3b, subunit 4 protein_id : XP_986781.1

name	LOC100041307 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266674 GeneID:100041307
definition	codon_start : 1 product : similar to high-mobility group box 1 protein_id : XP_001476657.1

name	LOC100040984 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266645 GeneID:100040984
definition	codon_start : 1 product : similar to T-SNARE domain containing 1 protein_id : XP_001475662.1

name	Bai1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92110033 GeneID:107831 MGI:1933736
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016525 - negative regulation of angiogenesis [Evidence ISS]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : brain-specific angiogenesis inhibitor 1 protein_id : NP_778156.2

name	1700016M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20902547 GeneID:69439 MGI:1916689
definition	codon_start : 1 product : hypothetical protein LOC69439 protein_id : XP_128161.1

name	Arc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055166 GeneID:11838 MGI:88067
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence TAS] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007492 - endoderm development [Evidence IMP] codon_start : 1 product : activity regulated cytoskeletal-associated protein protein_id : NP_061260.1

name	Jrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543012 CCDS:CCDS27524.1 GeneID:16469 MGI:106214
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA]; GO:0005840 - ribosome [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : jerky protein_id : NP_032441.3

name	Psca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312316 CCDS:CCDS27526.1 GeneID:72373 MGI:1919623
definition	GO_component : GO:0016020 - membrane [Evidence TAS] codon_start : 1 product : prostate stem cell antigen protein_id : NP_082492.1

name	4930572J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348460 CCDS:CCDS27527.1 GeneID:223626 MGI:1925301
definition	codon_start : 1 product : mesenchymal stem cell protein DSCD75 homolog protein_id : NP_941009.1

name	Slurp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048458 CCDS:CCDS27528.1 GeneID:57277 MGI:1930923
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] codon_start : 1 note : secreted Ly-6/uPAR related protein 1 product : Ars component B protein_id : NP_065265.1

name	Lypd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625683 CCDS:CCDS27529.1 GeneID:68311 MGI:1915561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : Ly6/Plaur domain containing 2 protein_id : NP_080947.1

name	2300005B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517476 GeneID:69462 MGI:1916712
definition	codon_start : 1 note : secreted Ly6/uPAR related protein-2 product : secreted Ly6/uPAR related protein 2 protein_id : NP_001075430.1

name	Lynx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106349 CCDS:CCDS27530.1 GeneID:23936 MGI:1345180
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0030550 - acetylcholine receptor inhibitor activity [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0008200 - ion channel inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IC] codon_start : 1 product : Ly6/neurotoxin 1 protein_id : NP_035968.1

name	Ly6d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754584 CCDS:CCDS27531.1 GeneID:17068 MGI:96881
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0030377 - U-plasminogen activator receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus D protein_id : NP_034872.1

name	D730001G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369575 GeneID:78725 MGI:1925975
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC78725 protein_id : NP_766021.1

name	Ly6k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54144477 CCDS:CCDS27532.1 GeneID:76486 MGI:1923736
definition	codon_start : 1 product : lymphocyte antigen 6 complex, locus K protein_id : NP_083903.1

name	Gml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266682 GeneID:625599 MGI:3644767
definition	codon_start : 1 product : similar to HemT-3 protein isoform 1 protein_id : XP_001476935.1

name	Gml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266684 GeneID:625599 MGI:3644767
definition	codon_start : 1 product : similar to HemT-3 protein isoform 2 protein_id : XP_001476948.1

name	Hemt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662776 CCDS:CCDS27534.1 GeneID:15202 MGI:1341831
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hematopoietic cell-specific transcript product : hematopoietic cell transcript 1 protein_id : NP_034546.2

name	Cyp11b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370298 CCDS:CCDS27535.1 GeneID:110115 MGI:88583
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : steroid-11-beta-hydroxylase product : cytochrome P450, family 11, subfamily b, polypeptide 1 protein_id : NP_001028401.1

name	Cyp11b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106287 CCDS:CCDS27536.1 GeneID:13072 MGI:88584
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0047783 - corticosterone 18-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004507 - steroid 11-beta-monooxygenase activity [Evidence IEA] GO_process : GO:0002017 - aldosterone mediated regulation of body fluids [Evidence IMP]; GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0042756 - drinking behavior [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0050801 - ion homeostasis [Evidence IMP]; GO:0001991 - regulation of blood pressure by circulatory renin-angiotensin [Evidence IMP] codon_start : 1 exception : mismatches in translation note : steroid-11-beta-hydroxylase; aldosterone synthase product : cytochrome P450, family 11, subfamily b, polypeptide 2 protein_id : NP_034121.1

name	2010109I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385422 CCDS:CCDS27537.1 GeneID:67038 MGI:1914288
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0009405 - pathogenesis [Evidence IEA] codon_start : 1 product : intectin protein_id : NP_080205.1

name	Ly6e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678748 CCDS:CCDS27538.1 GeneID:17069 MGI:106651
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus E protein_id : NP_032555.1

name	Ly6i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21356651 CCDS:CCDS27539.1 GeneID:57248 MGI:1888480
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lymphocyte antigen 6M protein_id : NP_065244.1

name	LOC100041528 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266691 GeneID:100041528
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477107.1

name	Ly6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754580 CCDS:CCDS27540.1 GeneID:110454 MGI:107527
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus A protein_id : NP_034868.1

name	Ly6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331142 CCDS:CCDS27541.1 GeneID:17067 MGI:96882
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus C protein_id : NP_034871.2

name	EG625737 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957497 GeneID:625737 MGI:3647407
definition	codon_start : 1 product : hypothetical protein protein_id : XP_904007.1

name	LOC100041546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266693 GeneID:100041546
definition	codon_start : 1 product : similar to Lymphocyte antigen 6C precursor (Ly-6C) isoform 1 protein_id : XP_001477121.1

name	LOC100041546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266695 GeneID:100041546
definition	codon_start : 1 product : similar to Lymphocyte antigen 6C precursor (Ly-6C) isoform 2 protein_id : XP_001477138.1

name	I830127L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266697 GeneID:546643 MGI:3612406
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477152.1

name	LOC100041070 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266653 GeneID:100041070
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475790.1

name	LOC546644 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266655 GeneID:546644
definition	codon_start : 1 product : similar to Lymphocyte antigen 6G precursor (Ly-6G) (Ly-6G.1) protein_id : XP_001475803.1

name	Ly6f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678750 CCDS:CCDS27543.1 GeneID:17071 MGI:109441
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus F protein_id : NP_032556.1

name	LOC100041107 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266658 GeneID:100041107
definition	codon_start : 1 product : similar to CDNA sequence BC025446 protein_id : XP_001475859.1

name	9030619P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89886451 GeneID:105892 MGI:3612405
definition	codon_start : 1 note : LY antigen-like product : RIKEN cDNA 9030619P08 protein_id : NP_001034809.1

name	Ly6h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754586 CCDS:CCDS27544.1 GeneID:23934 MGI:1346030
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus H protein_id : NP_035967.1

name	Gpihbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037121 CCDS:CCDS27545.1 GeneID:68453 MGI:1915703
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0008035 - high-density lipoprotein binding [Evidence IDA] GO_process : GO:0030301 - cholesterol transport [Evidence IDA]; GO:0006869 - lipid transport [Evidence IDA] codon_start : 1 product : GPI-anchored HDL-binding protein 1 protein_id : NP_081006.1

name	Zfp41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113462002 GeneID:22701 MGI:99186
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 41 protein_id : NP_001038183.1

name	Zfp41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563280 GeneID:22701 MGI:99186
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 41 protein_id : NP_035889.1

name	2810039B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266662 GeneID:72665 MGI:1919915
definition	codon_start : 1 product : hypothetical protein LOC72665 protein_id : XP_001475922.1

name	Top1mt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50657345 CCDS:CCDS27547.1 GeneID:72960 MGI:1920210
definition	EC_number : 5.99.1.2 GO_component : GO:0005694 - chromosome [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003918 - DNA topoisomerase (ATP-hydrolyzing) activity [Evidence IEA]; GO:0003917 - DNA topoisomerase type I activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006265 - DNA topological change [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IEA] codon_start : 1 note : mitochondrial topoisomerase I product : DNA topoisomerase 1, mitochondrial protein_id : NP_082680.1

name	Rhpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680085 CCDS:CCDS27548.1 GeneID:14787 MGI:1098783
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IPI] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation function : small GTPase Rho binding protein note : GTP-rho binding protein 1 product : rhophilin, Rho GTPase binding protein 1 protein_id : NP_032190.1

name	LOC100040966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040966
definition	number : 1 pseudo : _no_value

name	LOC100040966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040966
definition	number : 2 pseudo : _no_value

name	LOC100040966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040966
definition	number : 3 pseudo : _no_value

name	LOC625653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625653
definition	number : 1 pseudo : _no_value

name	LOC625653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625653
definition	number : 2 pseudo : _no_value

name	LOC625653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625653
definition	number : 3 pseudo : _no_value

name	LOC546642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546642
definition	number : 1 pseudo : _no_value

name	LOC546642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546642
definition	number : 2 pseudo : _no_value

name	LOC546642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546642
definition	number : 3 pseudo : _no_value

name	LOC100041087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041087
definition	number : 3 pseudo : _no_value

name	LOC100041087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041087
definition	number : 2 pseudo : _no_value

name	LOC100041087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041087
definition	number : 1 pseudo : _no_value

name	LOC100041092 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041092
definition	number : 3 pseudo : _no_value

name	LOC100041092 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041092
definition	number : 2 pseudo : _no_value

name	LOC100041092 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041092
definition	number : 1 pseudo : _no_value

name	LOC100041652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041652
definition	number : 3 pseudo : _no_value

name	LOC100041652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041652
definition	number : 2 pseudo : _no_value

name	LOC100041652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041652
definition	number : 1 pseudo : _no_value

name	4933427E11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266676 GeneID:66769 MGI:1914019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 5 ESTs product : RIKEN cDNA 4933427E11 gene transcript_id : XR_035306.1

name	LOC666240 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266689 GeneID:666240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to suppressor of cytokine signalling-2 pseudo : _no_value transcript_id : XR_033036.1

name	BC025446 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266559 GeneID:223631 MGI:2385015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025446 transcript_id : XR_035099.1

clone name	MSMg01-545J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-520H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417C04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476O22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342P12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518E21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-321B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-264E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323J22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215M24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-072F19.b	B6Ng01-072F19.g
ACC	DH889800	DH889801
length	468	1,045
definition	DH889800\|Mus musculus domesticus DNA, BAC clone: B6Ng01-072F19, 5' end.	DH889801\|Mus musculus domesticus DNA, BAC clone: B6Ng01-072F19, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	tatattccacataatcatgtttcagaggggaaggggaggggaagggggag ggacaggggcaggggagatggttctgttggtgaactgcttgccacacaaa ggatgaagagcgactttgatgcacagtgcccatgtaaagccaagtgtggc acacatctgaaatccctgccctagaaaggcatacaggatgatccctgggt tgctggccagcatgctagttaagtttttgagtttcaggttcagcaagaca ctgtctcttaaaaccatatgtaaagtgactgaagatacacccattgttga ctacaggcccataacagagttctctttgctaatgaggtacctagaggccc tgagggtttcaccaataagcttcccttaccaaacattcttccctgtataa ggtatttattcttcgggccattctgacaggtatggatgtatccattttcc tttattgaacaatcaata	gaattctttggctatgctcatctgagctactgactggatcactagcggga gcaggcttccttgtcactcttgcacctgcagggccgagcgccgtagccag gtggcgctgtactgctcggagcgtcccgccgtgacccgccccgccccgag aaaagcgaaagccgctaacgcagaggacccagactaggccatcgaggacg cgcgcaggggggaaccagtatctgtgcgagctactccagctcacggcgcc gctgcctctggagtactccccctcggactgctggaagagttggtgcgctc cagtcctcggagctcccaggcttcagggccggccggcagcaggcaacctg cgcagcgggctcctggacaccaggtgcccgctgccaagatgctggagctg ttggtggcgtcgttatccctggcgctcgccttctttgcgctgctggacgg ctggtacctggtgcgcgtgccgtgtgctgttctgcgcgcacgcttgctgc agccgcgggtccgcgacttattggcggagcagcggtatgccggccgggtg ctgccatcggacctggacctgctgctacacatgaacaacgcgcgctacct gcgcgaggcggatgtggcgcgcgctgcgcacctgacccgctgcggtgtgc tgggggcgctgcgcgacctgaacgcgcacacggtgctggccgcctcgtgc gcgcgctatcgccgctcgctgcgcctgtttgagccgttcgaggtacacac gcgactgcaaggctgggacgaccgcgccttctacctggaggcgcgttttg tcagccttcgcgatggtttcgtgtgcgccttgctgcgtttccgacagcac gtgctgggcacctcgccggatcgagtagtacagcacttgtgcaaacggag ggtgagcagcccacccgatgcccgccctgtttggctctcagctctcccgc gagaaacccctttgaagtctgggactgttcatgtcgaacattttgcactt tctctgtgtccaaggagtgccttgcttggggtccatcatctatga
quality values	Open. Hide. 61 59 61 59 59 61 59 23 23 61 59 61 61 61 61 59 52 59 59 61 61 52 49 38 23 59 32 36 37 36 55 59 61 59 59 59 61 61 55 59 61 61 61 61 61 61 61 59 55 59 61 49 59 43 59 59 55 30 35 59 43 43 44 25 13 25 9 23 6 8 16 8 12 12 13 20 20 26 24 18 27 43 39 27 24 18 26 23 28 32 32 31 23 10 18 10 10 19 24 34 23 41 44 37 29 35 22 18 49 23 12 12 13 22 18 12 18 20 27 20 27 19 13 23 17 23 12 35 22 32 27 15 29 33 29 19 24 28 27 23 30 11 18 11 7 23 15 37 23 11 15 20 13 18 13 21 22 28 16 8 13 15 16 18 18 18 11 18 23 29 23 23 10 12 18 21 25 13 27 11 13 12 36 23 12 24 20 10 8 18 24 10 13 23 23 12 27 23 22 12 10 13 18 22 22 23 15 19 16 11 12 18 11 13 13 18 23 12 12 12 18 22 12 13 10 10 8 12 23 33 24 27 23 36 20 18 10 22 12 10 17 9 10 28 20 28 25 32 8 29 18 27 23 12 10 6 12 22 9 27 11 27 18 19 23 15 14 12 24 18 13 23 22 26 18 21 27 21 13 18 16 13 12 10 12 24 15 17 11 18 10 12 21 12 24 12 6 8 13 13 15 9 12 8 10 10 23 12 18 13 8 5 18 13 8 12 10 32 15 23 10 8 22 8 12 15 20 24 18 10 25 26 18 17 32 10 19 10 12 8 13 12 18 11 23 12 15 18 13 18 12 15 13 10 22 23 12 15 14 39 36 32 20 10 11 15 23 9 24 25 28 12 11 13 13 12 14 13 10 12 18 13 30 12 17 12 30 12 9 11 11 9 21 20 13 8 13 11 19 15 13 32 11 15 8 8 12 10 8 10 12 23 13 10 12 25 10 18 23 12 12 37 28 24 17 20 10 22 8 18 11 24 28 23 10 10 13 8 10 24 25 7 12 12 12 8 8 6 8 8 12 6 9 11 8 22 20 28 11 12 12 12 10 8 12 10 21 10	Open. Hide. 43 37 50 38 50 52 43 49 43 52 30 41 47 49 55 52 52 49 40 38 52 52 59 59 59 49 52 59 43 52 43 59 43 45 45 59 59 59 59 59 49 49 59 49 49 59 59 59 59 43 59 49 43 37 59 45 59 59 52 59 52 59 59 59 49 43 43 59 59 59 52 59 49 43 52 52 52 59 45 36 38 59 59 39 52 39 59 52 52 52 52 59 45 45 59 39 59 59 49 59 52 59 61 59 52 59 59 59 59 52 52 49 59 61 52 59 59 59 61 61 59 59 59 49 52 52 41 41 52 59 45 49 59 59 59 59 59 45 49 59 52 59 43 52 59 59 59 49 59 59 55 43 49 49 43 38 39 52 59 59 59 52 52 45 52 59 45 59 59 52 59 49 33 59 41 59 59 43 52 52 43 39 59 52 52 52 43 59 45 52 49 59 52 45 45 49 59 59 59 45 59 52 59 59 59 49 52 61 61 61 61 61 61 59 59 59 52 52 59 52 59 59 59 59 59 59 59 49 59 52 59 59 59 61 61 59 59 59 38 36 49 39 49 37 43 59 52 52 59 59 43 59 59 59 59 59 59 59 52 59 59 61 59 49 59 59 59 43 43 52 52 59 52 52 43 49 59 52 52 55 52 55 55 55 52 52 49 61 43 52 55 55 61 52 61 52 41 52 52 52 49 37 33 52 52 52 52 52 43 52 55 49 52 55 52 55 52 52 43 52 49 52 52 52 39 32 55 52 37 52 41 55 43 52 52 55 52 49 43 49 37 28 55 52 43 49 49 52 52 52 49 52 52 49 49 49 52 55 55 55 55 61 55 55 55 50 55 50 49 50 41 43 34 49 32 49 37 38 37 31 50 50 50 49 50 43 43 31 41 25 31 26 26 32 34 50 32 37 49 49 37 43 50 49 43 50 50 43 37 49 50 37 37 49 38 49 37 37 37 43 49 49 31 37 43 50 50 25 31 37 37 34 34 49 49 50 47 40 36 37 43 43 32 43 43 43 52 43 35 50 36 45 50 61 35 45 35 35 35 43 32 24 45 35 31 35 31 35 50 43 43 31 29 50 35 50 35 53 53 35 38 35 35 28 35 31 41 35 43 35 42 31 50 50 50 50 43 50 39 38 32 30 45 50 35 45 35 42 42 39 27 42 24 38 26 37 33 47 47 45 39 47 50 40 31 31 43 52 38 45 45 43 33 38 47 42 42 43 39 32 34 27 43 31 39 39 45 39 45 52 39 34 31 23 27 24 39 42 31 38 52 24 42 42 39 38 52 24 45 45 50 27 32 29 24 30 24 50 39 30 34 47 45 38 32 34 27 34 28 28 28 30 38 42 50 48 40 40 50 45 52 38 30 38 24 43 29 38 26 19 23 32 20 43 42 50 47 30 34 45 40 45 39 39 36 43 45 35 21 34 36 33 52 42 43 31 36 36 27 30 38 33 30 16 32 45 45 30 37 28 30 36 35 37 38 38 26 33 36 39 34 34 23 32 39 42 35 26 30 40 42 34 36 23 35 24 34 38 37 31 32 14 26 24 50 35 38 31 37 20 30 20 22 24 30 40 34 41 50 30 35 41 29 37 30 50 42 38 31 29 17 24 35 33 33 36 41 24 20 19 28 24 11 19 31 33 39 38 42 40 47 47 24 39 37 21 40 35 37 16 50 28 37 22 23 40 32 25 24 28 24 28 14 31 21 28 30 26 12 36 17 25 15 30 53 53 27 18 23 15 29 12 35 37 40 21 21 18 20 31 20 29 31 23 32 53 24 20 33 17 37 13 23 35 23 18 33 36 40 41 20 31 16 9 19 9 7 22 27 24 20 25 29 14 24 27 19 30 27 31 17 15 27 15 18 29 10 29 25 18 18 21 14 34 22 19 11 19 19 16 20 12 6 30 15 34 14 27 14 20 17 19 35 34 39 34 38 29 21 15 20 7 7 22 26 14 11 11 34 30 20 34 21 41 14 20 25 20 21 24 27 19 29 19 29 22 24 25 39 11 21 17 23 18 16 9 12 14 18 17 36 32 14 25 28 17 25 19 20 28 22 18 12 17 18 24 12 23 12 17 32 24 8 12 8 21 24 22 29 11 29 12 11 17 6 26 23 24 18 20 4 6 4 6 22 6 10 12 5 6 14 29 10 16 26 24 5 23 30 9 13 22 9 10 23 20 10 30 14 7 13 26 14 20 10 10 10 10 10 9 4 11 26 7 18 17 16 6 9 13 9 16 35 20 14 6 12 7 7 8 6 8 11 18 13 14 10 4 5 14 8 29 5 12 7 10 5 29 5 5 17 5 6 9 7 17 6 9 27 29 29 9 14 13 7 9 9 13 6 8 5 11 10 6 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_74551337_74552399
seq2: B6Ng01-072F19.g_64_1108

seq1  GAATTCTTTGGCTATGCTCATCTGAGCTACTGACTGGATCACTAGCGGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGGCTATGCTCATCTGAGCTACTGACTGGATCACTAGCGGGA  50

seq1  GCAGGCTTCCTTGTCACTCTTGCACCTGCAGGGCCGAGCGCCGTAGCCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGCTTCCTTGTCACTCTTGCACCTGCAGGGCCGAGCGCCGTAGCCAG  100

seq1  GTGGCGCTGTACTGCTCGGAGCGTCCCGCCGTGACCCGCCCCGCCCCGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCGCTGTACTGCTCGGAGCGTCCCGCCGTGACCCGCCCCGCCCCGAG  150

seq1  AAAAGCGAAAGCCGCTAACGCAGAGGACCCAGACTAGGCCATCGAGGACG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCGAAAGCCGCTAACGCAGAGGACCCAGACTAGGCCATCGAGGACG  200

seq1  CGCGCAGGGGGGAACCAGTATCTGTGCGAGCTACTCCAGCTCACGGCGCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCGCAGGGGGGAACCAGTATCTGTGCGAGCTACTCCAGCTCACGGCGCC  250

seq1  GCTGCCTCTGGAGTACTCCCCCTCGGACTGCTGGAAGAGTTGGTGCGCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCCTCTGGAGTACTCCCCCTCGGACTGCTGGAAGAGTTGGTGCGCTC  300

seq1  CAGTCCTCGGAGCTCCCAGGCTTCAGGGCCGGCCGGCAGCAGGCAACCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCCTCGGAGCTCCCAGGCTTCAGGGCCGGCCGGCAGCAGGCAACCTG  350

seq1  CGCAGCGGGCTCCTGGACACCAGGTGCCCGCTGCCAAGATGCTGGAGCTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCAGCGGGCTCCTGGACACCAGGTGCCCGCTGCCAAGATGCTGGAGCTG  400

seq1  TTGGTGGCGTCGTTATCCCTGGCGCTCGCCTTCTTTGCGCTGCTGGACGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGGCGTCGTTATCCCTGGCGCTCGCCTTCTTTGCGCTGCTGGACGG  450

seq1  CTGGTACCTGGTGCGCGTGCCGTGTGCTGTTCTGCGCGCACGCTTGCTGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTACCTGGTGCGCGTGCCGTGTGCTGTTCTGCGCGCACGCTTGCTGC  500

seq1  AGCCGCGGGTCCGCGACTTATTGGCGGAGCAGCGGTATGCCGGCCGGGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGCGGGTCCGCGACTTATTGGCGGAGCAGCGGTATGCCGGCCGGGTG  550

seq1  CTGCCATCGGACCTGGACCTGCTGCTACACATGAACAACGCGCGCTACCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCATCGGACCTGGACCTGCTGCTACACATGAACAACGCGCGCTACCT  600

seq1  GCGCGAGGCGGATGTGGCGCGCGCTGCGCACCTGACCCGCTGCGGTGTGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCGAGGCGGATGTGGCGCGCGCTGCGCACCTGACCCGCTGCGGTGTGC  650

seq1  TGGGGGCGCTGCGCGACCTGAACGCGCACACGGTGCTGGCCGCCTCGTGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGCGCTGCGCGACCTGAACGCGCACACGGTGCTGGCCGCCTCGTGC  700

seq1  GCGCGCTATCGCCGCTCGCTGCGCCTGTTTGAGCCGTTCGAGGTACACAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCGCTATCGCCGCTCGCTGCGCCTGTTTGAGCCGTTCGAGGTACACAC  750

seq1  GCGACTGCAAGGCTGGGACGACCGCGCCTTCTACCTGGAGGCGCGTTTTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGACTGCAAGGCTGGGACGACCGCGCCTTCTACCTGGAGGCGCGTTTTG  800

seq1  TCAGCCTTCGCGATGGTTTCGTGTGCGCCTTGCTGCGTTTCCGACAGCAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCCTTCGCGATGGTTTCGTGTGCGCCTTGCTGCGTTTCCGACAGCAC  850

seq1  GTGCTGGGCACCTCGCCGGATCGAGTAGTACAGCACTTGTGCAAACGGAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGGGCACCTCGCCGGATCGAGTAGTACAGCACTTGTGCAAACGGAG  900

seq1  GGTGAGCAGCCCCACCCCGATGCCCCGGCCCTGTTTGGCTCTCAGCCCTC  950
      ||||||||||||   ||||||||||  ||||||||||||||||||  |||
seq2  GGTGAGCAGCCC--ACCCGATGCCC--GCCCTGTTTGGCTCTCAG--CTC  944

seq1  TCCCGCGAGAAAAACCCCTTTGAAGTTCTGGGACTGTTCCAATGTCGGAA  1000
      |||||||||  |||||||||||||| |||||||||||||  ||||| |||
seq2  TCCCGCGAG--AAACCCCTTTGAAG-TCTGGGACTGTTC--ATGTC-GAA  988

seq1  CACTTTTGCACGTTTCCTCTGTGTCCAAGGAGTTGCCCTTCTTGGGGTCC  1050
      || ||||||||  || |||||||||||||||| |||| | ||||||||  
seq2  CA-TTTTGCAC--TTTCTCTGTGTCCAAGGAG-TGCCTTGCTTGGGGT--  1032

seq1  CCATCATCTATGA  1063
      |||||||||||||
seq2  CCATCATCTATGA  1045

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information