MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-219G15
Chromosome	15 (Build37)
Map Location	97,403,383 - 97,597,639
singlet/doublet	doublet
Overlap gene	D15Ertd682e, Pp11r, Rapgef3
Upstream gene	Slc38a1, Slc38a2, LOC667941, LOC546651, Slc38a4, Amigo2, BC038822, LOC100043354, LOC100042774
Downstream gene	4930570C03Rik, Hdac7a, Vdr, Tmem106c, Col2a1, Senp1, Pfkm, Asb8, AI836003, Olfr288, LOC634104, EG629524, H1fnt, Zfp641, Olfr285, Olfr284, Olfr283, 1700031M16Rik, LOC100042818, Olfr282, LOC629549, Olfr281, Olfr240-ps1, GA_x5J8B7W76D0-7895713-7896429, Lalba, Olfr234, Olfr278-ps1, 2310037I24Rik, LOC100043418, Ccnt1, 4930415O20Rik, Adcy6, Cacnb3, Ddx23, Rnd1, Ccdc65, Fkbp11, Arf3, 5830427D03Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc38a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105727 MGI:2145895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc38a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67760 MGI:1915010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC546651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Slc38a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69354 MGI:1916604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amigo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105827 MGI:2145995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038822 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239647 MGI:2446270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins pseudo : _no_value

name	LOC100042774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	D15Ertd682e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71919 MGI:1277218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pp11r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19011 MGI:97746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgef3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223864 MGI:2441741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930570C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67739 MGI:1914989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56233 MGI:1891835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vdr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22337 MGI:103076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem106c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380967 MGI:1196384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12824 MGI:88452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Senp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223870 MGI:2445054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18642 MGI:97548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78541 MGI:1925791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI836003 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239650 MGI:2146066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr288 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545140 MGI:3030122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2329 Proteins

name	EG629524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629524 MGI:3643095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1690 Proteins

name	H1fnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70069 MGI:1917319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp641 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239652 MGI:2442788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257943 MGI:3030119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr284 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258278 MGI:3030118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr283 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259038 MGI:3030117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700031M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73302 MGI:1920552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100042818 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258449 MGI:3030116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr281 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258277 MGI:3030115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr240-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404356 MGI:3030074
definition	gene_synonym : MOR160-6_p note : olfactory receptor 240, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W76D0-7895713-7896429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257751
definition	note : olfactory receptor GA_x5J8B7W76D0-7895713-7896429 pseudo : _no_value

name	Lalba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16770 MGI:96742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258502 MGI:3030068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr278-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404371 MGI:3030112
definition	note : olfactory receptor 278, pseudogene 1 pseudo : _no_value

name	2310037I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69612 MGI:1916862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ccnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12455 MGI:1328363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930415O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73863 MGI:1921113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 1 Protein

name	Adcy6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11512 MGI:87917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12297 MGI:103307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ddx23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74351 MGI:1921601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223881 MGI:2444878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105833 MGI:2146001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66120 MGI:1913370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11842 MGI:99432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830427D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76061 MGI:1923311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc38a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381438 GeneID:105727 MGI:2145895
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 38, member 1 transcript_id : NM_134086.3

name	Slc38a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543734 GeneID:67760 MGI:1915010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 38, member 2 transcript_id : NM_175121.3

name	Slc38a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365242 GeneID:69354 MGI:1916604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 38, member 4 transcript_id : NM_027052.3

name	Amigo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392590 GeneID:105827 MGI:2145995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion molecule with Ig like domain 2 transcript_id : NM_178114.3

name	BC038822 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374053 GeneID:239647 MGI:2446270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038822 transcript_id : NM_172293.3

name	D15Ertd682e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374453 GeneID:71919 MGI:1277218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 15, ERATO Doi 682, expressed transcript_id : NM_028003.2

name	Pp11r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366558 GeneID:19011 MGI:97746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placental protein 11 related transcript_id : NM_008902.2

name	Rapgef3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450060 GeneID:223864 MGI:2441741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 3 transcript_id : NM_144850.1

name	4930570C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368946 GeneID:67739 MGI:1914989
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930570C03 gene transcript_id : NM_026353.3

name	Hdac7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254547 GeneID:56233 MGI:1891835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 7A transcript_id : NM_019572.2

name	Vdr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227202 GeneID:22337 MGI:103076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin D receptor transcript_id : NM_009504.3

name	Tmem106c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235746 GeneID:380967 MGI:1196384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 106C transcript_id : NM_201359.1

name	Col2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980519 GeneID:12824 MGI:88452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type II, alpha 1 transcript_id : NM_031163.2

name	Senp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353113 GeneID:223870 MGI:2445054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO1/sentrin specific peptidase 1 transcript_id : NM_144851.3

name	Pfkm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367127 GeneID:18642 MGI:97548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofructokinase, muscle transcript_id : NM_021514.3

name	Asb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801748 GeneID:78541 MGI:1925791
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 8 transcript_id : NM_030121.3

name	AI836003 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386196 GeneID:239650 MGI:2146066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI836003 transcript_id : NM_177716.2

name	Olfr288 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185919 GeneID:545140 MGI:3030122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 288 transcript_id : NM_001011733.2

name	LOC634104 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266752 GeneID:634104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2329 Proteins product : similar to Olfactory receptor 10AD1 transcript_id : XM_993741.2

name	EG629524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266754 GeneID:629524 MGI:3643095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1690 Proteins product : predicted gene, EG629524 transcript_id : XM_894414.3

name	H1fnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24111223 GeneID:70069 MGI:1917319
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member N, testis-specific transcript_id : NM_027304.1

name	Zfp641 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350744 GeneID:239652 MGI:2442788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 641 transcript_id : NM_173769.3

name	Olfr285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801331 GeneID:257943 MGI:3030119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 285 transcript_id : NM_001011778.1

name	Olfr284 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129720 GeneID:258278 MGI:3030118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 284 transcript_id : NM_146281.1

name	Olfr283 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128872 GeneID:259038 MGI:3030117
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 283 transcript_id : NM_147036.1

name	1700031M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398875 GeneID:73302 MGI:1920552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700031M16 gene, transcript variant 3 transcript_id : XM_902386.2

name	1700031M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398874 GeneID:73302 MGI:1920552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700031M16 gene, transcript variant 2 transcript_id : XM_902383.2

name	Olfr282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719160 GeneID:258449 MGI:3030116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 282 transcript_id : NM_146457.2

name	Olfr281 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129726 GeneID:258277 MGI:3030115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 281 transcript_id : NM_146280.1

name	Lalba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754499 GeneID:16770 MGI:96742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactalbumin, alpha transcript_id : NM_010679.1

name	Olfr234 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227366 GeneID:258502 MGI:3030068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 234 transcript_id : NM_001001807.1

name	2310037I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364524 GeneID:69612 MGI:1916862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310037I24 gene transcript_id : NM_133714.3

name	LOC100043418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266807 GeneID:100043418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043418 transcript_id : XM_001480722.1

name	Ccnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753315 GeneID:12455 MGI:1328363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin T1 transcript_id : NM_009833.1

name	4930415O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398893 GeneID:73863 MGI:1921113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 1 Protein product : RIKEN cDNA 4930415O20 gene transcript_id : XM_128114.5

name	Adcy6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86604720 GeneID:11512 MGI:87917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 6 transcript_id : NM_007405.2

name	Cacnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680290 GeneID:12297 MGI:103307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 3 subunit transcript_id : NM_001044741.1

name	Cacnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680270 GeneID:12297 MGI:103307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 3 subunit transcript_id : NM_007581.2

name	Ddx23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430513 GeneID:74351 MGI:1921601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 transcript_id : NM_001080981.1

name	Rnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361493 GeneID:223881 MGI:2444878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho family GTPase 1 transcript_id : NM_172612.2

name	Ccdc65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943817 GeneID:105833 MGI:2146001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 65 transcript_id : NM_153518.1

name	Fkbp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861215 GeneID:66120 MGI:1913370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 11 transcript_id : NM_024169.3

name	Arf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131061 GeneID:11842 MGI:99432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor 3 transcript_id : NM_007478.3

name	5830427D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361597 GeneID:76061 MGI:1923311
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830427D03 gene transcript_id : NM_175232.3

name	Slc38a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543733 CCDS:CCDS27777.1 GeneID:105727 MGI:2145895
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0015186 - L-glutamine transporter activity [Evidence IDA] GO_process : GO:0006868 - glutamine transport [Evidence IDA] codon_start : 1 product : solute carrier family 38, member 1 protein_id : NP_598847.2

name	Slc38a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543735 CCDS:CCDS27778.1 GeneID:67760 MGI:1915010
definition	codon_start : 1 product : solute carrier family 38, member 2 protein_id : NP_780330.2

name	Slc38a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543737 CCDS:CCDS27779.1 GeneID:69354 MGI:1916604
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : system A amino acid transporter 3 product : solute carrier family 38, member 4 protein_id : NP_081328.2

name	Amigo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017449 CCDS:CCDS27780.1 GeneID:105827 MGI:2145995
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] [Evidence ISS]; GO:0007157 - heterophilic cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence ISS]; GO:0043069 - negative regulation of programmed cell death [Evidence ISS] codon_start : 1 note : alivin 1; amphoterin induced gene and ORF 2 product : amphoterin induced gene 2 protein_id : NP_835215.1

name	BC038822 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986609 CCDS:CCDS27781.1 GeneID:239647 MGI:2446270
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC239647 protein_id : NP_758497.1

name	D15Ertd682e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386276 CCDS:CCDS27782.1 GeneID:71919 MGI:1277218
definition	GO_function : GO:0008483 - transaminase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71919 protein_id : NP_082279.1

name	Pp11r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679429 CCDS:CCDS27783.1 GeneID:19011 MGI:97746
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008083 - growth factor activity [Evidence ISS]; GO:0008236 - serine-type peptidase activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007565 - pregnancy [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] codon_start : 1 product : placental protein 11 related protein_id : NP_032928.1

name	Rapgef3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450061 GeneID:223864 MGI:2441741
definition	GO_component : GO:0005952 - cAMP-dependent protein kinase complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : exchange protein directly activated by cAMP product : Rap1 guanine-nucleotide-exchange factor directly activated by cAMP protein_id : NP_659099.1

name	4930570C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385856 GeneID:67739 MGI:1914989
definition	codon_start : 1 product : hypothetical protein LOC67739 protein_id : NP_080629.1

name	Hdac7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254548 GeneID:56233 MGI:1891835
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] [Evidence IDA]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016566 - specific transcriptional repressor activity [Evidence TAS]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030183 - B cell differentiation [Evidence TAS]; GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0045843 - negative regulation of striated muscle development [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence TAS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mFLJ00062 protein; histone deacetylase 7A, promoter 1; histone deacetylase 7A, promoter 2; histone deacetylase 7A, promoter 3 product : histone deacetylase 7A protein_id : NP_062518.2

name	Vdr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543944 CCDS:CCDS27784.1 GeneID:22337 MGI:103076
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0050892 - intestinal absorption [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : vitamin D receptor protein_id : NP_033530.2

name	Tmem106c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235747 CCDS:CCDS27785.1 GeneID:380967 MGI:1196384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC380967 protein_id : NP_958747.1

name	Col2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624305 GeneID:12824 MGI:88452
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0001502 - cartilage condensation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0006029 - proteoglycan metabolism [Evidence IMP] codon_start : 1 exception : mismatches in translation note : disproportionate micromelia product : procollagen, type II, alpha 1 protein_id : NP_112440.1

name	Senp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450063 GeneID:223870 MGI:2445054
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0016926 - protein desumoylation [Evidence IMP] [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : SUMO1/sentrin specific protease 1 protein_id : NP_659100.1

name	Pfkm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981185 CCDS:CCDS27786.1 GeneID:18642 MGI:97548
definition	GO_component : GO:0005945 - 6-phosphofructokinase complex [Evidence IEA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003872 - 6-phosphofructokinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008443 - phosphofructokinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0006110 - regulation of glycolysis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : phosphofructokinase-1 A isozyme; phosphofructokinase-M (connecting peptide) product : phosphofructokinase, muscle protein_id : NP_067489.2

name	Asb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560038 CCDS:CCDS27787.1 GeneID:78541 MGI:1925791
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 exception : mismatches in translation product : ankyrin repeat and SOCS box-containing protein 8 protein_id : NP_084397.2

name	AI836003 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244182 GeneID:239650 MGI:2146066
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC239650 protein_id : NP_808384.1

name	Olfr288 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185920 GeneID:545140 MGI:3030122
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5568919-5569857; olfactory receptor MOR286-3P; olfactory receptor GA_x5J8B7W76D0-7609197-7608973 product : olfactory receptor 288 protein_id : NP_001011733.2

name	LOC634104 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266753 GeneID:634104
definition	codon_start : 1 product : similar to olfactory receptor Olfr287 protein_id : XP_998835.2

name	EG629524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266755 GeneID:629524 MGI:3643095
definition	codon_start : 1 product : similar to olfactory receptor Olfr286 protein_id : XP_899507.3

name	H1fnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24111224 GeneID:70069 MGI:1917319
definition	GO_component : GO:0000790 - nuclear chromatin [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence TAS] GO_process : GO:0035092 - sperm chromatin condensation [Evidence IMP]; GO:0007290 - spermatid nuclear elongation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : expressed in haploid spermatids during spermiogenesis, specifically at the apical pole of round and elongating spermatids product : histone H1 variant protein_id : NP_081580.1

name	Zfp641 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424631 CCDS:CCDS27789.1 GeneID:239652 MGI:2442788
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 641 protein_id : NP_776130.1

name	Olfr285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801332 CCDS:CCDS27790.1 GeneID:257943 MGI:3030119
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5440777-5441736; olfactory receptor MOR160-3 product : olfactory receptor 285 protein_id : NP_001011778.1

name	Olfr284 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129721 CCDS:CCDS27791.1 GeneID:258278 MGI:3030118
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5395976-5396893; olfactory receptor MOR160-4 product : olfactory receptor 284 protein_id : NP_666393.1

name	Olfr283 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128873 CCDS:CCDS27792.1 GeneID:259038 MGI:3030117
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5351896-5352825; olfactory receptor MOR160-1 product : olfactory receptor 283 protein_id : NP_667247.1

name	1700031M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957729 GeneID:73302 MGI:1920552
definition	codon_start : 1 product : hypothetical protein LOC73302 isoform 3 protein_id : XP_907479.1

name	1700031M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957727 GeneID:73302 MGI:1920552
definition	codon_start : 1 product : hypothetical protein LOC73302 isoform 2 protein_id : XP_907476.1

name	Olfr282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719161 CCDS:CCDS27793.1 GeneID:258449 MGI:3030116
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5293798-5292872; olfactory receptor MOR160-2 product : olfactory receptor 282 protein_id : NP_666668.2

name	Olfr281 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129727 CCDS:CCDS27794.1 GeneID:258277 MGI:3030115
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5275017-5274082; olfactory receptor MOR160-5 product : olfactory receptor 281 protein_id : NP_666392.1

name	Lalba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754500 CCDS:CCDS27795.1 GeneID:16770 MGI:96742
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004461 - lactose synthase activity [Evidence IEA] GO_process : GO:0005989 - lactose biosynthesis [Evidence IEA] codon_start : 1 product : lactalbumin, alpha protein_id : NP_034809.1

name	Olfr234 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227367 CCDS:CCDS27796.1 GeneID:258502 MGI:3030068
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T04SN1-554-3; olfactory receptor MOR122-1; olfactory receptor 234, pseudogene 1 product : olfactory receptor 234 protein_id : NP_001001807.1

name	2310037I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981558 GeneID:69612 MGI:1916862
definition	codon_start : 1 product : hypothetical protein LOC69612 protein_id : NP_598475.2

name	LOC100043418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266808 GeneID:100043418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480772.1

name	Ccnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753316 CCDS:CCDS27797.1 GeneID:12455 MGI:1328363
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence IEA]; GO:0017069 - snRNA binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0000079 - regulation of cyclin-dependent protein kinase activity [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cyclin T1 protein_id : NP_033963.1

name	4930415O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20903411 GeneID:73863 MGI:1921113
definition	codon_start : 1 product : hypothetical protein LOC73863 protein_id : XP_128114.1

name	Adcy6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86604721 CCDS:CCDS27799.1 GeneID:11512 MGI:87917
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : adenylate cyclase 6 protein_id : NP_031431.2

name	Cacnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680291 GeneID:12297 MGI:103307
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; calcium channel beta 3 subunit product : calcium channel, voltage-dependent, beta 3 subunit isoform 2 protein_id : NP_001038206.1

name	Cacnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680271 CCDS:CCDS27800.1 GeneID:12297 MGI:103307
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; calcium channel beta 3 subunit product : calcium channel, voltage-dependent, beta 3 subunit isoform 1 protein_id : NP_031607.2

name	Ddx23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430514 GeneID:74351 MGI:1921601
definition	GO_component : GO:0046540 - U4/U6 x U5 tri-snRNP complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 protein_id : NP_001074450.1

name	Rnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369880 CCDS:CCDS27801.1 GeneID:223881 MGI:2444878
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Rho family GTPase 1 protein_id : NP_766200.1

name	Ccdc65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943818 CCDS:CCDS27802.1 GeneID:105833 MGI:2146001
definition	codon_start : 1 product : coiled-coil domain containing 65 protein_id : NP_705738.1

name	Fkbp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15277331 CCDS:CCDS27803.1 GeneID:66120 MGI:1913370
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : FK506 binding protein 11 protein_id : NP_077131.2

name	Arf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680718 CCDS:CCDS27804.1 GeneID:11842 MGI:99432
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ADP-ribosylation factor 3 protein_id : NP_031504.1

name	5830427D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424868 GeneID:76061 MGI:1923311
definition	codon_start : 1 product : hypothetical protein LOC76061 protein_id : NP_780441.1

name	LOC667941 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667941
definition	number : 1 pseudo : _no_value

name	LOC546651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546651
definition	number : 1 pseudo : _no_value

name	LOC100042774 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042774
definition	number : 3 pseudo : _no_value

name	LOC100042774 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042774
definition	number : 2 pseudo : _no_value

name	LOC100042774 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042774
definition	number : 1 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 1 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 2 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 3 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 4 pseudo : _no_value

name	LOC629549 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629549
definition	number : 1 pseudo : _no_value

name	LOC100043354 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266806 GeneID:100043354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : similar to high mobility group box 1 pseudo : _no_value transcript_id : XR_034778.1

clone name	MSMg01-309G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543E08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-467J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363E18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403O03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-527A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067A13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-219G15.b	B6Ng01-219G15.g
ACC	GA035257	GA035258
length	1,176	523
definition	B6Ng01-219G15.b	B6Ng01-219G15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(97,403,383 - 97,404,571)	(97,597,112 - 97,597,639)
sequence	gaattcaactggaccacagttctacccgcttcaggattcaccccagagag ttaccttgtcctgcatccccagaatgtctcctcaccccagagagaccgct aggtccctcccatgttaaaatcagaaagtctccaggaagtggtatgtggt gaccttagggaccgtgtcatttgtttccttatctcggggacactagtcct ccacagctttagggtctgtaccctgaaaactgttgtttcgtcattttgct gaactgctgtttcaggaaagagggtgattcagtttcactgctcattaggg gctgtctggaagttccatggactctactcattttctttaaactcttaaaa atgtcttgatgtgcacaatagactacatcaccggtttatttatagatagt agctaacaacactgagaaatggttccatgtgaaacgtctgtgctttttct accatttcctctagcattcaaacaaaagcctttcttgaagcaagatcttt caattaaacaaacaaacaaatgaaaataaaacggcacatccttcttctat ccttcttccaggagcatgtatatttggggagagtcagtcattggctcttc agctcttacccaaacacttaagaagtcaagacacattgaggtcaccctgt tataagcaacagaaagtgcaataaatagacttcagccataaagggagttc actgtgcacatagctgaacagtctcggggagaggggtctagcaccgcatg agcaagacctcaaaggtgctctcttcctcctccctcttcctcctccactt cctcctcctctccactttccacaacccatccctctgttgacactgtcctc agacaagtgccgcctgcctttaggactctcagaaagctatcagcaacagg gctatgtccatcattatgattcagtaagggacacgaaagattggcttggg agttttctgctgaagaagccaagtgccacagcagcacaggaaatgccctt cttgtctcttgtgactcgctgaattaagctctgtagtgatgatgtgactg gtcacctgactgcatctgaaacaactcaagacagcatctgggcaccagca tcttggcaggctgtgagagccttcccgaagggataactgattggggagaa cctgtagcacttggggtagcaccttc	cagccagaactgagaagagccccatcgttgtgagttgagtggagacccct aggtgcgccaagccagcaggacccggggcaggtcttcctgtccctccccc ggctcctggcagggttgccgcacctccgcatgaccagtccaagtccagag gacgctaagccaggggtggtagtggggaggtccagctcctccggccgatg gctgtcctctttcctccccacatcacaggtcagctggccaggtgagaacc actggcaggtgggcccagctgtggtggagagtccagctgtgggggcaccg caggtgggaggtctcccggacgtggttccggagggcacgctgctcaatat ggtgttgaagagaatgcaccgtccccgctgctgctcttaccagctagtgt tcgagcaccggcgccccatctgcatccagggactccgctgggtgagtacc ggccatctgccaggctgggtcagggctggaagagtcgggattgtagtgct ggtgggccatgcagcttttctcc
quality values	Open. Hide. 62 23 26 37 62 33 24 47 62 62 62 62 47 51 43 30 62 59 62 62 49 62 62 62 62 62 62 62 62 62 51 49 30 22 43 28 44 48 35 46 59 59 54 54 62 46 33 42 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 54 49 54 62 62 59 62 62 62 62 59 56 42 54 59 62 59 59 62 62 62 59 62 62 62 59 49 54 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 59 62 62 54 54 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 42 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 49 42 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 59 59 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 41 56 43 62 54 33 62 47 62 62 62 56 62 56 62 62 62 62 62 62 62 62 43 62 52 62 52 62 52 62 62 62 54 62 62 62 62 62 62 62 62 52 52 52 62 62 54 62 42 52 62 62 41 38 62 62 54 50 62 62 54 54 54 47 58 58 52 50 42 23 44 44 58 28 46 54 52 58 58 45 45 45 43 47 52 47 39 54 52 54 58 58 54 52 52 36 54 52 54 45 38 54 35 50 58 38 23 52 46 54 52 50 54 54 54 58 52 54 58 52 42 41 54 54 46 32 31 40 41 22 49 49 54 52 54 58 46 52 32 58 38 38 47 41 58 58 38 51 47 46 52 37 48 49 40 50 58 46 42 42 41 24 34 38 46 39 35 58 58 58 48 51 30 36 18 58 58 50 40 53 42 39 34 50 40 30 44 42 50 37 50 48 51 16 58 33 37 28 49 32 43 50 16 6 58 14 35 58 41 53 39 58 53 50 52 54 51 41 58 39 31 39 38 50 58 54 41 41 39 33 27 43 26 29 29 43 33 35 32 41 21 32 29 51 29 24 41 52 39 32 28 23 32 32 21 31 39 51 54 23 29 37 32 35 35 30 25 42 40 33 40 23 54 45 37 35 42 35 22 38 36 34 22 17 32 37 45 40 33 31 37 40 31 17 51 22 18 51 32 31 40 24 28 26 20 14 26 34 15 33 27 52 28 24 9 19 34 19 32 32 31 28 28 19 53 53 42 30 29 40 22 31 32 39 19 34 22 31 31 17 25 46 35 31 31 28 28 23 30 24 43 21 34 33 27 34 33 30 29 31 30 16 29 32 25 6 15 11 25 17 46 15 29 16 21 24 19 32 47 31 30 30 11 31 19 13 32 12 30 33 46 24 16 9 31 46 42 31 21 11 26 31 32 28 34 34 9 36 28 9 15 12 14 33 16 16 17 19 20 13 28 13 19 25 28 21 16 9 29 16 18 11 33 46 30 20 30 41 46 30 24 31 35 24 22 29 9 9 16 35 8 22 12 11 19 31 22 24 31 13 18 31 27 37 37 19 24 17 31 22 32 25 15 13 34 22 29 14 10 4 4 4 10 8 5 28 18 8 23 14 22 24 22 6 9 12 18 12 4 6 15 17 11 17 21 16 23 25 10 10 33 39 13 9 9 13 31 8 10 10 5 11 16 17 9 9 19 10 12 8 18 16 30 17 4 6 6 16 15 12 19 8 20 8 7 9 20 27 9 8 17 17 4 5 8 6 8 14 10 5 10 3 5 9 21 13 27 6 5 5 4 5 9 23 19 9 23 16 15 21 7 16 5 4 9 10 28 7 18 4 10 20 10 8 6 4 4 5 4 5 6 5 4 2 1 3 17 6 9 5 5 6 7 20 19 4 5 3	Open. Hide. 44 31 62 56 39 23 25 28 25 21 32 31 28 23 28 49 56 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 49 62 62 62 54 59 49 62 33 54 54 48 59 59 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 56 59 62 56 59 62 62 62 62 59 59 59 56 59 50 59 51 62 48 59 59 50 62 62 62 62 59 56 59 59 56 59 59 56 59 59 62 62 59 59 59 56 62 59 56 59 59 56 62 43 48 56 51 59 56 56 59 46 46 49 50 56 50 62 62 59 62 59 59 59 59 59 59 62 54 46 62 62 62 46 62 62 62 43 51 50 34 31 43 62 59 46 54 56 38 54 48 54 48 54 50 49 50 49 49 51 56 54 54 46 59 59 30 34 28 13 17 30 31 51 50 56 41 62 46 59 46 35 46 31 31 29 43 56 48 48 46 36 48 54 46 26 36 26 19 18 18 18 23 30 59 54 46 59 59 49 51 56 43 49 34 21 18 13 17 19 23 34 23 34 34 49 51 46 18 18 13 18 18 13 50 13 23 16 9 13 12 23 34 39 34 17 30 30 30 25 17 34 31 27 34 34 39 23 46 49 37 46 43 43 38 33 23 31 44 39 49 49 59 31 27 48 18 48 27 34 24 23 30 13 23 11 26 18 23 18 23 12 9 12 9 21 13 9 17 33 39 24 18 24 40 27 30 14 23 19 19 21 35 46 54 44 27 41 41 18 28 8 17 18 34 17 8 18 18 23 11 19 27 24 10 10 10 11 13 24 23 26 19 17 11 20 16 28 14 7 17 23 16 17 23 13 14 5 13 10 6 17 20 23 12 20 23 17 34 13 28 29 17 28 23 9 9 12 13 11 9 10 6 5 8 18 23 11 21 29 34 20 18 17 16 13 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_97403383_97404571
seq2: B6Ng01-219G15.b_45_1220

seq1  GAATTCAACTGGACCACAGTTCTACCCGCTTCAGGATTCACCCCAGAGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACTGGACCACAGTTCTACCCGCTTCAGGATTCACCCCAGAGAG  50

seq1  TTACCTTGTCCTGCATCCCCAGAATGTCTCCTCACCCCAGAGAGACCGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCTTGTCCTGCATCCCCAGAATGTCTCCTCACCCCAGAGAGACCGCT  100

seq1  AGGTCCCTCCCATGTTAAAATCAGAAAGTCTCCAGGAAGTGGTATGTGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCCCTCCCATGTTAAAATCAGAAAGTCTCCAGGAAGTGGTATGTGGT  150

seq1  GACCTTAGGGACCGTGTCATTTGTTTCCTTATCTCGGGGACACTAGTCCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTTAGGGACCGTGTCATTTGTTTCCTTATCTCGGGGACACTAGTCCT  200

seq1  CCACAGCTTTAGGGTCTGTACCCTGAAAACTGTTGTTTCGTCATTTTGCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAGCTTTAGGGTCTGTACCCTGAAAACTGTTGTTTCGTCATTTTGCT  250

seq1  GAACTGCTGTTTCAGGAAAGAGGGTGATTCAGTTTCACTGCTCATTAGGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTGCTGTTTCAGGAAAGAGGGTGATTCAGTTTCACTGCTCATTAGGG  300

seq1  GCTGTCTGGAAGTTCCATGGACTCTACTCATTTTCTTTAAACTCTTAAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTCTGGAAGTTCCATGGACTCTACTCATTTTCTTTAAACTCTTAAAA  350

seq1  ATGTCTTGATGTGCACAATAGACTACATCACCGGTTTATTTATAGATAGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCTTGATGTGCACAATAGACTACATCACCGGTTTATTTATAGATAGT  400

seq1  AGCTAACAACACTGAGAAATGGTTCCATGTGAAACGTCTGTGCTTTTTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAACAACACTGAGAAATGGTTCCATGTGAAACGTCTGTGCTTTTTCT  450

seq1  ACCATTTCCTCTAGCATTCAAACAAAAGCCTTTCTTGAAGCAAGATCTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATTTCCTCTAGCATTCAAACAAAAGCCTTTCTTGAAGCAAGATCTTT  500

seq1  CAATTAAACAAACAAACAAATGAAAATAAAACGGCACATCCTTCTTCTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTAAACAAACAAACAAATGAAAATAAAACGGCACATCCTTCTTCTAT  550

seq1  CCTTCTTCCAGGAGCATGTATATTTGGGGAGAGTCAGTCATTGGCTCTTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCTTCCAGGAGCATGTATATTTGGGGAGAGTCAGTCATTGGCTCTTC  600

seq1  AGCTCTTACCCAAACACTTAAGAAGTCAAGACACATTGAGGTCACCCTGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTTACCCAAACACTTAAGAAGTCAAGACACATTGAGGTCACCCTGT  650

seq1  TATAAGCAACAGAAAGTGCAATAAATAGACTTCAGCCATAAAGGGAGTTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAGCAACAGAAAGTGCAATAAATAGACTTCAGCCATAAAGGGAGTTC  700

seq1  ACTGTGCACATAGCTGAACAGTCTCGGGGAGAGGGGTCTAGCACCGCATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTGCACATAGCTGAACAGTCTCGGGGAGAGGGGTCTAGCACCGCATG  750

seq1  AGCAAGACCTC-AAGGTGCTCTCTTCCTCCTCCCTCTTCCTCCTCCACTT  799
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AGCAAGACCTCAAAGGTGCTCTCTTCCTCCTCCCTCTTCCTCCTCCACTT  800

seq1  CCTCCTCCTCTCCACTTTCCACAACCCATCCCTCTGTTGACACTGTCCTC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCTCTCCACTTTCCACAACCCATCCCTCTGTTGACACTGTCCTC  850

seq1  AGACAAGTGCCGCCTGCCTTTAGGACTCTCAGAAAGCTATCAGCAACAGG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAAGTGCCGCCTGCCTTTAGGACTCTCAGAAAGCTATCAGCAACAGG  900

seq1  GCTATGTCCATCATTATGATTCAGTAAGGGACACGAAAGATTGCCTTGGG  949
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GCTATGTCCATCATTATGATTCAGTAAGGGACACGAAAGATTGGCTTGGG  950

seq1  AGTTTTCTGCTGAAGAAGCCAAGTGCCACCAGCAGCACCAGGAAATGCCC  999
      |||||||||||||||||||||||||||| |||||||| ||||||||| ||
seq2  AGTTTTCTGCTGAAGAAGCCAAGTGCCA-CAGCAGCA-CAGGAAATG-CC  997

seq1  CTTCTTGTCTCCTTGTGACTCGCTGAATTAAGCTCTGTAGTGGTTGATGT  1049
      |||||||||| |||||||||||||||||||||||||||||| | ||||| 
seq2  CTTCTTGTCT-CTTGTGACTCGCTGAATTAAGCTCTGTAGT-GATGATG-  1044

seq1  TGACT-GTCACCTTGACTGCATCTGAAAACAACCTCAGGACCAGCATCTG  1098
      ||||| |||||| |||||||||||| |||||| |||| || |||||||||
seq2  TGACTGGTCACC-TGACTGCATCTG-AAACAA-CTCAAGA-CAGCATCTG  1090

seq1  GGCACCAGCATCTGGGCAGGCCTGTGAGGGCCTTCCCGAGAGGGATAACT  1148
      ||||||||||||| |||||| ||||||| |||||||||| ||||||||||
seq2  GGCACCAGCATCTTGGCAGG-CTGTGAGAGCCTTCCCGA-AGGGATAACT  1138

seq1  GAATGGGGGAAGACCCTTGTAGCATTGTGGGTAGCACCTTC  1189
      || |||||  ||| || ||||||| |  |||||||||||||
seq2  GATTGGGG--AGAACC-TGTAGCACTTGGGGTAGCACCTTC  1176

seq1: chr15_97597112_97597639
seq2: B6Ng01-219G15.g_67_595 (reverse)

seq1  GGAG-AAAGCTGCCTGGCCCACCAGCACTACAATCCCGACTCTTCCAGCC  49
      |||| |||||||| ||||||||||||||||||||||||||||||||||||
seq2  GGAGAAAAGCTGCATGGCCCACCAGCACTACAATCCCGACTCTTCCAGCC  50

seq1  CTGACCCAGCCTGGCAGATGGCCGGTACTCACCCAGCGGAGTCCCTGGAT  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACCCAGCCTGGCAGATGGCCGGTACTCACCCAGCGGAGTCCCTGGAT  100

seq1  GCAGCTGGGGCGCCGGTGCTCGAACACTAGCTGGTAAGAGCAGCAGCGGG  149
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGATGGGGCGCCGGTGCTCGAACACTAGCTGGTAAGAGCAGCAGCGGG  150

seq1  GACGGTGCATTCTCTTCAACACCATATTGAGCAGCGTGCCCTCCGGAACC  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGGTGCATTCTCTTCAACACCATATTGAGCAGCGTGCCCTCCGGAACC  200

seq1  ACGTCCGGGAGACCTCCCACCTGCGGTGCCCCCACAGCTGGACTCTCCAC  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTCCGGGAGACCTCCCACCTGCGGTGCCCCCACAGCTGGACTCTCCAC  250

seq1  CACAGCTGGGCCCACCTGCCAGTGGTTCTCACCTGGCCAGCTGACCTGTG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCTGGGCCCACCTGCCAGTGGTTCTCACCTGGCCAGCTGACCTGTG  300

seq1  ATGTGGGGAGGAAAGAGGACAGCCATCGGCCGGAGGAGCTGGACCTCCCC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGGGGAGGAAAGAGGACAGCCATCGGCCGGAGGAGCTGGACCTCCCC  350

seq1  ACTACCACCCCTGGCTTAGCGTCCTCTGGACTTGGACTGGTCATGCGGAG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACCACCCCTGGCTTAGCGTCCTCTGGACTTGGACTGGTCATGCGGAG  400

seq1  GTGCGGCAACCCTGCCAGGAGCCGGGGGAGGGACAGGAAGACCTGCCCCG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCGGCAACCCTGCCAGGAGCCGGGGGAGGGACAGGAAGACCTGCCCCG  450

seq1  GGTCCTGCTGGCTTGGCGCACCTAGGGGTCTCCACTCAACTCACAACGAT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCTGCTGGCTTGGCGCACCTAGGGGTCTCCACTCAACTCACAACGAT  500

seq1  GGGGCTCTTCTCAGTTCTGGCTGGAATTC  528
      |||||||||||||||||||||||||||||
seq2  GGGGCTCTTCTCAGTTCTGGCTGGAATTC  529

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information