MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-295C10
Chromosome	15 (Build37)
Map Location	84,832,122 - 84,996,638
singlet/doublet	doublet
Overlap gene	LOC628135, Upk3a, 3110048E14Rik, Smc1b, Ribc2
Upstream gene	4931407K02Rik, LOC667167, Sult4a1, Pnpla5, Pnpla3, Samm50, Parvb, Parvg, LOC382988, 1810041L15Rik, Ldoc1l, Arhgap8, 3110043J09Rik, Phf21b, LOC100043084, 4930513L16Rik, Nup50, 5031439G07Rik
Downstream gene	Fbln1, Atxn10, EG223745, Wnt7b, LOC100042240, Ppara, 2210021J22Rik, Pkdrej, AW124722, Gtse1, Trmu, Celsr1, BC021523, Cerk
Link	Open Mouse BAC browser

Click to get alignment info.

name	4931407K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77627 MGI:1924877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Sult4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29859 MGI:1888971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75772 MGI:1923022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116939 MGI:2151796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Samm50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68653 MGI:1915903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parvb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170736 MGI:2153063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parvg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64099 MGI:2158329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382988 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	1810041L15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72301 MGI:1919551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 97 ESTs, 1 Protein

name	Ldoc1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223732 MGI:2675858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109270 MGI:1924714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110043J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73167 MGI:1920417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf21b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271305 MGI:2443812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043084 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 248 ESTs, 13 Proteins pseudo : _no_value

name	4930513L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78021 MGI:1925271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Nup50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18141 MGI:1351502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5031439G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223739 MGI:2444899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 6 Proteins pseudo : _no_value

name	Upk3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22270 MGI:98914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110048E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73225 MGI:1920475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Smc1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140557 MGI:2154049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ribc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67747 MGI:1914997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs, 3 Proteins

name	Fbln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14114 MGI:95487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atxn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54138 MGI:1859293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG223745 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223745 MGI:3647768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Wnt7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22422 MGI:98962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042240 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ppara (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19013 MGI:104740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210021J22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72355 MGI:1919605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkdrej (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18766 MGI:1338786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW124722 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239570 MGI:2146198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtse1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29870 MGI:1352755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trmu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72026 MGI:1919276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Celsr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12614 MGI:1100883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223752 MGI:2676308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cerk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223753 MGI:2386052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931407K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734488 GeneID:77627 MGI:1924877
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931407K02 gene transcript_id : NM_029946.3

name	Sult4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328448 GeneID:29859 MGI:1888971
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 4A, member 1 transcript_id : NM_013873.3

name	Pnpla5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115749408 GeneID:75772 MGI:1923022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 5 transcript_id : NM_029427.1

name	Pnpla3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226244 GeneID:116939 MGI:2151796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 3 transcript_id : NM_054088.3

name	Samm50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372107 GeneID:68653 MGI:1915903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting and assembly machinery component 50 homolog (S. cerevisiae) transcript_id : NM_178614.3

name	Parvb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781769 GeneID:170736 MGI:2153063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parvin, beta transcript_id : NM_133167.3

name	Parvg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802814 GeneID:64099 MGI:2158329
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parvin, gamma transcript_id : NM_022321.3

name	1810041L15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266777 GeneID:72301 MGI:1919551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 97 ESTs, 1 Protein product : RIKEN cDNA 1810041L15 gene, transcript variant 1 transcript_id : XM_128169.9

name	Ldoc1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681692 GeneID:223732 MGI:2675858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper, down-regulated in cancer 1-like transcript_id : NM_177630.3

name	Arhgap8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583638 GeneID:109270 MGI:1924714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 8 transcript_id : NM_146061.4

name	3110043J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365448 GeneID:73167 MGI:1920417
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110043J09 gene transcript_id : NM_028455.2

name	Phf21b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487186 GeneID:271305 MGI:2443812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 21B transcript_id : NM_001081166.1

name	4930513L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266780 GeneID:78021 MGI:1925271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930513L16 gene transcript_id : XM_001480182.1

name	Nup50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016153 GeneID:18141 MGI:1351502
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 50 transcript_id : NM_016714.2

name	5031439G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387530 GeneID:223739 MGI:2444899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5031439G07 gene transcript_id : NM_001033273.2

name	Upk3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963692 GeneID:22270 MGI:98914
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroplakin 3A transcript_id : NM_023478.1

name	3110048E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801484 GeneID:73225 MGI:1920475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110048E14 gene transcript_id : NM_177067.2

name	3110048E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059085 GeneID:73225 MGI:1920475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110048E14 gene transcript_id : NM_133750.3

name	Smc1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17978289 GeneID:140557 MGI:2154049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structural maintenace of chromosomes 1B transcript_id : NM_080470.1

name	Ribc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398827 GeneID:67747 MGI:1914997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs, 3 Proteins product : RIB43A domain with coiled-coils 2, transcript variant 1 transcript_id : XM_283290.4

name	Fbln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753821 GeneID:14114 MGI:95487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibulin 1 transcript_id : NM_010180.1

name	Atxn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376666 GeneID:54138 MGI:1859293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxin 10 transcript_id : NM_016843.3

name	EG223745 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398828 GeneID:223745 MGI:3647768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG223745 transcript_id : XM_139514.3

name	Wnt7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328152 GeneID:22422 MGI:98962
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 7B transcript_id : NM_009528.2

name	Ppara (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227253 GeneID:19013 MGI:104740
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor alpha transcript_id : NM_011144.3

name	2210021J22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930552 GeneID:72355 MGI:1919605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210021J22 gene transcript_id : NM_197998.1

name	Pkdrej (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115583674 GeneID:18766 MGI:1338786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like transcript_id : NM_011105.2

name	AW124722 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381878 GeneID:239570 MGI:2146198
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW124722 transcript_id : NM_001033337.2

name	Gtse1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305118 GeneID:29870 MGI:1352755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G two S phase expressed protein 1 transcript_id : NM_013882.1

name	Trmu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130414 GeneID:72026 MGI:1919276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase transcript_id : NM_028063.2

name	Celsr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648152 GeneID:12614 MGI:1100883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin EGF LAG seven-pass G-type receptor 1 transcript_id : NM_009886.2

name	BC021523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368891 GeneID:223752 MGI:2676308
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021523 transcript_id : NM_172611.2

name	Cerk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62899060 GeneID:223753 MGI:2386052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ceramide kinase transcript_id : NM_145475.3

name	4931407K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734489 CCDS:CCDS27707.1 GeneID:77627 MGI:1924877
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : bM150J22.2 (novel protein (4931407K02RIK, 4932408N08RIK)) product : CAP-binding protein complex interacting protein 1 protein_id : NP_084222.3

name	Sult4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328449 CCDS:CCDS27708.1 GeneID:29859 MGI:1888971
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0008146 - sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006790 - sulfur metabolism [Evidence IDA] codon_start : 1 note : sulfotransferase-related protein product : sulfotransferase family 4A, member 1 protein_id : NP_038901.3

name	Pnpla5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115749409 GeneID:75772 MGI:1923022
definition	GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : patatin-like phospholipase domain containing 5 protein_id : NP_083703.1

name	Pnpla3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226245 GeneID:116939 MGI:2151796
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004623 - phospholipase A2 activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004806 - triacylglycerol lipase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0019432 - triacylglycerol biosynthesis [Evidence ISS]; GO:0019433 - triacylglycerol catabolism [Evidence ISS] codon_start : 1 product : adiponutrin protein_id : NP_473429.2

name	Samm50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519943 GeneID:68653 MGI:1915903
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] codon_start : 1 product : sorting and assembly machinery component 50 homolog protein_id : NP_848729.1

name	Parvb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18860551 GeneID:170736 MGI:2153063
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : beta-parvin product : parvin, beta protein_id : NP_573395.1

name	Parvg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543462 CCDS:CCDS27710.1 GeneID:64099 MGI:2158329
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gamma-parvin product : parvin, gamma protein_id : NP_071716.2

name	1810041L15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266778 GeneID:72301 MGI:1919551
definition	codon_start : 1 product : hypothetical protein LOC72301 isoform 1 protein_id : XP_128169.4

name	Ldoc1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681693 GeneID:223732 MGI:2675858
definition	codon_start : 1 note : gag-like protein product : leucine zipper, down-regulated in cancer 1-like protein_id : NP_808298.2

name	Arhgap8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583639 CCDS:CCDS27711.1 GeneID:109270 MGI:1924714
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence ISS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0030335 - positive regulation of cell migration [Evidence ISS] codon_start : 1 note : proline rich protein 5 product : Rho GTPase activating protein 8 protein_id : NP_666173.4

name	3110043J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312155 CCDS:CCDS27712.1 GeneID:73167 MGI:1920417
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 8 protein_id : NP_082731.1

name	Phf21b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487187 GeneID:271305 MGI:2443812
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : PHD finger protein 21B protein_id : NP_001074635.1

name	4930513L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266781 GeneID:78021 MGI:1925271
definition	codon_start : 1 product : hypothetical protein LOC78021 protein_id : XP_001480232.1

name	Nup50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016154 CCDS:CCDS27714.1 GeneID:18141 MGI:1351502
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence TAS]; GO:0015288 - porin activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001841 - neural tube formation [Evidence IMP]; GO:0006913 - nucleocytoplasmic transport [Evidence TAS] codon_start : 1 note : nuclear pore associated protein 60 kDa; nucleoprotein 50 product : nucleoporin 50 protein_id : NP_057923.2

name	5031439G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701776 CCDS:CCDS27715.1 GeneID:223739 MGI:2444899
definition	codon_start : 1 product : hypothetical protein LOC223739 protein_id : NP_001028445.1

name	Upk3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963693 CCDS:CCDS27716.1 GeneID:22270 MGI:98914
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : proplakin IIIa product : uroplakin 3A protein_id : NP_075967.1

name	3110048E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526958 CCDS:CCDS27717.1 GeneID:73225 MGI:1920475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC73225 isoform a protein_id : NP_598511.1

name	3110048E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059167 GeneID:73225 MGI:1920475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC73225 isoform b protein_id : NP_796041.1

name	Smc1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978290 CCDS:CCDS27718.1 GeneID:140557 MGI:2154049
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IDA]; GO:0000800 - lateral element [Evidence IDA]; GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051276 - chromosome organization and biogenesis [Evidence IEA]; GO:0007126 - meiosis [Evidence IPI]; GO:0007062 - sister chromatid cohesion [Evidence IDA] codon_start : 1 note : SMC product : SMC (structural maintenace of chromosomes 1)-like 2 protein_id : NP_536718.1

name	Ribc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957597 GeneID:67747 MGI:1914997
definition	codon_start : 1 product : RIB43A domain with coiled-coils 2 isoform 1 protein_id : XP_283290.2

name	Fbln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753822 CCDS:CCDS27719.1 GeneID:14114 MGI:95487
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016504 - protease activator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : BM-90/fibulin extracellular matrix glyroprotein product : fibulin 1 protein_id : NP_034310.1

name	Atxn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649709 GeneID:54138 MGI:1859293
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : brain protein E46; spinocerebellar ataxia 10; testis expressed gene 169 product : ataxin 10 protein_id : NP_058539.2

name	EG223745 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398829 GeneID:223745 MGI:3647768
definition	codon_start : 1 product : hypothetical protein protein_id : XP_139514.3

name	Wnt7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328153 GeneID:22422 MGI:98962
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045669 - positive regulation of osteoblast differentiation [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IGI] codon_start : 1 exception : mismatches in translation product : wingless-related MMTV integration site 7B protein_id : NP_033554.2

name	Ppara (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543500 CCDS:CCDS27721.1 GeneID:19013 MGI:104740
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IDA] [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IMP] [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008544 - epidermis development [Evidence IMP]; GO:0006631 - fatty acid metabolism [Evidence IMP] [Evidence TAS]; GO:0006006 - glucose metabolism [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence TAS]; GO:0045941 - positive regulation of transcription [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0019217 - regulation of fatty acid metabolism [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : peroxisome proliferator activated receptor alpha protein_id : NP_035274.2

name	2210021J22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930553 CCDS:CCDS27722.1 GeneID:72355 MGI:1919605
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72355 protein_id : NP_932115.1

name	Pkdrej (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115583675 CCDS:CCDS27723.1 GeneID:18766 MGI:1338786
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : receptor for egg jelly-like protein protein_id : NP_035235.2

name	AW124722 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701834 CCDS:CCDS27724.1 GeneID:239570 MGI:2146198
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC239570 protein_id : NP_001028509.1

name	Gtse1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305119 CCDS:CCDS27725.1 GeneID:29870 MGI:1352755
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] codon_start : 1 function : p53 regulated microtubule localised protein product : G two S phase expressed protein 1 protein_id : NP_038910.1

name	Trmu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312518 CCDS:CCDS27726.1 GeneID:72026 MGI:1919276
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004808 - tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase 1 protein_id : NP_082339.1

name	Celsr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115648153 GeneID:12614 MGI:1100883
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS] [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA] [Evidence NAS]; GO:0046983 - protein dimerization activity [Evidence NAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0045176 - apical protein localization [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence NAS]; GO:0007417 - central nervous system development [Evidence NAS]; GO:0007275 - development [Evidence IEA]; GO:0042249 - establishment of polarity of embryonic epithelium [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence NAS]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0001843 - neural tube closure [Evidence IMP]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0046928 - regulation of neurotransmitter secretion [Evidence NAS]; GO:0007165 - signal transduction [Evidence NAS] [Evidence IEA] codon_start : 1 note : seven-pass transmembrane receptor product : cadherin EGF LAG seven-pass G-type receptor 1 precursor protein_id : NP_034016.2

name	BC021523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369870 CCDS:CCDS27727.1 GeneID:223752 MGI:2676308
definition	GO_component : GO:0009573 - ribulose bisphosphate carboxylase complex (sensu Magnoliophyta) [Evidence IEA] GO_function : GO:0016984 - ribulose-bisphosphate carboxylase activity [Evidence IEA] GO_process : GO:0015977 - carbon utilization by fixation of carbon dioxide [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223752 protein_id : NP_766199.1

name	Cerk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62899061 CCDS:CCDS27728.1 GeneID:223753 MGI:2386052
definition	GO_component : GO:0000299 - integral to membrane of membrane fraction [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence ISS]; GO:0001729 - ceramide kinase activity [Evidence ISS]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006672 - ceramide metabolism [Evidence ISS]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 product : ceramide kinase protein_id : NP_663450.3

name	LOC667167 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667167
definition	number : 1 pseudo : _no_value

name	LOC382988 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382988
definition	number : 2 pseudo : _no_value

name	LOC382988 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382988
definition	number : 1 pseudo : _no_value

name	LOC100042240 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042240
definition	number : 1 pseudo : _no_value

name	LOC100042240 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042240
definition	number : 2 pseudo : _no_value

name	LOC100043084 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266779 GeneID:100043084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 248 ESTs, 13 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034570.1

name	LOC628135 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266783 GeneID:628135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 6 Proteins product : similar to SET translocation pseudo : _no_value transcript_id : XR_034574.1

clone name	MSMg01-481O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-513K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-094E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-295C10.b	B6Ng01-295C10.g
ACC	GA091095	GA091096
length	1,163	1,060
definition	B6Ng01-295C10.b	B6Ng01-295C10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(84,995,480 - 84,996,638)	(84,832,122 - 84,833,176)
sequence	gaattcagttggcaaacatatactgagtaccttgtttaaagctatgtgct atgtaattcccttagaacatgcgtccccattgttcatggccttacctaga gagagagagtaagagaacgtagaaggtgaaggtgcagagctgaagcttgc cctgccacgagacggccacacaatggccaagcgtgctttcaggagcaaga tgcctgagttccagtcctcactgtctgtgtgacttagtcgccaagggctc agagttctcatctgaagctaggagccatctgagggtggcactctcaagtg gtggtccccaggatacggagaaaggagcttcgtgttcctttctgctggag tctgtgaagccatcagaaccccaaagtgagctcttctgagctcgtcgctt taggcgtgtcaggacaccccggcagggaaggaaagaggaataattcattt gcctaacgtatgtttatttcctggctgccttctaaatgcaaagcaaacaa atgcactcaaatctgtaattaattagaagccccagctgtggcagcaggca agcatacctgcactacagagatgctggcccaggtccaaggcgctaatcca ggtgagggatggtgggcctatgtgggcctccatacagagcaaatggttct caacgtgtgggtcccaccctttcacaggcatggcctaagaccatcagaaa acacagacattcaaattctgattcacaacagcagcaaaattacagttatg aagaagcaatgaaaacaattttatgtttgggggccgccgccacagtgtga ggaactgtattaaagggtcgcagtgttaggaaggttgagaaccgctgctg tagagtcatcagggcacacagcccttgtgaaaggcagtaggatgtgaaaa ggaaatcaagaggcgcttgaagctttagccttcttcctcggtagaccgac attgcctttccactaaatgctttgcgggttccacagggactgactgagcc tttgggtctgcccgtcagcatctcctcagtgggctcttgacctttcagac ttcctttgcacctttactttcaatcatccagacggagcccctccgttagc agatgcctcgtgaccttccttttgtaatggaggagactaatggagtgagg gttacttcacagg	gaattccgcctccagggagtcttcctggcctgggacgggccttgtttagt cagccttgtctgcgcagttactcattgacatcttctaagggacagtcaca ttcacaggctggaagtaaggctgcatcactcaccatcccggaatgatcct caggggatacctttgagggctggagccttttgcaacagtctggtatctta ggtggaggaaccctgcctgagaactcttacttaatcatgctcccttaggg ctgactagtccttctgagcccggaaaaagaggcttctaggcttgccctga aaatgaccttggtgtccaccttggccttgcttagactatttccagatggt cctggtccttctgagcctctgcttgctggcatggaaggttcattcgagaa acaggtcctgcatttgggagtagttacaaggctccgcttaaaagtggaca cctataacacatagtctggaagacattctgtcatccctgaagcaatgtct ctctcgtggttggatttgaatgtgctagaacattcagccctgggtctgtg gctggcccaggtgctggcccctggctcacatgagcacagtgcagatcatg ccaagacaggactgagactgtctggattcaaatgctagcttctgctctcc atagctgtatgtcaggaggaaatggtcaaaacctacgtgtgccagggcta ccccgaggattcccaggtaaaggttaatgattagttttgctcttgggcta aaaagccaccaccagatgtccagggagctgggagagaaaggataaagctg gcttggacctgggatggccgtgaactctgagaactaggcttaggaatgcc ctaggctgtccttaccttttcctagagtgacagcacatggggtatgggga gggtctgttctctagagaggactttgcccagggggtcagagttcagtcct ttcatgaggatgtaggagatgaccataagtaataaggcaggaagctgggg ctcggctttaatttccctgttagtcttaagagtcatttattggctctgct tctttcccag
quality values	Open. Hide. 38 24 19 29 58 31 21 54 58 62 62 47 52 62 62 62 56 53 62 62 62 62 62 62 62 54 62 54 62 47 62 62 42 51 31 28 21 24 27 23 28 28 33 49 38 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 42 42 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 54 54 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 43 37 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 49 58 58 58 58 54 54 58 54 58 58 58 58 58 58 54 58 58 58 58 58 34 54 58 52 58 58 54 58 54 45 42 58 54 58 58 58 43 58 58 52 51 58 58 58 45 48 58 49 58 58 58 58 49 40 48 51 58 45 41 54 58 54 58 58 40 58 58 41 33 58 58 49 58 58 46 39 58 58 51 58 58 53 58 58 48 47 58 58 51 51 50 58 52 58 53 51 58 52 58 48 38 44 41 58 46 37 58 49 51 41 42 54 52 51 50 58 49 58 58 54 53 54 58 49 52 37 58 58 58 58 54 53 42 50 52 46 58 53 29 49 51 58 33 58 50 52 53 53 53 29 40 37 54 49 51 49 54 54 54 39 45 42 53 45 53 49 40 37 54 54 39 24 54 44 52 51 53 51 51 33 24 49 52 40 49 35 54 53 43 45 53 37 26 30 18 54 54 47 52 53 32 47 32 53 53 53 39 53 42 33 33 33 53 54 32 52 35 35 53 53 45 53 53 32 32 31 36 52 51 49 32 45 42 52 53 49 37 52 49 49 49 40 32 46 33 37 52 27 33 38 24 52 33 41 39 53 41 46 32 16 40 36 23 31 31 51 31 38 41 42 43 51 42 23 47 33 31 35 31 31 31 25 29 51 31 18 36 29 34 35 42 18 46 23 35 30 41 31 41 32 24 40 32 43 31 32 38 35 31 32 32 24 42 26 31 38 32 38 31 32 32 46 33 29 31 31 24 31 31 31 36 36 31 37 31 31 31 37 35 47 32 24 30 18 41 38 36 18 17 9 30 16 35 31 34 33 46 46 20 21 14 21 44 30 31 32 24 24 15 36 13 30 21 27 26 25 16 29 21 30 23 31 33 47 31 38 24 36 36 19 34 34 26 26 25 30 31 28 21 29 16 32 27 32 18 25 32 33 27 24 21 25 25 19 28 13 48 16 33 28 32 33 19 12 39 11 24 33 33 20 47 24 32 29 26 48 31 8 10 34 9 8 20 22 21 48 29 12 22 24 28 27 26 27 28 24 7 15 11 20 34 27 9 34 13 7 13 16 21 9 31 11 22 16 25 24 18 22 17 28 24 28 13 16 23 27 4 5 9 14 21 20 16 25 6 4 16 20 29 14 16 5 34 14 28 9 9 6 4 5 5 8 16 25 30 17 5 3 3 3 7 25 30 17 7 9 20 29 16 16 11 9 6 12 20 19 16 17 13 8 22 12 3 7 22 6 10 15 26 8 22 9 20 10 6 8 13 5 14 5 5 3 4 15 5 6 14 6 4 4 6 8 7 6 17 5 7 6 16 29 30 18 8 7 7 7 8 5 5 8 4 4 7 5 11 8 9 7 11 4 11 5 1 3 4 6 6 4 11 5 2 2 11 12 8 10 16 9 7 2 3 5	Open. Hide. 62 47 43 47 62 62 62 47 62 62 62 62 39 32 25 27 24 15 21 38 43 38 62 62 62 62 62 62 62 62 62 62 62 49 46 39 62 62 62 62 62 62 62 54 38 62 54 59 62 62 62 59 62 54 62 62 62 59 37 54 56 54 42 45 59 56 49 62 59 62 59 54 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 48 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 42 58 58 58 58 58 58 54 54 58 58 58 54 52 58 47 58 58 54 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 49 39 58 58 54 39 58 54 58 58 54 58 54 52 58 58 58 51 51 58 58 58 51 50 50 51 58 58 58 51 58 46 53 54 54 58 58 51 48 47 54 49 54 52 53 58 58 51 50 54 51 34 40 52 51 58 49 50 58 58 58 26 41 50 48 58 50 58 58 58 58 37 37 42 51 32 58 51 52 58 49 51 53 40 58 58 51 51 58 54 48 49 58 49 53 46 40 51 41 40 50 58 58 52 45 46 51 50 49 50 35 58 54 27 44 15 31 42 39 58 42 24 53 39 58 58 50 50 54 51 41 54 39 53 53 53 54 51 41 33 50 58 58 50 53 31 41 34 34 42 24 32 15 54 41 35 32 52 54 41 37 34 51 35 53 54 38 40 53 23 31 24 42 40 53 41 36 35 32 34 49 54 54 49 52 33 53 53 49 35 54 54 47 36 22 18 54 54 54 38 31 47 47 31 52 45 43 45 53 24 37 41 35 45 39 40 40 31 37 51 46 32 17 40 34 31 51 36 25 18 51 26 38 52 26 19 45 31 33 40 53 48 31 34 42 34 41 31 32 18 27 32 29 26 45 33 31 51 48 27 29 51 38 31 42 30 30 36 42 38 31 34 42 30 26 42 24 46 30 29 33 29 11 25 25 37 31 31 20 30 32 30 38 43 29 46 30 34 32 22 42 24 31 37 31 31 31 26 42 30 22 25 31 48 48 33 24 30 31 42 32 43 31 31 31 35 34 25 31 32 35 31 30 31 41 46 36 30 16 30 32 31 46 46 31 31 25 47 36 24 37 26 32 21 16 43 32 31 31 26 11 18 11 19 25 33 38 22 33 48 34 26 24 29 10 5 8 28 33 41 25 10 19 27 17 44 13 33 22 13 6 24 21 13 44 37 39 32 14 15 21 23 32 17 14 24 22 33 18 11 15 9 31 10 37 22 34 32 21 20 19 10 33 8 19 21 16 6 5 12 11 33 20 23 29 27 17 10 12 23 7 3 9 21 8 15 13 13 16 20 22 8 9 18 21 13 15 17 34 21 11 40 13 14 21 8 5 7 12 5 6 7 11 7 13 6 6 5 18 8 6 15 27 15 16 8 15 11 27 9 11 9 10 8 19 19 7 11 5 27 20 11 38 24 10 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_84995480_84996638
seq2: B6Ng01-295C10.b_50_1212 (reverse)

seq1  CCTGTG-AGTAACCCCTCAC-CCATTAGTCTCTCTCAT--CAAAAG--AA  44
      |||||| ||||| ||||||| |||||||||||   |||  ||||||  | 
seq2  CCTGTGAAGTAA-CCCTCACTCCATTAGTCTCCTCCATTACAAAAGGAAG  49

seq1  GTCACGAAGCACCCTGCT-ACGGAGGGGCTCCGGTCTGGGATGATTGAAA  93
      ||||||| |||  ||||| ||||||||||||| |||| ||||||||||||
seq2  GTCACGAGGCA-TCTGCTAACGGAGGGGCTCC-GTCT-GGATGATTGAAA  96

seq1  GTAAAGTTGGCAAAAGGAAGGTCCTGAAGGGTC-AGAGCCCACTGGAGGA  142
      |||||| ||   ||||||||   ||||| |||| |||||||||| |||||
seq2  GTAAAGGTG--CAAAGGAAG--TCTGAAAGGTCAAGAGCCCACT-GAGGA  141

seq1  GATGCTGAC-GGCAGA-CCAAAGGCTCAGTCAGTCCCTGTGG-ACCCGCA  189
      ||||||||| |||||| ||||||||||||||||||||||||| |||||||
seq2  GATGCTGACGGGCAGACCCAAAGGCTCAGTCAGTCCCTGTGGAACCCGCA  191

seq1  AAGCA-TTAGTGG-AAGGCAATGTCGGTCTACCGAGGAAGAAGGCTAAAG  237
      ||||| ||||||| ||||||||||||||||||||||||||||||||||||
seq2  AAGCATTTAGTGGAAAGGCAATGTCGGTCTACCGAGGAAGAAGGCTAAAG  241

seq1  CTTCAAGCGCCTCTTGATTTCCTTTTCACATCCTACTGCCTTTCACAAGG  287
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAGCGCCTCTTGATTTCCTTTTCACATCCTACTGCCTTTCACAAGG  291

seq1  GCTGTGTGCCCTGATGACTCTACAGCAGCGGTTCTCAACCTTCCTAACAC  337
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTGTGCCCTGATGACTCTACAGCAGCGGTTCTCAACCTTCCTAACAC  341

seq1  TGCGACCCTTTAATACAGTTCCTCACACTGTGGCGGCGGCCCCCAAACAT  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGACCCTTTAATACAGTTCCTCACACTGTGGCGGCGGCCCCCAAACAT  391

seq1  AAAATTGTTTTCATTGCTTCTTCATAACTGTAATTTTGCTGCTGTTGTGA  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTGTTTTCATTGCTTCTTCATAACTGTAATTTTGCTGCTGTTGTGA  441

seq1  ATCAGAATTTGAATGTCTGTGTTTTCTGATGGTCTTAGGCCATGCCTGTG  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGAATTTGAATGTCTGTGTTTTCTGATGGTCTTAGGCCATGCCTGTG  491

seq1  AAAGGGTGGGACCCACACGTTGAGAACCATTTGCTCTGTATGGAGGCCCA  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGGTGGGACCCACACGTTGAGAACCATTTGCTCTGTATGGAGGCCCA  541

seq1  CATAGGCCCACCATCCCTCACCTGGATTAGCGCCTTGGACCTGGGCCAGC  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGGCCCACCATCCCTCACCTGGATTAGCGCCTTGGACCTGGGCCAGC  591

seq1  ATCTCTGTAGTGCAGGTATGCTTGCCTGCTGCCACAGCTGGGGCTTCTAA  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTGTAGTGCAGGTATGCTTGCCTGCTGCCACAGCTGGGGCTTCTAA  641

seq1  TTAATTACAGATTTGAGTGCATTTGTTTGCTTTGCATTTAGAAGGCAGCC  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTACAGATTTGAGTGCATTTGTTTGCTTTGCATTTAGAAGGCAGCC  691

seq1  AGGAAATAAACATACGTTAGGCAAATGAATTATTCCTCTTTCCTTCCCTG  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAATAAACATACGTTAGGCAAATGAATTATTCCTCTTTCCTTCCCTG  741

seq1  CCGGGGTGTCCTGACACGCCTAAAGCGACGAGCTCAGAAGAGCTCACTTT  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGGGTGTCCTGACACGCCTAAAGCGACGAGCTCAGAAGAGCTCACTTT  791

seq1  GGGGTTCTGATGGCTTCACAGACTCCAGCAGAAAGGAACACGAAGCTCCT  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTTCTGATGGCTTCACAGACTCCAGCAGAAAGGAACACGAAGCTCCT  841

seq1  TTCTCCGTATCCTGGGGACCACCACTTGAGAGTGCCACCCTCAGATGGCT  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCCGTATCCTGGGGACCACCACTTGAGAGTGCCACCCTCAGATGGCT  891

seq1  CCTAGCTTCAGATGAGAACTCTGAGCCCTTGGCGACTAAGTCACACAGAC  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGCTTCAGATGAGAACTCTGAGCCCTTGGCGACTAAGTCACACAGAC  941

seq1  AGTGAGGACTGGAACTCAGGCATCTTGCTCCTGAAAGCACGCTTGGCCAT  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAGGACTGGAACTCAGGCATCTTGCTCCTGAAAGCACGCTTGGCCAT  991

seq1  TGTGTGGCCGTCTCGTGGCAGGGCAAGCTTCAGCTCTGCACCTTCACCTT  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGGCCGTCTCGTGGCAGGGCAAGCTTCAGCTCTGCACCTTCACCTT  1041

seq1  CTACGTTCTCTTACTCTCTCTCTCTAGGTAAGGCCATGAACAATGGGGAC  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACGTTCTCTTACTCTCTCTCTCTAGGTAAGGCCATGAACAATGGGGAC  1091

seq1  GCATGTTCTAAGGGAATTACATAGCACATAGCTTTAAACAAGGTACTCAG  1137
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGTTCTAAGGGAATTACATAGCACATAGCTTTAAACAAGGTACTCAG  1141

seq1  TATATGTTTGCCAACTGAATTC  1159
      ||||||||||||||||||||||
seq2  TATATGTTTGCCAACTGAATTC  1163

seq1: chr15_84832122_84833176
seq2: B6Ng01-295C10.g_68_1127

seq1  GAATTCCGCCTCCAGGGAGTCTTCCTGGCCTGGGACGGGCCTTGTTTAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCGCCTCCAGGGAGTCTTCCTGGCCTGGGACGGGCCTTGTTTAGT  50

seq1  CAGCCTTGTCTGCGCAGTTACTCATTGACATCTTCTAAGGGACAGTCACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTTGTCTGCGCAGTTACTCATTGACATCTTCTAAGGGACAGTCACA  100

seq1  TTCACAGGCTGGAAGTAAGGCTGCATCACTCACCATCCCGGAATGATCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACAGGCTGGAAGTAAGGCTGCATCACTCACCATCCCGGAATGATCCT  150

seq1  CAGGGGATACCTTTGAGGGCTGGAGCCTTTTGCAACAGTCTGGTATCTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGGATACCTTTGAGGGCTGGAGCCTTTTGCAACAGTCTGGTATCTTA  200

seq1  GGTGGAGGAACCCTGCCTGAGAACTCTTACTTAATCATGCTCCCTTAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGAGGAACCCTGCCTGAGAACTCTTACTTAATCATGCTCCCTTAGGG  250

seq1  CTGACTAGTCCTTCTGAGCCCGGAAAAAGAGGCTTCTAGGCTTGCCCTGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACTAGTCCTTCTGAGCCCGGAAAAAGAGGCTTCTAGGCTTGCCCTGA  300

seq1  AAATGACCTTGGTGTCCACCTTGGCCTTGCTTAGACTATTTCCAGATGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGACCTTGGTGTCCACCTTGGCCTTGCTTAGACTATTTCCAGATGGT  350

seq1  CCTGGTCCTTCTGAGCCTCTGCTTGCTGGCATGGAAGGTTCATTCGAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTCCTTCTGAGCCTCTGCTTGCTGGCATGGAAGGTTCATTCGAGAA  400

seq1  ACAGGTCCTGCATTTGGGAGTAGTTACAAGGCTCCGCTTAAAAGTGGACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGTCCTGCATTTGGGAGTAGTTACAAGGCTCCGCTTAAAAGTGGACA  450

seq1  CCTATAACACATAGTCTGGAAGACATTCTGTCATCCCTGAAGCAATGTCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATAACACATAGTCTGGAAGACATTCTGTCATCCCTGAAGCAATGTCT  500

seq1  CTCTCGTGGTTGGATTTGAATGTGCTAGAACATTCAGCCCTGGGTCTGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCGTGGTTGGATTTGAATGTGCTAGAACATTCAGCCCTGGGTCTGTG  550

seq1  GCTGGCCCAGGTGCTGGCCCCTGGCTCACATGAGCACAGTGCAGATCATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCCCAGGTGCTGGCCCCTGGCTCACATGAGCACAGTGCAGATCATG  600

seq1  CCAAGACAGGACTGAGACTGTCTGGATTCAAATGCTAGCTTCTGCTCTCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGACAGGACTGAGACTGTCTGGATTCAAATGCTAGCTTCTGCTCTCC  650

seq1  ATAGCTGTATGTCAGGAGGAAATGGTCAAAACCTACGTGTGCCAGGGCTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCTGTATGTCAGGAGGAAATGGTCAAAACCTACGTGTGCCAGGGCTA  700

seq1  CCCCGAGGATTCCCAGGTAAAGGTTAATGATTAGTTTTGCTCTTGGGCTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCGAGGATTCCCAGGTAAAGGTTAATGATTAGTTTTGCTCTTGGGCTA  750

seq1  AAAAGCCACCACCAGATGTCCAGGGAGCTGGGAGAGAAAGGATAAAGCTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCCACCACCAGATGTCCAGGGAGCTGGGAGAGAAAGGATAAAGCTG  800

seq1  GCTTGGACCTGGGATGGCCGTGAACTCTGAGAACTAGGCTTAGGAATGCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGGACCTGGGATGGCCGTGAACTCTGAGAACTAGGCTTAGGAATGCC  850

seq1  CTAGGCTGTCCTTACCTTTTCCTAGAGTGACAGCACATGGGGTATGGGGA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGCTGTCCTTACCTTTTCCTAGAGTGACAGCACATGGGGTATGGGGA  900

seq1  GGGTCTGTTCTCTAGAGAGGACTTTGCCCAGGGGGGTCAGAGTTCAGGTC  950
      |||||||||||||||||||||||||||||| ||||||||||||||| |||
seq2  GGGTCTGTTCTCTAGAGAGGACTTTGCCCA-GGGGGTCAGAGTTCA-GTC  948

seq1  CTTTCATGAGGATGTAGGAGATGACCATAAAGTAAT-AGGCAGGAGGCCT  999
      |||||||||||||||||||||||||||| ||||||| |||||||| | ||
seq2  CTTTCATGAGGATGTAGGAGATGACCAT-AAGTAATAAGGCAGGAAG-CT  996

seq1  GGGGCTCGGGCTTAATTT-CCTG-TAGTCTT-AGAGTCATT--ATGG--C  1042
      |||||||||  ||||||| |||| ||||||| |||||||||   |||  |
seq2  GGGGCTCGGCTTTAATTTCCCTGTTAGTCTTAAGAGTCATTTATTGGCTC  1046

seq1  TGCTTC-TTCCCAG  1055
      |||||| |||||||
seq2  TGCTTCTTTCCCAG  1060

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information