MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-328B05
Chromosome	15 (Build37)
Map Location	73,716,145 - 73,866,597
singlet/doublet	doublet
Overlap gene	LOC100040966
Upstream gene	1810044A24Rik, LOC100041120, Chrac1, Eif2c2, Ptk2, LOC666053, LOC100040929, Dennd3, Slc45a4, Gpr20, LOC100040946, pPtp4a3, Gm628, LOC100041273, EG625276
Downstream gene	EG666113, LOC100041307, LOC100040984, Bai1, 1700016M24Rik, Arc, Jrk, 4933427E11Rik, Psca, 4930572J05Rik, Slurp1, Lypd2, 2300005B03Rik, Lynx1, Ly6d, D730001G18Rik, Ly6k, Gml, Hemt1, Cyp11b1, Cyp11b2, 2010109I03Rik, LOC625653, Ly6e, Ly6i, LOC666240, LOC100041528, Ly6a
Link	Open Mouse BAC browser

Click to get alignment info.

name	1810044A24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76510 MGI:1923760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041120 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 185 ESTs, 7 Proteins

name	Chrac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93696 MGI:2135796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239528 MGI:2446632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14083 MGI:95481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 64 ESTs, 6 Proteins pseudo : _no_value

name	LOC100040929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1186 ESTs, 9 Proteins

name	Dennd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105841 MGI:2146009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc45a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106068 MGI:2146236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239530 MGI:2441803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	pPtp4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19245 MGI:1277098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm628 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268816 MGI:2685474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 225 ESTs, 4 Proteins

name	EG625276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625276 MGI:3647277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG666113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666113 MGI:3646370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 164 ESTs, 9 Proteins

name	LOC100041307 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 902 ESTs, 23 Proteins

name	LOC100040984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Bai1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107831 MGI:1933736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69439 MGI:1916689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 2 Proteins

name	Arc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11838 MGI:88067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16469 MGI:106214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933427E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66769 MGI:1914019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 5 ESTs

name	Psca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72373 MGI:1919623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930572J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223626 MGI:1925301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slurp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57277 MGI:1930923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lypd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68311 MGI:1915561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2300005B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69462 MGI:1916712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lynx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23936 MGI:1345180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17068 MGI:96881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D730001G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78725 MGI:1925975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76486 MGI:1923736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625599 MGI:3644767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Hemt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15202 MGI:1341831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp11b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110115 MGI:88583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp11b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13072 MGI:88584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010109I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67038 MGI:1914288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625653 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ly6e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17069 MGI:106651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57248 MGI:1888480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666240 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	LOC100041528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ly6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110454 MGI:107527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810044A24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68264925 GeneID:76510 MGI:1923760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810044A24 gene transcript_id : NM_180662.1

name	1810044A24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30840991 GeneID:76510 MGI:1923760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810044A24 gene transcript_id : NM_029640.1

name	LOC100041120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266659 GeneID:100041120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 185 ESTs, 7 Proteins product : similar to G protein gamma-5 subunit transcript_id : XM_001476327.1

name	Chrac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365642 GeneID:93696 MGI:2135796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin accessibility complex 1 transcript_id : NM_053068.3

name	Eif2c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859782 GeneID:239528 MGI:2446632
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 2 transcript_id : NM_153178.2

name	Ptk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679740 GeneID:14083 MGI:95481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTK2 protein tyrosine kinase 2 transcript_id : NM_007982.1

name	LOC100040929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266642 GeneID:100040929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1186 ESTs, 9 Proteins product : similar to Rpl17 protein transcript_id : XM_001475503.1

name	Dennd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486709 GeneID:105841 MGI:2146009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 3 transcript_id : NM_001081066.1

name	Slc45a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380401 GeneID:106068 MGI:2146236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 45, member 4 transcript_id : NM_001033219.2

name	Gpr20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378498 GeneID:239530 MGI:2441803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 20 transcript_id : NM_173365.2

name	pPtp4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543526 GeneID:19245 MGI:1277098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase 4a3 transcript_id : NM_008975.2

name	Gm628 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803126 GeneID:268816 MGI:2685474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 628, (NCBI) transcript_id : NM_001033365.2

name	LOC100041273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266668 GeneID:100041273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 225 ESTs, 4 Proteins product : similar to NADH dehydrogenase 1 beta subcomplex 4 transcript_id : XM_001476571.1

name	EG625276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398717 GeneID:625276 MGI:3647277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG625276 transcript_id : XM_898698.2

name	EG666113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266670 GeneID:666113 MGI:3646370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 164 ESTs, 9 Proteins product : predicted gene, EG666113 transcript_id : XM_981687.2

name	LOC100041307 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266673 GeneID:100041307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 902 ESTs, 23 Proteins product : similar to high-mobility group box 1 transcript_id : XM_001476607.1

name	LOC100040984 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266644 GeneID:100040984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to T-SNARE domain containing 1 transcript_id : XM_001475612.1

name	Bai1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110032 GeneID:107831 MGI:1933736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 1 transcript_id : NM_174991.3

name	1700016M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398720 GeneID:69439 MGI:1916689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 2 Proteins product : RIKEN cDNA 1700016M24 gene transcript_id : XM_128161.5

name	Arc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86604725 GeneID:11838 MGI:88067
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activity regulated cytoskeletal-associated protein transcript_id : NM_018790.2

name	Jrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802891 GeneID:16469 MGI:106214
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jerky transcript_id : NM_008415.4

name	Psca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312315 GeneID:72373 MGI:1919623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostate stem cell antigen transcript_id : NM_028216.1

name	4930572J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348459 GeneID:223626 MGI:1925301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930572J05 gene transcript_id : NM_198607.1

name	Slurp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048457 GeneID:57277 MGI:1930923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted Ly6/Plaur domain containing 1 transcript_id : NM_020519.1

name	Lypd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625682 GeneID:68311 MGI:1915561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/Plaur domain containing 2 transcript_id : NM_026671.1

name	2300005B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517475 GeneID:69462 MGI:1916712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2300005B03 gene transcript_id : NM_001081961.1

name	Lynx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802112 GeneID:23936 MGI:1345180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/neurotoxin 1 transcript_id : NM_011838.3

name	Ly6d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754583 GeneID:17068 MGI:96881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus D transcript_id : NM_010742.1

name	D730001G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367552 GeneID:78725 MGI:1925975
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D730001G18 gene transcript_id : NM_172433.2

name	Ly6k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54144476 GeneID:76486 MGI:1923736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus K transcript_id : NM_029627.1

name	Gml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266681 GeneID:625599 MGI:3644767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : GPI anchored molecule like protein, transcript variant 1 transcript_id : XM_001476885.1

name	Gml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266683 GeneID:625599 MGI:3644767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : GPI anchored molecule like protein, transcript variant 2 transcript_id : XM_001476898.1

name	Hemt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662775 GeneID:15202 MGI:1341831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic cell transcript 1 transcript_id : NM_010416.2

name	Cyp11b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803200 GeneID:110115 MGI:88583
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 11, subfamily b, polypeptide 1 transcript_id : NM_001033229.2

name	Cyp11b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9845247 GeneID:13072 MGI:88584
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 11, subfamily b, polypeptide 2 transcript_id : NM_009991.2

name	2010109I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842381 GeneID:67038 MGI:1914288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010109I03 gene transcript_id : NM_025929.2

name	Ly6e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982210 GeneID:17069 MGI:106651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus E transcript_id : NM_008529.2

name	Ly6i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21356650 GeneID:57248 MGI:1888480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus I transcript_id : NM_020498.1

name	LOC100041528 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266690 GeneID:100041528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100041528 transcript_id : XM_001477057.1

name	Ly6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981636 GeneID:110454 MGI:107527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus A transcript_id : NM_010738.2

name	1810044A24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68264926 GeneID:76510 MGI:1923760
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; Ikk2 binding protein; NIK and IKK(beta) binding protein product : NIK and IKK(beta) binding protein isoform 2 protein_id : NP_850993.1

name	1810044A24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30840992 GeneID:76510 MGI:1923760
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Ikk2 binding protein; NIK and IKK(beta) binding protein product : NIK and IKK(beta) binding protein isoform 1 protein_id : NP_083916.1

name	LOC100041120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266660 GeneID:100041120
definition	codon_start : 1 product : similar to G protein gamma-5 subunit protein_id : XP_001476377.1

name	Chrac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18860511 CCDS:CCDS27516.1 GeneID:93696 MGI:2135796
definition	GO_component : GO:0008623 - chromatin accessibility complex [Evidence ISS]; GO:0008622 - epsilon DNA polymerase complex [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0003893 - epsilon DNA polymerase activity [Evidence ISS]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence ISS] codon_start : 1 note : NF-YC-like protein product : chromatin accessibility complex 1 protein_id : NP_444298.1

name	Eif2c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859783 GeneID:239528 MGI:2446632
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation function : siRNA-mediated RNAi? note : GERp95; Piwi/Argonaute family protein meIF2C2; argonaute 2 product : eukaryotic translation initiation factor 2C, 2 protein_id : NP_694818.2

name	Ptk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679741 GeneID:14083 MGI:95481
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0006928 - cell motility [Evidence TAS]; GO:0040023 - establishment of nucleus localization [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence TAS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IDA]; GO:0046621 - negative regulation of organ size [Evidence IGI]; GO:0001764 - neuron migration [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : focal adhesion kinase product : PTK2 protein tyrosine kinase 2 protein_id : NP_032008.1

name	LOC100040929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266643 GeneID:100040929
definition	codon_start : 1 product : similar to Rpl17 protein protein_id : XP_001475553.1

name	Dennd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486710 GeneID:105841 MGI:2146009
definition	codon_start : 1 product : DENN/MADD domain containing 3 protein_id : NP_001074535.1

name	Slc45a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701720 CCDS:CCDS27517.1 GeneID:106068 MGI:2146236
definition	codon_start : 1 exception : mismatches in translation product : solute carrier family 45, member 4 protein_id : NP_001028391.1

name	Gpr20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734082 CCDS:CCDS27518.1 GeneID:239530 MGI:2441803
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR20 product : G protein-coupled receptor 20 protein_id : NP_775541.1

name	pPtp4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543527 CCDS:CCDS27519.1 GeneID:19245 MGI:1277098
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase 4a3 protein_id : NP_033001.2

name	Gm628 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701862 CCDS:CCDS27520.1 GeneID:268816 MGI:2685474
definition	codon_start : 1 product : hypothetical protein LOC268816 protein_id : NP_001028537.1

name	LOC100041273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266669 GeneID:100041273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476621.1

name	EG625276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957475 GeneID:625276 MGI:3647277
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903791.1

name	EG666113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398719 GeneID:666113 MGI:3646370
definition	codon_start : 1 product : similar to Splicing factor 3b, subunit 4 protein_id : XP_986781.1

name	LOC100041307 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266674 GeneID:100041307
definition	codon_start : 1 product : similar to high-mobility group box 1 protein_id : XP_001476657.1

name	LOC100040984 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266645 GeneID:100040984
definition	codon_start : 1 product : similar to T-SNARE domain containing 1 protein_id : XP_001475662.1

name	Bai1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92110033 GeneID:107831 MGI:1933736
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016525 - negative regulation of angiogenesis [Evidence ISS]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : brain-specific angiogenesis inhibitor 1 protein_id : NP_778156.2

name	1700016M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20902547 GeneID:69439 MGI:1916689
definition	codon_start : 1 product : hypothetical protein LOC69439 protein_id : XP_128161.1

name	Arc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055166 GeneID:11838 MGI:88067
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence TAS] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007492 - endoderm development [Evidence IMP] codon_start : 1 product : activity regulated cytoskeletal-associated protein protein_id : NP_061260.1

name	Jrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543012 CCDS:CCDS27524.1 GeneID:16469 MGI:106214
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA]; GO:0005840 - ribosome [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : jerky protein_id : NP_032441.3

name	Psca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312316 CCDS:CCDS27526.1 GeneID:72373 MGI:1919623
definition	GO_component : GO:0016020 - membrane [Evidence TAS] codon_start : 1 product : prostate stem cell antigen protein_id : NP_082492.1

name	4930572J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348460 CCDS:CCDS27527.1 GeneID:223626 MGI:1925301
definition	codon_start : 1 product : mesenchymal stem cell protein DSCD75 homolog protein_id : NP_941009.1

name	Slurp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048458 CCDS:CCDS27528.1 GeneID:57277 MGI:1930923
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] codon_start : 1 note : secreted Ly-6/uPAR related protein 1 product : Ars component B protein_id : NP_065265.1

name	Lypd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625683 CCDS:CCDS27529.1 GeneID:68311 MGI:1915561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : Ly6/Plaur domain containing 2 protein_id : NP_080947.1

name	2300005B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517476 GeneID:69462 MGI:1916712
definition	codon_start : 1 note : secreted Ly6/uPAR related protein-2 product : secreted Ly6/uPAR related protein 2 protein_id : NP_001075430.1

name	Lynx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106349 CCDS:CCDS27530.1 GeneID:23936 MGI:1345180
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0030550 - acetylcholine receptor inhibitor activity [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0008200 - ion channel inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IC] codon_start : 1 product : Ly6/neurotoxin 1 protein_id : NP_035968.1

name	Ly6d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754584 CCDS:CCDS27531.1 GeneID:17068 MGI:96881
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0030377 - U-plasminogen activator receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus D protein_id : NP_034872.1

name	D730001G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369575 GeneID:78725 MGI:1925975
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC78725 protein_id : NP_766021.1

name	Ly6k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54144477 CCDS:CCDS27532.1 GeneID:76486 MGI:1923736
definition	codon_start : 1 product : lymphocyte antigen 6 complex, locus K protein_id : NP_083903.1

name	Gml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266682 GeneID:625599 MGI:3644767
definition	codon_start : 1 product : similar to HemT-3 protein isoform 1 protein_id : XP_001476935.1

name	Gml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266684 GeneID:625599 MGI:3644767
definition	codon_start : 1 product : similar to HemT-3 protein isoform 2 protein_id : XP_001476948.1

name	Hemt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662776 CCDS:CCDS27534.1 GeneID:15202 MGI:1341831
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hematopoietic cell-specific transcript product : hematopoietic cell transcript 1 protein_id : NP_034546.2

name	Cyp11b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370298 CCDS:CCDS27535.1 GeneID:110115 MGI:88583
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : steroid-11-beta-hydroxylase product : cytochrome P450, family 11, subfamily b, polypeptide 1 protein_id : NP_001028401.1

name	Cyp11b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106287 CCDS:CCDS27536.1 GeneID:13072 MGI:88584
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0047783 - corticosterone 18-monooxygenase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004507 - steroid 11-beta-monooxygenase activity [Evidence IEA] GO_process : GO:0002017 - aldosterone mediated regulation of body fluids [Evidence IMP]; GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0042756 - drinking behavior [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0050801 - ion homeostasis [Evidence IMP]; GO:0001991 - regulation of blood pressure by circulatory renin-angiotensin [Evidence IMP] codon_start : 1 exception : mismatches in translation note : steroid-11-beta-hydroxylase; aldosterone synthase product : cytochrome P450, family 11, subfamily b, polypeptide 2 protein_id : NP_034121.1

name	2010109I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385422 CCDS:CCDS27537.1 GeneID:67038 MGI:1914288
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0009405 - pathogenesis [Evidence IEA] codon_start : 1 product : intectin protein_id : NP_080205.1

name	Ly6e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678748 CCDS:CCDS27538.1 GeneID:17069 MGI:106651
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus E protein_id : NP_032555.1

name	Ly6i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21356651 CCDS:CCDS27539.1 GeneID:57248 MGI:1888480
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lymphocyte antigen 6M protein_id : NP_065244.1

name	LOC100041528 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266691 GeneID:100041528
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477107.1

name	Ly6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754580 CCDS:CCDS27540.1 GeneID:110454 MGI:107527
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus A protein_id : NP_034868.1

name	LOC100040946 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040946
definition	number : 2 pseudo : _no_value

name	LOC100040946 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040946
definition	number : 1 pseudo : _no_value

name	LOC100040966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040966
definition	number : 1 pseudo : _no_value

name	LOC100040966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040966
definition	number : 2 pseudo : _no_value

name	LOC100040966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040966
definition	number : 3 pseudo : _no_value

name	LOC625653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625653
definition	number : 1 pseudo : _no_value

name	LOC625653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625653
definition	number : 2 pseudo : _no_value

name	LOC625653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625653
definition	number : 3 pseudo : _no_value

name	LOC666053 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266663 GeneID:666053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 64 ESTs, 6 Proteins product : similar to protein tyrosine phosphatase-like protein PTPLB pseudo : _no_value transcript_id : XR_032745.1

name	4933427E11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266676 GeneID:66769 MGI:1914019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 5 ESTs product : RIKEN cDNA 4933427E11 gene transcript_id : XR_035306.1

name	LOC666240 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266689 GeneID:666240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to suppressor of cytokine signalling-2 pseudo : _no_value transcript_id : XR_033036.1

clone name	MSMg01-164E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-520H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417C04
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-340J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273C24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-328B05.b	B6Ng01-328B05.g
ACC	GA115435	GA115436
length	1,123	880
definition	B6Ng01-328B05.b	B6Ng01-328B05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(73,865,465 - 73,866,597)	(73,716,145 - 73,717,019)
sequence	gaattctctatccatcaggagataagttggcacacaggcaataatggagt agataggacactcatgcagaagggtttggggtgggacctgggatgaactg ggattcagagatgcttcccaggagaatggaggtacctacgggacactctt gtcttttgtgtggagaagctcctgatgggggcacaggtcaaagacttgtc catatcctcttccagacagagataatagaagctgggcacctggtcatagt aagaaagcagctgccaggctgtctgaccatgagagatgcctttgatcctt gcaggggctctggaaggctgggctggtagaacctgagtgagggctttgcc ctgggaggctgactctaggcttctccatcagtcagcaaagcccaggctgc ctcatctcctgggcccttcatctgggatttgtagaatgagatgtgatcca ctgtgagttctgctgatggggaagtcatttttctccctccctggagaaat taaaggtatgaagcttatggctggcaccataccaattggctcagcataaa aacatcaagagcaaaagcctcgcagaagtgttctggatttaggcaaagct tggagacttcctgacagggtgagatatggtcagacacagataccaggcac cccagcgacctgccagggtgccaggctctgcctttttcatgatctctgcc cctctccctccactcttcttttggtcacaagaggatgaaatggctgtcta ctggagtgtggaaaaatagacgtgaaacatttggaaaagcgttgagtaaa tattctatttccagatgccattgttaaaataattacacttattttaatag acttcatttttcagaacagttttaggttttaggaaatgtgtgcaaaaaaa aaaaaaaaaaaacaatctgaaggtattttaacagatgattaaacagtaat tgtcctagagaaccgggaagcaggcccctggccagcatattttctgaggc ctcagacccagtcacctcaggctctgtgtctggggatactacatgacaga gagtccagagtagccacttcccaggtctctttttataattctgagacacc cccagagaatgtccgtggcaccc	gaattcatgtctcttgctgccgttagaaggctggagcagtaggttctaca cgttggagctggccaggctcaaggaagtagaacatcccaggtcccacccc ctcatctctacacatagcctctatctctgcatgccaggactcacagaaag caggaaataggggacacaccctatcctgtatggagagggttgtagcccag agggggaatgtatgtgatgggggatgtgtctcattcataggagcctagag ggcaggctgtatgtggagacaacctgatagtggagtattgagaactttgt tgggaatggaagtctatgtaggtcatagcgaacagcctatgtaaccatag tgacgtgccaaccagtgctacaggctgaactaacccaggcaggggacatg ccagaggaaggaggtatcatccattggagggccttgaagtggccttgaag gataggaaacctggaagtgttggctctgctgcttttttgatcatgaccct tgtgtcccagctccactagcctctctcttccccagatgacaaccatgttg ttttcaaggtcatgcctttgtatctaggcataaggtgacagtggtacagt agtcccagaagcctcctgggtctgtccttgtctcctagatcctgaactct ccttccaaagcctcagttcagctcatgggctcagatttggggtctgacta cgggaggtgccctgcatcacagggacccgggtagcatgcctgtctagcta tacagtgtgcatctgtttggtatagcacgtggtgtcagtgaggctccatg tgttccccgtactggtacttaggcctagctaactttttacccagcctgtc cttggttatgggggatatccccatggactt
quality values	Open. Hide. 62 35 31 39 62 62 47 62 62 62 59 62 43 23 62 59 59 62 62 59 62 49 30 62 59 59 62 51 59 59 51 34 56 34 32 28 28 54 59 56 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 54 54 62 62 59 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 59 59 62 62 62 62 62 49 42 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 59 62 62 59 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 59 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 54 58 58 58 58 58 58 49 58 58 54 58 58 58 58 58 58 58 58 45 41 58 54 58 54 54 52 52 58 58 58 58 58 58 58 58 58 47 45 47 58 58 58 58 58 58 58 54 52 54 58 58 54 58 58 54 54 48 52 54 58 58 50 58 51 54 58 50 52 54 54 51 58 58 51 46 51 53 51 58 58 52 51 58 58 46 39 53 58 51 46 47 49 54 58 46 44 37 42 58 58 41 58 50 49 34 53 58 50 51 53 53 53 51 58 54 58 58 58 42 52 34 51 58 39 39 52 53 54 52 51 41 58 58 58 52 53 50 40 49 49 39 53 47 31 53 51 51 50 50 51 44 49 58 50 58 31 31 50 39 45 22 58 40 51 24 50 35 20 52 54 49 40 34 54 35 29 51 54 37 53 49 39 53 47 49 52 51 26 47 54 41 54 39 52 54 54 54 40 39 45 40 37 37 40 53 45 53 54 37 41 28 51 54 41 51 45 45 54 54 46 23 35 37 53 52 32 46 32 42 42 53 42 34 32 36 31 40 37 34 33 49 47 36 34 26 32 47 31 37 31 41 26 37 33 51 31 32 31 53 53 32 36 21 35 31 31 28 42 35 37 38 38 31 32 51 51 29 29 35 31 30 26 31 31 30 29 30 24 31 46 46 51 42 36 30 17 46 38 37 29 31 31 48 48 44 32 42 27 21 46 46 31 31 24 33 36 48 31 28 32 29 37 31 36 31 38 48 46 46 48 48 46 46 46 48 48 48 48 46 46 46 48 46 31 31 22 23 31 32 32 31 27 14 15 17 13 18 29 44 44 31 20 24 19 18 15 29 23 31 33 24 31 25 44 18 25 23 31 31 26 16 24 21 32 31 30 25 29 14 8 8 5 14 29 9 13 22 34 32 17 33 22 32 8 10 16 18 34 39 18 11 16 18 4 11 14 21 31 27 14 5 5 31 33 7 11 19 14 25 6 14 20 11 32 28 13 13 27 17 39 22 19 21 18 14 30 18 9 27 25 27 17 21 13 28 21 13 10 9 13 16 12 27 14 47 47 26 10 12 20 28 13 30 7 8 19 20 13 10 5 5 23 9 24 18 27 33 29 12 9 12 5 17 27 12 26 10 15 13 14 13 21 27 9 3 3 3 4 7 8 11 8 30 28 25 13 5 6 8 16 11 7 16 16 18 19 16 8 9 4 8 22 30 25 18 6 7 6 7 4 20 6 4 6 17 16 5 2 5 9 21 5 21 22 14	Open. Hide. 62 47 51 47 62 47 42 59 62 51 31 28 45 45 49 38 56 56 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 54 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 54 42 54 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 62 62 54 54 49 54 62 62 59 59 62 62 62 54 59 59 62 59 62 62 62 49 59 56 59 59 62 59 62 62 62 62 56 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 49 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 59 62 62 59 56 50 62 59 56 59 59 62 56 62 59 62 62 59 46 46 50 59 59 59 59 62 62 62 62 62 62 59 62 59 56 59 62 59 59 59 62 62 62 62 59 59 62 62 62 50 62 62 62 62 59 56 39 34 48 28 34 46 62 62 62 62 56 51 56 56 56 51 49 59 49 56 56 62 62 62 59 62 59 59 62 50 46 46 37 54 35 54 62 48 43 54 54 62 62 62 62 62 62 56 59 56 59 51 59 59 62 56 62 51 62 59 51 59 59 59 59 59 59 49 59 62 59 59 62 62 62 59 54 49 46 62 59 59 62 59 62 62 62 62 62 62 59 49 48 62 56 50 56 59 56 46 49 46 38 56 50 59 59 62 62 62 59 59 62 59 62 62 62 62 62 59 43 43 50 45 46 43 56 56 59 35 62 51 62 62 62 62 62 59 43 59 62 51 51 41 43 44 43 41 44 50 51 59 51 51 45 44 51 51 62 62 62 59 56 45 62 56 59 62 59 59 59 59 56 50 56 62 56 56 56 56 56 56 62 62 56 56 56 62 56 56 51 56 56 37 50 39 51 56 56 51 44 62 47 38 39 38 56 51 51 56 39 39 18 56 38 42 39 39 30 25 15 27 18 7 14 23 21 41 56 47 51 51 51 26 24 20 10 38 23 40 43 33 47 56 56 46 62 56 56 32 47 56 56 47 20 62 62 26 41 56 42 42 42 31 38 42 33 62 47 23 22 20 24 35 28 28 43 34 52 47 52 51 34 21 15 9 17 38 28 38 40 39 52 43 26 38 43 39 42 30 38 41 38 39 50 42 35 38 42 41 46 23 19 52 11 52 50 41 35 34 40 46 41 41 46 52 25 34 49 38 8 31 34 28 14 39 32 41 8 47 11 32 52 27 20 32 21 17 17 20 18 40 34 33 28 21 19 22 20 23 18 24 15 10 9 13 19 17 15 26 24 13 19 30 39 19 27 26 23 31 12 16 8 10 42 50 29 34 27 12 19 24 46 38 8 23 18 13 10 12 29 46 31 33 35 15 4 27 21 37 30 20 25 21 20 24 18 24 35 17 8 20 9 19 14 17 9 18 24 17 27 7 12 6 10 6 9 24 9 19 18 32 25 25 25 23 19 7 16 9 10 24 14 16 6 32 23 24 15 9 13 11 7 18 10 39 52 50 21 18 10 10 12 13 12 30 19 26 21 11 11 10 14 9 16 12 9 10 14 26 40 40 39 33 30 23 32 35 22 14 21 9 9 13 19 14 7 13 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_73865465_73866597
seq2: B6Ng01-328B05.b_47_1169 (reverse)

seq1  GGGTGCAACGGGACA-TCTCTGGGGGTGGTCCTCAGAATTTATAAAAGAG  49
      |||||| || ||||| ||||||||||||   |||||||||   |||||||
seq2  GGGTGCCAC-GGACATTCTCTGGGGGTG--TCTCAGAATTATAAAAAGAG  47

seq1  ACCCTGGGAAGTGGCTACTCTGGGACTCTCTGTCATGTTAGTATCCCCAA  99
      | ||||||||||||||||||| ||||||||||||||| |||||||||| |
seq2  A-CCTGGGAAGTGGCTACTCT-GGACTCTCTGTCATG-TAGTATCCCC-A  93

seq1  GACACAGAGCCTTGAGGTTGACTGGGTCTGAGGCCTCAG-AAATATGCTG  148
      ||||||||||| ||||| ||||||||||||||||||||| ||||||||||
seq2  GACACAGAGCC-TGAGG-TGACTGGGTCTGAGGCCTCAGAAAATATGCTG  141

seq1  GCCAGGGGCCCTGCTTCCCGGTTCTCCTAGGACAATTACTGTTTAATCAT  198
      |||||||| |||||||||||||||| ||||||||||||||||||||||||
seq2  GCCAGGGG-CCTGCTTCCCGGTTCT-CTAGGACAATTACTGTTTAATCAT  189

seq1  CTGTTAAAATACCTTCAGATTGTTTTTTTTTTTTTTTTTTTTGCACACAT  248
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  CTGTTAAAATACCTTCAGATTG-TTTTTTTTTTTTTTTTTTTGCACACAT  238

seq1  TTCCTAAAACCTAAAACTGTTCTGAAAAATGAAGTCTATTAAAATAAGTG  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTAAAACCTAAAACTGTTCTGAAAAATGAAGTCTATTAAAATAAGTG  288

seq1  TAATTATTTTAACAATGGCATCTGGAAATAGAATATTTACTCAACGCTTT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTATTTTAACAATGGCATCTGGAAATAGAATATTTACTCAACGCTTT  338

seq1  TCCAAATGTTTCACGTCTATTTTTCCACACTCCAGTAGACAGCCATTTCA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAATGTTTCACGTCTATTTTTCCACACTCCAGTAGACAGCCATTTCA  388

seq1  TCCTCTTGTGACCAAAAGAAGAGTGGAGGGAGAGGGGCAGAGATCATGAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTTGTGACCAAAAGAAGAGTGGAGGGAGAGGGGCAGAGATCATGAA  438

seq1  AAAGGCAGAGCCTGGCACCCTGGCAGGTCGCTGGGGTGCCTGGTATCTGT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCAGAGCCTGGCACCCTGGCAGGTCGCTGGGGTGCCTGGTATCTGT  488

seq1  GTCTGACCATATCTCACCCTGTCAGGAAGTCTCCAAGCTTTGCCTAAATC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGACCATATCTCACCCTGTCAGGAAGTCTCCAAGCTTTGCCTAAATC  538

seq1  CAGAACACTTCTGCGAGGCTTTTGCTCTTGATGTTTTTATGCTGAGCCAA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAACACTTCTGCGAGGCTTTTGCTCTTGATGTTTTTATGCTGAGCCAA  588

seq1  TTGGTATGGTGCCAGCCATAAGCTTCATACCTTTAATTTCTCCAGGGAGG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTATGGTGCCAGCCATAAGCTTCATACCTTTAATTTCTCCAGGGAGG  638

seq1  GAGAAAAATGACTTCCCCATCAGCAGAACTCACAGTGGATCACATCTCAT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAAATGACTTCCCCATCAGCAGAACTCACAGTGGATCACATCTCAT  688

seq1  TCTACAAATCCCAGATGAAGGGCCCAGGAGATGAGGCAGCCTGGGCTTTG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACAAATCCCAGATGAAGGGCCCAGGAGATGAGGCAGCCTGGGCTTTG  738

seq1  CTGACTGATGGAGAAGCCTAGAGTCAGCCTCCCAGGGCAAAGCCCTCACT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACTGATGGAGAAGCCTAGAGTCAGCCTCCCAGGGCAAAGCCCTCACT  788

seq1  CAGGTTCTACCAGCCCAGCCTTCCAGAGCCCCTGCAAGGATCAAAGGCAT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTTCTACCAGCCCAGCCTTCCAGAGCCCCTGCAAGGATCAAAGGCAT  838

seq1  CTCTCATGGTCAGACAGCCTGGCAGCTGCTTTCTTACTATGACCAGGTGC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCATGGTCAGACAGCCTGGCAGCTGCTTTCTTACTATGACCAGGTGC  888

seq1  CCAGCTTCTATTATCTCTGTCTGGAAGAGGATATGGACAAGTCTTTGACC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCTTCTATTATCTCTGTCTGGAAGAGGATATGGACAAGTCTTTGACC  938

seq1  TGTGCCCCCATCAGGAGCTTCTCCACACAAAAGACAAGAGTGTCCCGTAG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCCCCATCAGGAGCTTCTCCACACAAAAGACAAGAGTGTCCCGTAG  988

seq1  GTACCTCCATTCTCCTGGGAAGCATCTCTGAATCCCAGTTCATCCCAGGT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACCTCCATTCTCCTGGGAAGCATCTCTGAATCCCAGTTCATCCCAGGT  1038

seq1  CCCACCCCAAACCCTTCTGCATGAGTGTCCTATCTACTCCATTATTGCCT  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACCCCAAACCCTTCTGCATGAGTGTCCTATCTACTCCATTATTGCCT  1088

seq1  GTGTGCCAACTTATCTCCTGATGGATAGAGAATTC  1133
      |||||||||||||||||||||||||||||||||||
seq2  GTGTGCCAACTTATCTCCTGATGGATAGAGAATTC  1123

seq1: chr15_73716145_73717019
seq2: B6Ng01-328B05.g_67_946

seq1  GAATTCATGTCTCTTGCTGCCGTTAGAAGGCTGGAGCAGTAGGTTCTACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGTCTCTTGCTGCCGTTAGAAGGCTGGAGCAGTAGGTTCTACA  50

seq1  CGTTGGAGCTGGCCAGGCTCAAGGAAGTAGAACATCCCAGGTCCCACCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTGGAGCTGGCCAGGCTCAAGGAAGTAGAACATCCCAGGTCCCACCCC  100

seq1  CTCATCTCTACACATAGCCTCTATCTCTGCATGCCAGGACTCACAGAAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATCTCTACACATAGCCTCTATCTCTGCATGCCAGGACTCACAGAAAG  150

seq1  CAGGAAATAGGGGACACACCCTATCCTGTATGGAGAGGGTTGTAGCCCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAATAGGGGACACACCCTATCCTGTATGGAGAGGGTTGTAGCCCAG  200

seq1  AGGGGGAATGTATGTGATGGGGGATGTGTCTCATTCATAGGAGCCTAGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGGAATGTATGTGATGGGGGATGTGTCTCATTCATAGGAGCCTAGAG  250

seq1  GGCAGGCTGTATGTGGAGACAACCTGATAGTGGAGTATTGAGAACTTTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGCTGTATGTGGAGACAACCTGATAGTGGAGTATTGAGAACTTTGT  300

seq1  TGGGAATGGAAGTCTATGTAGGTCATAGCGAACAGCCTATGTAACCATAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAATGGAAGTCTATGTAGGTCATAGCGAACAGCCTATGTAACCATAG  350

seq1  TGACGTGCCAACCAGTGCTACAGGCTGAACTAACCCAGGCAGGGGACATG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACGTGCCAACCAGTGCTACAGGCTGAACTAACCCAGGCAGGGGACATG  400

seq1  CCAGAGGAAGGAGGTATCATCCATTGGAGGGCCTTGAAGTGGCCTTGAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAGGAAGGAGGTATCATCCATTGGAGGGCCTTGAAGTGGCCTTGAAG  450

seq1  GATAGGAAACCTGGAAGTGTTGGCTCTGCTGCTTTTTTGATCATGACCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGGAAACCTGGAAGTGTTGGCTCTGCTGCTTTTTTGATCATGACCCT  500

seq1  TGTGTCCCAGCTCCACTAGCCTCTCTCTTCCCCAGATGACAACCATGTTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCCCAGCTCCACTAGCCTCTCTCTTCCCCAGATGACAACCATGTTG  550

seq1  TTTTCAAGGTCATGCCTTTGTATCTAGGCATAAGGTGACAGTGGTACAGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCAAGGTCATGCCTTTGTATCTAGGCATAAGGTGACAGTGGTACAGT  600

seq1  AGTCCCAGAAGCCTCCTGGGTCTGTCCTTGTCTCCTAGATCCTGAACTCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCCAGAAGCCTCCTGGGTCTGTCCTTGTCTCCTAGATCCTGAACTCT  650

seq1  CCTTCCAAAGCCTCAGTTCAGCTCATGGGCTCAGATTT-GGGTCTGACTA  699
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CCTTCCAAAGCCTCAGTTCAGCTCATGGGCTCAGATTTGGGGTCTGACTA  700

seq1  CGGGAGGTG-CCTGCATCACAGGGACCCGGGTAGCATGCCTGTCTAGCTA  748
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  CGGGAGGTGCCCTGCATCACAGGGACCCGGGTAGCATGCCTGTCTAGCTA  750

seq1  TACAGTGTGCATCTG-TTGGTATAGCAGGTGGTGTCAGTGAGGCTCCATG  797
      ||||||||||||||| ||||||||||| ||||||||||||||||||||||
seq2  TACAGTGTGCATCTGTTTGGTATAGCACGTGGTGTCAGTGAGGCTCCATG  800

seq1  TGTTCACGGCACTGGTACCTAGGCCCAGCTAACCTTTTACCCAG-CTGTC  846
      ||||| | | |||||||| |||||| ||||||| |||||||||| |||||
seq2  TGTTCCCCGTACTGGTACTTAGGCCTAGCTAACTTTTTACCCAGCCTGTC  850

seq1  C-TGTCTATGGGGGATATCCCCATGGACTT  875
      | ||  ||||||||||||||||||||||||
seq2  CTTGGTTATGGGGGATATCCCCATGGACTT  880

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information