MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-079O15
Chromosome	16 (Build37)
Map Location	9,447,706 - 9,562,862
singlet/doublet	doublet
Overlap gene	none
Upstream gene	BC024814, Abat, LOC665207, Tmem186, Pmm2, Carhsp1, EG436336, Usp7, LOC665231, 1810013L24Rik, LOC100043106
Downstream gene	Grin2a, LOC665291, LOC100042534, 4930517K11Rik, Atf7ip2, Emp2, Tekt5, Nubp1, BC068110, Ciita, LOC669998, Dexi, 4932416N17Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC024814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239706 MGI:2384301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268860 MGI:2443582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665207 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Tmem186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66690 MGI:1913940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pmm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54128 MGI:1859214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Carhsp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52502 MGI:1196368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436336 MGI:3643507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Usp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252870 MGI:2182061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665231 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	1810013L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69053 MGI:1916303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 100 ESTs, 3 Proteins

name	LOC100043106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 614 ESTs, 5 Proteins

name	Grin2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14811 MGI:95820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	LOC100042534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	4930517K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68172 MGI:1915422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf7ip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75329 MGI:1922579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein

name	Emp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13731 MGI:1098726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70426 MGI:1917676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 7 Proteins

name	Nubp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26425 MGI:1347073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC068110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383103 MGI:3665441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciita (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12265 MGI:108445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Dexi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58239 MGI:1926236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932416N17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74374 MGI:1921624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC024814 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122828 GeneID:239706 MGI:2384301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024814 transcript_id : NM_146247.1

name	Abat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37202120 GeneID:268860 MGI:2443582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 4-aminobutyrate aminotransferase transcript_id : NM_172961.2

name	Tmem186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801992 GeneID:66690 MGI:1913940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 186 transcript_id : NM_025708.2

name	Pmm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892745 GeneID:54128 MGI:1859214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphomannomutase 2 transcript_id : NM_016881.2

name	Carhsp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27229012 GeneID:52502 MGI:1196368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium regulated heat stable protein 1 transcript_id : NM_025821.2

name	EG436336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267274 GeneID:436336 MGI:3643507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG436336 transcript_id : XM_489506.4

name	Usp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491859 GeneID:252870 MGI:2182061
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 7 transcript_id : NM_001003918.1

name	LOC665231 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94400053 GeneID:665231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to C04G2.8 transcript_id : XM_975517.1

name	1810013L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267314 GeneID:69053 MGI:1916303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 100 ESTs, 3 Proteins product : RIKEN cDNA 1810013L24 gene transcript_id : XM_001480138.1

name	LOC100043106 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267316 GeneID:100043106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 614 ESTs, 5 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001480142.1

name	Grin2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41680704 GeneID:14811 MGI:95820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA2A (epsilon 1) transcript_id : NM_008170.2

name	4930517K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803088 GeneID:68172 MGI:1915422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930517K11 gene transcript_id : NM_026594.2

name	Atf7ip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400043 GeneID:75329 MGI:1922579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein product : activating transcription factor 7 interacting protein 2, transcript variant 1 transcript_id : XM_148109.5

name	Emp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154058 GeneID:13731 MGI:1098726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epithelial membrane protein 2 transcript_id : NM_007929.2

name	Tekt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400059 GeneID:70426 MGI:1917676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 7 Proteins product : tektin 5 transcript_id : XM_358761.3

name	Nubp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754905 GeneID:26425 MGI:1347073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleotide binding protein 1 transcript_id : NM_011955.1

name	BC068110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701471 GeneID:383103 MGI:3665441
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC068110 transcript_id : NM_001013778.1

name	Ciita (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131183 GeneID:12265 MGI:108445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : class II transactivator transcript_id : NM_007575.2

name	LOC669998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267318 GeneID:669998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC669998 transcript_id : XM_001480173.1

name	Dexi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809749 GeneID:58239 MGI:1926236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dexamethasone-induced transcript transcript_id : NM_021428.4

name	4932416N17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130442 GeneID:74374 MGI:1921624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932416N17 gene transcript_id : NM_177562.4

name	BC024814 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122829 CCDS:CCDS27938.1 GeneID:239706 MGI:2384301
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC239706 protein_id : NP_666359.1

name	Abat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37202121 CCDS:CCDS27939.1 GeneID:268860 MGI:2443582
definition	EC_number : 2.6.1.19 GO_component : GO:0032144 - 4-aminobutyrate transaminase complex [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0047298 - (S)-3-amino-2-methylpropionate transaminase activity [Evidence IEA]; GO:0003867 - 4-aminobutyrate transaminase activity [Evidence IEA] [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA] [Evidence ISS]; GO:0032145 - succinate-semialdehyde dehydrogenase binding [Evidence ISS]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0048148 - behavioral response to cocaine [Evidence IMP]; GO:0009448 - gamma-aminobutyric acid metabolism [Evidence IEA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 product : 4-aminobutyrate aminotransferase protein_id : NP_766549.2

name	Tmem186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228988 CCDS:CCDS27940.1 GeneID:66690 MGI:1913940
definition	codon_start : 1 product : hypothetical protein LOC66690 protein_id : NP_079984.2

name	Pmm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393988 CCDS:CCDS27941.1 GeneID:54128 MGI:1859214
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004615 - phosphomannomutase activity [Evidence IEA] GO_process : GO:0019307 - mannose biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : phosphomannomutase 2 protein_id : NP_058577.1

name	Carhsp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385290 CCDS:CCDS27942.1 GeneID:52502 MGI:1196368
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : calcineurin substrate CRHSP-24 product : calcium-regulated heat-stable protein (24kD) protein_id : NP_080097.1

name	EG436336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267275 GeneID:436336 MGI:3643507
definition	codon_start : 1 product : similar to Lipopolysaccharide-induced TNF factor protein_id : XP_489506.2

name	Usp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491860 GeneID:252870 MGI:2182061
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin thiolesterase 7; herpesvirus-associated ubiquitin-specific protease product : ubiquitin specific protease 7 protein_id : NP_001003918.1

name	LOC665231 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94400054 GeneID:665231
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980611.1

name	1810013L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267315 GeneID:69053 MGI:1916303
definition	codon_start : 1 product : hypothetical protein LOC69053 protein_id : XP_001480188.1

name	LOC100043106 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267317 GeneID:100043106
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480192.1

name	Grin2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41680705 CCDS:CCDS27943.1 GeneID:14811 MGI:95820
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA]; GO:0042734 - presynaptic membrane [Evidence IEP]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence TAS]; GO:0048167 - regulation of synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GluRepsilon1 product : glutamate receptor, ionotropic, NMDA2A (epsilon 1) protein_id : NP_032196.2

name	4930517K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386082 GeneID:68172 MGI:1915422
definition	codon_start : 1 product : ribosomal protein L39-like protein protein_id : NP_080870.1

name	Atf7ip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38079693 GeneID:75329 MGI:1922579
definition	codon_start : 1 product : activating transcription factor 7 interacting protein 2 isoform 1 protein_id : XP_148109.3

name	Emp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154059 GeneID:13731 MGI:1098726
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : epithelial membrane protein 2 protein_id : NP_031955.2

name	Tekt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38080173 GeneID:70426 MGI:1917676
definition	codon_start : 1 product : tektin 5 protein_id : XP_358761.1

name	Nubp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754906 CCDS:CCDS27948.1 GeneID:26425 MGI:1347073
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : nucleotide binding protein 1 protein_id : NP_036085.1

name	BC068110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701472 CCDS:CCDS27949.1 GeneID:383103 MGI:3665441
definition	codon_start : 1 product : hypothetical protein LOC383103 protein_id : NP_001013800.1

name	Ciita (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671654 CCDS:CCDS27950.1 GeneID:12265 MGI:108445
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : class II transactivator protein_id : NP_031601.1

name	LOC669998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267319 GeneID:669998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480223.1

name	Dexi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19920321 GeneID:58239 MGI:1926236
definition	codon_start : 1 product : dexamethasone-induced protein protein_id : NP_067403.2

name	4932416N17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656175 GeneID:74374 MGI:1921624
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74374 protein_id : NP_808230.2

name	LOC665207 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665207
definition	number : 2 pseudo : _no_value

name	LOC665207 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665207
definition	number : 1 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 1 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 2 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 3 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 4 pseudo : _no_value

name	LOC100042534 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042534
definition	number : 1 pseudo : _no_value

clone name	MSMg01-441L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-493P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151B15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-079O15.b	B6Ng01-079O15.g
ACC	DH895193	DH895194
length	1,166	1,187
definition	DH895193\|Mus musculus domesticus DNA, BAC clone: B6Ng01-079O15, 5' end.	DH895194\|Mus musculus domesticus DNA, BAC clone: B6Ng01-079O15, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(9,561,683 - 9,562,862)	(9,447,706 - 9,448,923)
sequence	gaattccaagatcagagcaagaccatgttcccagaaacagcagaaagcaa ccacagaagccacccagtgtgaacctctggcatccacaagcatgggtgca catacatatgcacacccacatgcgaatgtgcacacaaacataagagagca cacactgagatacatgcatgcactacatgcatgtgcatacatgtgcatgc acacagaggcatgtggaatttgacttggaaaatggaaagaatgttttaga aagattgttgctcatggcctttttagcatgctcagaacattgggggaaaa gttggggccagcttacagaaccagagtacattttactgactttgagtgtc acagctcccattagaaagaggaacacggtgaaccatttttttagcataat caacataagtgtaaggctttataatccaaaatccatcaccaaaagattaa atcacagaccaaaatctatacacacccagcatctccctttatgcaacctt agcaacccaaatctacccgagctccagatgaaactaatctagagggaaaa tagtctctactggtgttgccttcaggcctaggaagaactctactgggctt ggcatttctctggtttaacagaaagaataaaagatgaacaccacagaccc atagttataaataataggtgataaagcaagtgcactgcttaagctccact taatctccactgccaatttgatgccatttaggttaccatggaaacatgcc ttgagggagtctctagaccagattagttgaggtatgaagacagatgttga atgtgggtggccccatgctatgggctaaagtccgagacttaataaacagg aagcactctaagcaccagcatccatctctctctgcttcttgactcctgat gcagtcagaccagatagctgcctgtgttcataccaccatgcctctcctat tgtcctgtgctgggccatcagacagaaagccaatataaatcttccataaa gccaccttttccaacatgagaaagttactaatgtagcaaagcaacaactc acaacaataccagccaccaaccccttgtttgcttgtctcagaattgttga agaacgcagttgctcagcccactcatgaaaacacatttccttccctcctt ctgccaagcactttct	gaattcaaaggcactggtagtggaagtcttcagcaaaacagtatttgcca gacatgatagggctattccacacatgaaatcacaacagttgtgactatat gcacaaaacctacagtatattaagccagctaaaatcctggcatagatagg gagtaactcacgaaatcccatcattagattaggagttacctgtaatttgt ggctgcttggggacggagagtcagttttcttcagttatgtggccctgaga agctacctatgctataaagcagtggttctcagccttcctaatgttgtgac tctttaatatagtccatcatgttgtggtgaccccactcataaaattattt tcatcagtacttcacaactgtaactttgctattgttaggaattgtagtga aacctctgatatacaggagctctgatatgtgaccctgtgaacaagtcctt tgatttccaaagggattgagaaccactgcactagctgtccctacatcctt gcacatacagacagcattgagtagatgatacaggtaggggaagtatcaga gggatggaatggaattggatttgttaaaaattaaatacatatttataaaa tttggaaaaataaaaattattaaaaataaaaaatcacatgaggaagtgtt tttaacataataatattttattatgtagctaacatgcataattctaattt tgttgaaatctggttttattaaaacctaaataaagaaaagaatctgaatt acaagttcctttagaagaggttcatccagaaaaaaattaattataaaata ggaattcattacaggacacagtctgatggtatctctggtgaatgtgaaag tgattatatttagctcctactttggatgatactggttgactcttataaat ggtatttgacaggtgaaaagtctgttttctggatatagtagaagagaggc tgctcatgaaatgggattagtcctactttatagaggttacaaatccttgg cacagactcaggcctctatggctcagagggttagcgattattctagactg tttaaatcacccaagatgatgatctataacagacttattatgagccagcg aactccacagccttgctacttgtctggcctggtcataatgcttatgttct attataccataggatatttattgattgggatgtatat
quality values	Open. Hide. 61 43 38 47 61 55 37 26 49 55 49 49 49 43 59 61 61 59 61 61 61 61 61 59 23 31 49 36 29 24 24 26 13 22 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 44 59 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 55 44 55 59 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 52 61 53 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 42 61 61 61 61 61 61 61 61 57 57 57 57 57 57 57 57 57 53 57 50 57 57 47 57 53 57 53 53 43 57 50 57 57 57 47 53 57 57 52 57 57 45 57 53 53 57 57 57 57 57 57 53 57 57 53 47 47 38 53 57 57 53 57 57 57 57 51 42 57 45 53 53 53 53 53 57 57 57 50 53 45 36 47 52 57 57 53 57 30 57 57 47 47 52 52 47 32 53 43 52 57 47 47 47 45 53 52 53 53 53 50 52 53 57 50 50 41 53 50 52 50 52 30 57 41 39 50 57 57 53 50 46 47 53 50 53 40 38 53 50 57 50 53 40 30 53 37 46 47 37 47 34 47 53 39 37 53 39 53 50 30 38 38 52 37 57 37 39 21 57 37 57 52 38 42 33 44 37 53 30 53 41 39 40 32 52 36 47 31 21 40 29 35 46 52 39 57 41 37 24 42 53 36 47 33 53 47 29 20 57 53 48 19 37 37 44 41 39 37 30 40 17 33 30 34 44 31 37 33 30 48 53 36 44 14 46 21 28 28 37 43 43 30 30 30 27 38 33 27 31 18 32 34 48 29 23 47 26 48 51 48 36 44 32 10 46 51 46 27 24 30 34 31 30 29 30 51 46 29 26 12 46 29 25 28 34 47 24 48 25 39 31 31 11 14 33 36 38 46 27 23 11 10 15 29 39 28 28 29 39 34 28 29 29 39 29 29 27 24 32 22 29 36 34 38 35 35 31 29 26 36 29 35 34 34 25 24 34 26 19 33 29 20 25 22 28 31 35 22 28 21 29 35 29 31 29 28 28 26 33 27 31 35 18 28 28 27 28 20 35 28 29 27 29 20 27 21 30 14 31 18 23 23 20 30 33 41 33 30 16 36 26 25 33 17 23 27 24 28 22 34 34 28 17 16 33 13 21 19 17 34 10 29 23 30 28 51 31 12 24 21 23 20 16 20 34 17 12 20 31 51 26 24 14 20 24 12 15 21 26 20 38 30 19 22 9 38 13 26 31 26 12 31 30 24 19 10 10 13 23 24 44 44 39 7 24 15 16 13 20 5 12 16 11 30 44 34 8 13 9 26 9 15 13 16 14 34 9 11 11 32 28 44 30 19 16 24 20 8 5 22 14 17 18 8 8 13 5 10 14 21 29 16 7 17 10 29 17 5 5 6 4 11 7 6 6 27 29 8 7 21 13 42 30 26 16 23 7 7 5 4 8 14 13 4 4 16 19 25 10 7 24 24 26 5 7 12 9 8 5 17 11 6 3 2 4 7 11 8 11 7 18 27 10 15 11 5 5 11 5 7 18 30 30 5 7 8 12 4 5 3 2 4 9 12 17 9 19 8 12 8 19 4 8 6 9 20 8 10 3 5 7 5 10 6 16 19 20 4 4	Open. Hide. 55 55 61 49 28 28 10 12 12 13 19 12 12 11 49 59 59 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 59 59 40 30 44 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 59 59 59 61 59 61 61 61 61 59 59 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 41 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 50 55 55 55 55 55 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 53 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 39 61 61 40 61 61 61 53 61 61 61 61 61 61 57 57 57 53 57 53 53 57 53 53 57 43 57 57 39 34 57 57 53 53 47 57 57 57 53 53 57 53 53 52 43 57 53 42 40 47 47 57 57 57 53 52 53 52 47 47 52 53 57 50 47 52 57 57 47 52 53 50 57 57 57 53 57 57 57 47 57 57 57 57 36 50 45 53 53 53 47 52 57 38 37 41 52 47 47 57 45 50 47 47 47 53 57 47 45 57 47 47 45 53 57 52 30 57 57 47 45 53 52 28 57 57 57 41 27 53 47 38 52 39 52 50 57 52 50 40 53 57 57 32 50 30 37 36 36 37 30 40 42 50 42 21 52 38 38 53 57 34 32 42 36 47 28 52 42 42 42 53 32 57 57 36 37 30 53 33 39 57 47 40 39 23 53 40 37 57 57 52 33 22 26 35 47 45 39 22 46 33 37 57 37 44 36 57 53 30 53 57 57 43 19 42 41 29 40 40 36 48 29 26 14 19 35 26 29 28 40 38 33 39 33 41 33 35 15 47 53 14 34 9 23 14 28 33 15 34 32 53 23 29 48 51 51 46 46 46 29 47 24 20 32 24 46 31 29 34 46 51 30 29 29 29 20 22 13 32 31 31 22 39 38 21 29 17 30 47 18 21 26 39 31 18 15 29 28 29 26 17 23 38 10 19 30 31 34 33 21 29 38 21 29 25 33 31 39 15 12 29 51 39 31 23 21 29 30 29 29 33 28 26 51 29 29 29 35 33 34 29 18 28 21 23 51 30 36 29 29 14 23 33 14 24 27 23 35 30 18 25 28 27 13 20 20 28 19 21 13 15 51 39 24 39 39 6 21 22 51 28 20 29 27 19 43 29 8 10 6 46 51 29 22 29 31 13 15 12 51 51 33 27 27 31 22 23 36 16 21 22 13 12 34 12 33 6 7 31 9 29 20 28 20 12 21 20 30 28 23 29 25 27 51 17 14 33 38 8 7 8 6 6 5 11 24 27 18 34 20 31 51 22 19 20 17 10 22 21 28 22 22 19 17 32 51 38 31 38 31 18 28 19 28 15 27 26 29 6 18 18 8 8 5 4 10 13 27 28 23 21 11 20 21 27 9 26 11 6 6 29 9 38 29 7 8 31 11 5 3 14 22 23 28 34 8 7 5 13 9 14 8 6 7 4 7 5 10 20 27 10 6 5 13 29 22 7 29 12 15 5 7 26 9 11 12 6 8 12 7 14 14 7 4 3 4 7 12 9 21 8 17 25 12 16 16 16 11 11 13 5 7 12 5 12 10 7 14 11 20 6 14 4 3 4 7 24 5 7 16 7 5 5 16 11 25 11 9 5 11 15 9 6 4 13 11 3 7 5 5 7 18 4 18 6 14 9 21 11 17 6 16 16 5 10 4 13 4 16 2 3 13 4 11 4 5 7 13 16 8 16 5 4 3 5 3 4 6 4 9 8 16 4 3 1 3 8 8 5 4 1

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_9561683_9562862
seq2: B6Ng01-079O15.b_49_1214 (reverse)

seq1  AGAAAGTGCTTGTGGCAGAAGGAGGAAGGTATATGTGTTTTCATGAGTTG  50
      ||||||||||  ||||||||||||| | | | ||||||||||||||| ||
seq2  AGAAAGTGCT--TGGCAGAAGGAGGGAAGGAAATGTGTTTTCATGAG-TG  47

seq1  GGCTGAAGACAAACTGCG-TCTTCAACAAATCTTGGAGACAAGCAAACAG  99
      ||||   ||  ||||||| |||||||||| |||  |||||||||||||| 
seq2  GGCT---GAGCAACTGCGTTCTTCAACAATTCT--GAGACAAGCAAACAA  92

seq1  GGTGTTTGTGTGCTGGTTATTGTTGTGAGTTGTTTGCTTTTGCTACATTA  149
      || ||| ||| ||||| ||||||||||||||| |||| ||||||||||||
seq2  GGGGTTGGTG-GCTGG-TATTGTTGTGAGTTG-TTGC-TTTGCTACATTA  138

seq1  GTTACTTTTCTCATTGTTGGAAAAAGGTGGCTTTATGGAAGATTTATATT  199
      || || ||||||| |||||| |||||||||||||||||||||||||||||
seq2  GTAAC-TTTCTCA-TGTTGG-AAAAGGTGGCTTTATGGAAGATTTATATT  185

seq1  GGCTTTCTGTCTGATGGCCCAGCACAGGACAATAGGAGAGGCATGGTGGT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTCTGTCTGATGGCCCAGCACAGGACAATAGGAGAGGCATGGTGGT  235

seq1  ATGAACACAGGCAGCTATCTGGTCTGACTGCATCAGGAGTCAAGAAGCAG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAACACAGGCAGCTATCTGGTCTGACTGCATCAGGAGTCAAGAAGCAG  285

seq1  AGAGAGATGGATGCTGGTGCTTAGAGTGCTTCCTGTTTATTAAGTCTCGG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGATGGATGCTGGTGCTTAGAGTGCTTCCTGTTTATTAAGTCTCGG  335

seq1  ACTTTAGCCCATAGCATGGGGCCACCCACATTCAACATCTGTCTTCATAC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTAGCCCATAGCATGGGGCCACCCACATTCAACATCTGTCTTCATAC  385

seq1  CTCAACTAATCTGGTCTAGAGACTCCCTCAAGGCATGTTTCCATGGTAAC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAACTAATCTGGTCTAGAGACTCCCTCAAGGCATGTTTCCATGGTAAC  435

seq1  CTAAATGGCATCAAATTGGCAGTGGAGATTAAGTGGAGCTTAAGCAGTGC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATGGCATCAAATTGGCAGTGGAGATTAAGTGGAGCTTAAGCAGTGC  485

seq1  ACTTGCTTTATCACCTATTATTTATAACTATGGGTCTGTGGTGTTCATCT  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGCTTTATCACCTATTATTTATAACTATGGGTCTGTGGTGTTCATCT  535

seq1  TTTATTCTTTCTGTTAAACCAGAGAAATGCCAAGCCCAGTAGAGTTCTTC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTCTTTCTGTTAAACCAGAGAAATGCCAAGCCCAGTAGAGTTCTTC  585

seq1  CTAGGCCTGAAGGCAACACCAGTAGAGACTATTTTCCCTCTAGATTAGTT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGCCTGAAGGCAACACCAGTAGAGACTATTTTCCCTCTAGATTAGTT  635

seq1  TCATCTGGAGCTCGGGTAGATTTGGGTTGCTAAGGTTGCATAAAGGGAGA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTGGAGCTCGGGTAGATTTGGGTTGCTAAGGTTGCATAAAGGGAGA  685

seq1  TGCTGGGTGTGTATAGATTTTGGTCTGTGATTTAATCTTTTGGTGATGGA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGGTGTGTATAGATTTTGGTCTGTGATTTAATCTTTTGGTGATGGA  735

seq1  TTTTGGATTATAAAGCCTTACACTTATGTTGATTATGCTAAAAAAATGGT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGGATTATAAAGCCTTACACTTATGTTGATTATGCTAAAAAAATGGT  785

seq1  TCACCGTGTTCCTCTTTCTAATGGGAGCTGTGACACTCAAAGTCAGTAAA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCGTGTTCCTCTTTCTAATGGGAGCTGTGACACTCAAAGTCAGTAAA  835

seq1  ATGTACTCTGGTTCTGTAAGCTGGCCCCAACTTTTCCCCCAATGTTCTGA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTACTCTGGTTCTGTAAGCTGGCCCCAACTTTTCCCCCAATGTTCTGA  885

seq1  GCATGCTAAAAAGGCCATGAGCAACAATCTTTCTAAAACATTCTTTCCAT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCTAAAAAGGCCATGAGCAACAATCTTTCTAAAACATTCTTTCCAT  935

seq1  TTTCCAAGTCAAATTCCACATGCCTCTGTGTGCATGCACATGTATGCACA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCAAGTCAAATTCCACATGCCTCTGTGTGCATGCACATGTATGCACA  985

seq1  TGCATGTAGTGCATGCATGTATCTCAGTGTGTGCTCTCTTATGTTTGTGT  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGTAGTGCATGCATGTATCTCAGTGTGTGCTCTCTTATGTTTGTGT  1035

seq1  GCACATTCGCATGTGGGTGTGCATATGTATGTGCACCCATGCTTGTGGAT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACATTCGCATGTGGGTGTGCATATGTATGTGCACCCATGCTTGTGGAT  1085

seq1  GCCAGAGGTTCACACTGGGTGGCTTCTGTGGTTGCTTTCTGCTGTTTCTG  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGAGGTTCACACTGGGTGGCTTCTGTGGTTGCTTTCTGCTGTTTCTG  1135

seq1  GGAACATGGTCTTGCTCTGATCTTGGAATTC  1180
      |||||||||||||||||||||||||||||||
seq2  GGAACATGGTCTTGCTCTGATCTTGGAATTC  1166

seq1: chr16_9447706_9448923
seq2: B6Ng01-079O15.g_71_1257

seq1  GAATTCAAAGGCACTGGTAGTGGAAGTCTTCAGCAAAACAGTATTTGCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAGGCACTGGTAGTGGAAGTCTTCAGCAAAACAGTATTTGCCA  50

seq1  GACATGATAGGGCTATTCCACACATGAAATCACAACAGTTGTGACTATAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATGATAGGGCTATTCCACACATGAAATCACAACAGTTGTGACTATAT  100

seq1  GCACAAAACCTACAGTATATTAAGCCAGCTAAAATCCTGGCATAGATAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAAAACCTACAGTATATTAAGCCAGCTAAAATCCTGGCATAGATAGG  150

seq1  GAGTAACTCACGAAATCCCATCATTAGATTAGGAGTTACCTGTAATTTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTAACTCACGAAATCCCATCATTAGATTAGGAGTTACCTGTAATTTGT  200

seq1  GGCTGCTTGGGGACGGAGAGTCAGTTTTCTTCAGTTATGTGGCCCTGAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTTGGGGACGGAGAGTCAGTTTTCTTCAGTTATGTGGCCCTGAGA  250

seq1  AGCTACCTATGCTATAAAGCAGTGGTTCTCAGCCTTCCTAATGTTGTGAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTACCTATGCTATAAAGCAGTGGTTCTCAGCCTTCCTAATGTTGTGAC  300

seq1  TCTTTAATATAGTCCATCATGTTGTGGTGACCCCACTCATAAAATTATTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTAATATAGTCCATCATGTTGTGGTGACCCCACTCATAAAATTATTT  350

seq1  TCATCAGTACTTCACAACTGTAACTTTGCTATTGTTAGGAATTGTAGTGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCAGTACTTCACAACTGTAACTTTGCTATTGTTAGGAATTGTAGTGA  400

seq1  AACCTCTGATATACAGGAGCTCTGATATGTGACCCTGTGAACAAGTCCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTCTGATATACAGGAGCTCTGATATGTGACCCTGTGAACAAGTCCTT  450

seq1  TGATTTCCAAAGGGATTGAGAACCACTGCACTAGCTGTCCCTACATCCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTCCAAAGGGATTGAGAACCACTGCACTAGCTGTCCCTACATCCTT  500

seq1  GCACATACAGACAGCATTGAGTAGATGATACAGGTAGGGGAAGTATCAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACATACAGACAGCATTGAGTAGATGATACAGGTAGGGGAAGTATCAGA  550

seq1  GGGATGGAATGGAATTGGATTTGTTAAAAATTAAATACATATTTATAAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATGGAATGGAATTGGATTTGTTAAAAATTAAATACATATTTATAAAA  600

seq1  TTTGGAAAAATAAAAATTATTAAAAATAAAAAATCACATGAGGAAGTGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGAAAAATAAAAATTATTAAAAATAAAAAATCACATGAGGAAGTGTT  650

seq1  TTTAACATAATAATATTTTATTATGTAGCTAACATGCATAATTCTAATTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAACATAATAATATTTTATTATGTAGCTAACATGCATAATTCTAATTT  700

seq1  TGTTGAAATCTGGTTTTATTAAAACCTAAATAAAGAAAAGAATCTGAATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGAAATCTGGTTTTATTAAAACCTAAATAAAGAAAAGAATCTGAATT  750

seq1  ACAAGTTCCTTTAGAAGAGGTTCATCCAGAAAAAAATTAATTATAAAATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTTCCTTTAGAAGAGGTTCATCCAGAAAAAAATTAATTATAAAATA  800

seq1  GGAATTCATTACAGGACACAGTCTGATGGTATCTCTGGTGAATGTGAAAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATTCATTACAGGACACAGTCTGATGGTATCTCTGGTGAATGTGAAAG  850

seq1  TGATTATATTTAGCTCCTACTTTGGATGATACTGGTTGACTCTTATAAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTATATTTAGCTCCTACTTTGGATGATACTGGTTGACTCTTATAAAT  900

seq1  GGTATTTGACAGGTGGAAAAGTCTGTTTTCTGGATTATAGTAGAAGAGAG  950
      |||||||||||||| ||||||||||||||||||| |||||||||||||||
seq2  GGTATTTGACAGGT-GAAAAGTCTGTTTTCTGGA-TATAGTAGAAGAGAG  948

seq1  GCTGCTCATGAAATGGGAATGAGTCCTACTTTATAGAGGTTACAAAATCC  1000
      ||||||||||||||||| || |||||||||||||||||||||||||   |
seq2  GCTGCTCATGAAATGGG-ATTAGTCCTACTTTATAGAGGTTACAAA--TC  995

seq1  CTTGGCAACAAGACTCCAAGGCCTCTATGGCTCAGAGGGTTAAGCAGATT  1050
      |||||||   ||||||  ||||||||||||||||||||||| ||| ||||
seq2  CTTGGCA--CAGACTC--AGGCCTCTATGGCTCAGAGGGTT-AGC-GATT  1039

seq1  ATTCTAGACTGTATAAAATCACCCCAAAGATGATGATACTATAACAGACC  1100
      |||||||||||| | |||||||||  ||||||||||| |||||||||| |
seq2  ATTCTAGACTGT-TTAAATCACCC--AAGATGATGAT-CTATAACAGA-C  1084

seq1  TTATTATGAGCCAAGCAGACTCACACAGGCTTGCTACTTGTCATGGCTGG  1150
      |||||||||||| |||  |||| ||||| |||||||||||||  | ||||
seq2  TTATTATGAGCC-AGCGAACTC-CACAGCCTTGCTACTTGTCTGGCCTGG  1132

seq1  GTTCATAAATGGCTTTAATTGTTCTATTATTACCATTATGATTATTATTG  1200
        ||||||   ||||    |||||||||| ||||| || |||  ||||||
seq2  --TCATAA--TGCTT---ATGTTCTATTA-TACCA-TAGGATATTTATTG  1173

seq1  ATATTGTGATATGTATAT  1218
      ||    ||  ||||||||
seq2  AT----TGGGATGTATAT  1187

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information