MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-095D24
Chromosome	16 (Build37)
Map Location	89,390,220 - 89,391,345
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG622373, Cldn17, Cldn8, Gm312, 2310079G19Rik, 2310002B14Rik, EG665513, 2310061N02Rik, Krtap13-1, Krtap13, 2310034C09Rik, 2310057N15Rik, EG546672, EG433047, 4930553J12Rik, Krtap14, Krtap15, Krtap16-9, Krtap16-1, Krtap16-5, Krtap16-4, Krtap8-2, LOC100040191, AY026312, Krtap16-10, EG621595, LOC100040167, 1110032D16Rik, LOC100040201, Krtap6-1, LOC100040214, Krtap16-8, 1110025L11Rik, LOC100040249, LOC100040267, EG622794, LOC100040281, ENSMUSG00000044227, EG665661, LOC100040288, EG622935, EG622981, EG622998, EG623011, EG623026, LOC100040346, EG623049, LOC100040415, EG640636, LOC640652, LOC640654, LOC100040425, LOC100040374, LOC640656, LOC100040445
Downstream gene	LOC100040456, Krtap21-1, Krtap6-2, 5430433J05Rik, Tiam1, LOC100040496, LOC640694, LOC100040440, Sod1, Sfrs15, LOC545175, Hunk
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG622373 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622373 MGI:3645674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cldn17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239931 MGI:2652030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54420 MGI:1859286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239932 MGI:2685158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	2310079G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69699 MGI:1916949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	2310002B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69533 MGI:1916783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665513 MGI:3648908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins pseudo : _no_value

name	2310061N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69661 MGI:1916911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 6 Proteins

name	Krtap13-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268905 MGI:2146359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16699 MGI:1330835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310034C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117172 MGI:2152338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310057N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69696 MGI:1916946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546672 MGI:3645197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 7 Proteins

name	EG433047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433047 MGI:3647686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	4930553J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75351 MGI:1922601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 5 Proteins

name	Krtap14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23927 MGI:1346079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26560 MGI:1347350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170657 MGI:2157769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170651 MGI:2157572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77918 MGI:1925168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170654 MGI:2157757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap8-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16704 MGI:1330295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	AY026312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	1110032D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC100040201 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins

name	Krtap6-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins

name	Krtap16-8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68484 MGI:1915734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110025L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins

name	LOC100040249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC100040267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG622794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	ENSMUSG00000044227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG665661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040288 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG622935 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG622981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG622998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG623011 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG623026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG623049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG640636 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC640652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC640654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040425 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC640656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Krtap21-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73716 MGI:1920966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap6-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16701 MGI:1330280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430433J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71363 MGI:1918613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tiam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21844 MGI:103306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 1 Protein pseudo : _no_value

name	LOC640694 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100040440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Sod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20655 MGI:98351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224432 MGI:2146350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545175 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 66 ESTs, 1 Protein

name	Hunk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26559 MGI:1347352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801892 GeneID:239931 MGI:2652030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 17 transcript_id : NM_181490.3

name	Cldn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542405 GeneID:54420 MGI:1859286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 8 transcript_id : NM_018778.2

name	Gm312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400718 GeneID:239932 MGI:2685158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : gene model 312, (NCBI) transcript_id : XM_977282.1

name	2310079G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268136 GeneID:69699 MGI:1916949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : RIKEN cDNA 2310079G19 gene transcript_id : XM_484566.3

name	2310002B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351733 GeneID:69533 MGI:1916783
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310002B14 gene transcript_id : NM_027105.2

name	2310061N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268129 GeneID:69661 MGI:1916911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 6 Proteins product : RIKEN cDNA 2310061N02 gene transcript_id : XM_001473644.1

name	Krtap13-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147241 GeneID:268905 MGI:2146359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 13-1 transcript_id : NM_183189.1

name	Krtap13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754491 GeneID:16699 MGI:1330835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 13 transcript_id : NM_010671.1

name	2310034C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368102 GeneID:117172 MGI:2152338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310034C09 gene transcript_id : NM_054100.2

name	2310057N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386207 GeneID:69696 MGI:1916946
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310057N15 gene transcript_id : NM_027170.1

name	EG546672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400721 GeneID:546672 MGI:3645197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 7 Proteins product : predicted gene, EG546672, transcript variant 3 transcript_id : XM_885642.2

name	4930553J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400723 GeneID:75351 MGI:1922601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 5 Proteins product : RIKEN cDNA 4930553J12 gene transcript_id : XM_484569.3

name	Krtap14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350453 GeneID:23927 MGI:1346079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 14 transcript_id : NM_013707.2

name	Krtap15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305212 GeneID:26560 MGI:1347350
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 15 transcript_id : NM_013713.1

name	Krtap16-9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865952 GeneID:170657 MGI:2157769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-9 transcript_id : NM_130876.3

name	Krtap16-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21357426 GeneID:170651 MGI:2157572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-1 transcript_id : NM_130870.1

name	Krtap16-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158705 GeneID:77918 MGI:1925168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-5 transcript_id : NM_130857.2

name	Krtap16-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426872 GeneID:170654 MGI:2157757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-4 transcript_id : NM_130873.1

name	Krtap8-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722126 GeneID:16704 MGI:1330295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 8-2 transcript_id : NM_010676.2

name	LOC100040191 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268138 GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cDNA sequence AY026312 transcript_id : XM_001474241.1

name	AY026312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801851 GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY026312 transcript_id : NM_133359.2

name	Krtap16-10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50080210 GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-10 transcript_id : NM_183296.1

name	EG621595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973040 GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG621595, transcript variant 3 transcript_id : XM_896462.1

name	1110032D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400724 GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : RIKEN cDNA 1110032D16 gene transcript_id : XM_897249.2

name	LOC100040201 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268140 GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins product : similar to glycine tyrosine-rich hair keratin protein transcript_id : XM_001474256.1

name	Krtap6-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374194 GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-1 transcript_id : NM_010672.3

name	LOC100040214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268142 GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins product : similar to keratin associated protein 6-1 transcript_id : XM_001474297.1

name	Krtap16-8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504469 GeneID:68484 MGI:1915734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-8 transcript_id : NM_130856.2

name	1110025L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268144 GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins product : RIKEN cDNA 1110025L11 gene transcript_id : XM_001474332.1

name	LOC100040249 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268146 GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474351.1

name	LOC100040267 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268148 GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MGC58416 protein transcript_id : XM_001474379.1

name	EG622794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268152 GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG622794 transcript_id : XM_897326.2

name	LOC100040281 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268154 GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474426.1

name	ENSMUSG00000044227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268150 GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, ENSMUSG00000044227 transcript_id : XM_001474147.1

name	EG665661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400725 GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG665661 transcript_id : XM_978513.1

name	LOC100040288 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268156 GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to MGC58416 protein transcript_id : XM_001474181.1

name	EG622935 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268158 GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG622935 transcript_id : XM_897414.2

name	EG622981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268160 GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG622981 transcript_id : XM_897445.2

name	EG622998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973291 GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG622998 transcript_id : XM_897455.1

name	EG623011 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973294 GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623011 transcript_id : XM_897466.1

name	EG623026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973298 GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623026 transcript_id : XM_897479.1

name	LOC100040346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268164 GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474233.1

name	EG623049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973304 GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623049 transcript_id : XM_897498.1

name	LOC100040415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268174 GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474343.1

name	EG640636 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268170 GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640636 transcript_id : XM_978919.2

name	LOC640652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268168 GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474284.1

name	LOC640654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268172 GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474324.1

name	LOC100040425 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268176 GeneID:100040425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474371.1

name	LOC100040374 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268166 GeneID:100040374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to MGC58416 protein transcript_id : XM_001474267.1

name	LOC640656 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268162 GeneID:640656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to keratin associated protein 6-2 transcript_id : XM_001474501.1

name	LOC100040445 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268179 GeneID:100040445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474391.1

name	LOC100040456 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268181 GeneID:100040456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to keratin associated protein 21-1 transcript_id : XM_001474418.1

name	Krtap21-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802943 GeneID:73716 MGI:1920966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 21-1 transcript_id : NM_028621.2

name	Krtap6-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195693 GeneID:16701 MGI:1330280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-2 transcript_id : NM_010673.2

name	5430433J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268183 GeneID:71363 MGI:1918613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 5430433J05 gene transcript_id : XM_001474473.1

name	Tiam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372435 GeneID:21844 MGI:103306
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell lymphoma invasion and metastasis 1 transcript_id : NM_009384.2

name	Sod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45597446 GeneID:20655 MGI:98351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : superoxide dismutase 1, soluble transcript_id : NM_011434.1

name	Sfrs15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150408 GeneID:224432 MGI:2146350
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 15 transcript_id : NM_178923.3

name	LOC545175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268190 GeneID:545175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 66 ESTs, 1 Protein product : similar to LOC635138 protein transcript_id : XM_001474656.1

name	Hunk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131024 GeneID:26559 MGI:1347352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hormonally upregulated Neu-associated kinase transcript_id : NM_015755.2

name	Cldn17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31377830 CCDS:CCDS28295.1 GeneID:239931 MGI:2652030
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 17 protein_id : NP_852467.1

name	Cldn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055192 CCDS:CCDS28296.1 GeneID:54420 MGI:1859286
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 8 protein_id : NP_061248.1

name	Gm312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400719 GeneID:239932 MGI:2685158
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982376.1

name	2310079G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769382 GeneID:69699 MGI:1916949
definition	codon_start : 1 product : hypothetical protein LOC69699 protein_id : XP_484566.1

name	2310002B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312310 CCDS:CCDS28298.1 GeneID:69533 MGI:1916783
definition	codon_start : 1 product : hypothetical protein LOC69533 protein_id : NP_081381.1

name	2310061N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268130 GeneID:69661 MGI:1916911
definition	codon_start : 1 product : hypothetical protein LOC69661 protein_id : XP_001473694.1

name	Krtap13-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147242 CCDS:CCDS28299.1 GeneID:268905 MGI:2146359
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 13-1 protein_id : NP_899012.1

name	Krtap13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754492 CCDS:CCDS28300.1 GeneID:16699 MGI:1330835
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 13 product : keratin associated protein 13 protein_id : NP_034801.1

name	2310034C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905137 GeneID:117172 MGI:2152338
definition	codon_start : 1 product : RIKEN cDNA 2310034C09 protein_id : NP_473441.1

name	2310057N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386208 CCDS:CCDS28302.1 GeneID:69696 MGI:1916946
definition	codon_start : 1 product : hypothetical protein LOC69696 protein_id : NP_081446.1

name	EG546672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973004 GeneID:546672 MGI:3645197
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_890735.1

name	4930553J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769388 GeneID:75351 MGI:1922601
definition	codon_start : 1 product : hypothetical protein LOC75351 protein_id : XP_484569.1

name	Krtap14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142350454 GeneID:23927 MGI:1346079
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 14 product : keratin associated protein 14 protein_id : NP_038735.2

name	Krtap15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305213 GeneID:26560 MGI:1347350
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 15 product : keratin associated protein 15 protein_id : NP_038741.1

name	Krtap16-9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865953 GeneID:170657 MGI:2157769
definition	codon_start : 1 product : keratin associated protein 16-9 protein_id : NP_570946.2

name	Krtap16-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21357427 CCDS:CCDS28304.1 GeneID:170651 MGI:2157572
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-1 protein_id : NP_570940.1

name	Krtap16-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426859 GeneID:77918 MGI:1925168
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-5 protein_id : NP_570927.1

name	Krtap16-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426873 GeneID:170654 MGI:2157757
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-4 protein_id : NP_570943.1

name	Krtap8-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722127 GeneID:16704 MGI:1330295
definition	codon_start : 1 note : keratin-associated protein 8.2; HGTpI alpha; keratin-associated protein 8-2 product : keratin associated protein 8-2 protein_id : NP_034806.2

name	LOC100040191 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268139 GeneID:100040191
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474291.1

name	AY026312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111168 GeneID:170939 MGI:2181750
definition	codon_start : 1 note : high-glycine/tyrosine protein type I E5 product : cDNA sequence AY026312 protein_id : NP_579937.1

name	Krtap16-10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080211 GeneID:71369 MGI:1918619
definition	codon_start : 1 product : keratin associated protein 16-10 protein_id : NP_899119.1

name	EG621595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973041 GeneID:621595 MGI:3644653
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_901555.1

name	1110032D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973182 GeneID:68740 MGI:1915990
definition	codon_start : 1 product : hypothetical protein LOC68740 protein_id : XP_902342.1

name	LOC100040201 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268141 GeneID:100040201
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474306.1

name	Krtap6-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754494 GeneID:16700 MGI:1330228
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.1 product : keratin associated protein 6-1 protein_id : NP_034802.1

name	LOC100040214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268143 GeneID:100040214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474347.1

name	Krtap16-8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536240 GeneID:68484 MGI:1915734
definition	codon_start : 1 product : keratin associated protein 16-8 protein_id : NP_570926.1

name	1110025L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268145 GeneID:68637 MGI:1915887
definition	codon_start : 1 product : RIKEN cDNA 1110025L11 protein_id : XP_001474382.1

name	LOC100040249 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268147 GeneID:100040249
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474401.1

name	LOC100040267 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268149 GeneID:100040267
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474429.1

name	EG622794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268153 GeneID:622794 MGI:3643237
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902419.2

name	LOC100040281 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268155 GeneID:100040281
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474476.1

name	ENSMUSG00000044227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268151 GeneID:640627 MGI:3642043
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474197.1

name	EG665661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400726 GeneID:665661 MGI:3649168
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983607.1

name	LOC100040288 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268157 GeneID:100040288
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474231.1

name	EG622935 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268159 GeneID:622935 MGI:3647747
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902507.2

name	EG622981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268161 GeneID:622981 MGI:3645349
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902538.2

name	EG622998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973292 GeneID:622998 MGI:3648365
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902548.1

name	EG623011 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973295 GeneID:623011 MGI:3643299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902559.1

name	EG623026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973299 GeneID:623026 MGI:3646232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902572.1

name	LOC100040346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268165 GeneID:100040346
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474283.1

name	EG623049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973305 GeneID:623049 MGI:3646961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902591.1

name	LOC100040415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268175 GeneID:100040415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474393.1

name	EG640636 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268171 GeneID:640636 MGI:3646423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984013.2

name	LOC640652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268169 GeneID:640652
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474334.1

name	LOC640654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268173 GeneID:640654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474374.1

name	LOC100040425 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268177 GeneID:100040425
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474421.1

name	LOC100040374 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268167 GeneID:100040374
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474317.1

name	LOC640656 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268163 GeneID:640656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474551.1

name	LOC100040445 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268180 GeneID:100040445
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474441.1

name	LOC100040456 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268182 GeneID:100040456
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474468.1

name	Krtap21-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229158 CCDS:CCDS28311.1 GeneID:73716 MGI:1920966
definition	codon_start : 1 exception : mismatches in translation product : keratin associated protein 21-1 protein_id : NP_082897.1

name	Krtap6-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195694 GeneID:16701 MGI:1330280
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.2; keratin-associated protein 6-2 product : keratin associated protein 6-2 protein_id : NP_034803.2

name	5430433J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268184 GeneID:71363 MGI:1918613
definition	codon_start : 1 product : hypothetical protein LOC71363 protein_id : XP_001474523.1

name	Tiam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678351 CCDS:CCDS28314.1 GeneID:21844 MGI:103306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046875 - ephrin receptor binding [Evidence IPI]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0048013 - ephrin receptor signaling pathway [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IMP]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation product : T-cell lymphoma invasion and metastasis 1 protein_id : NP_033410.1

name	Sod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597447 GeneID:20655 MGI:98351
definition	EC_number : 1.15.1.1 GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0004785 - copper, zinc superoxide dismutase activity [Evidence IDA] [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004784 - superoxide dismutase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence IDA]; GO:0019430 - removal of superoxide radicals [Evidence TAS]; GO:0006979 - response to oxidative stress [Evidence IDA]; GO:0006801 - superoxide metabolism [Evidence IEA]; GO:0042554 - superoxide release [Evidence IDA] codon_start : 1 note : Cu(2+)-Zn2+ superoxide dismutase product : superoxide dismutase 1, soluble protein_id : NP_035564.1

name	Sfrs15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150409 GeneID:224432 MGI:2146350
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : CTD-binding SR-like protein RA4 product : splicing factor, arginine/serine-rich 15 protein_id : NP_849254.2

name	LOC545175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268191 GeneID:545175
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_001474706.1

name	Hunk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657216 CCDS:CCDS28315.1 GeneID:26559 MGI:1347352
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA] codon_start : 1 product : hormonally upregulated Neu-associated kinase protein_id : NP_056570.1

name	EG622373 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622373
definition	number : 1 pseudo : _no_value

name	EG433047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433047
definition	number : 1

name	LOC640694 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640694
definition	number : 1 pseudo : _no_value

name	LOC640694 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640694
definition	number : 2 pseudo : _no_value

name	EG665513 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268126 GeneID:665513 MGI:3648908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins product : predicted gene, EG665513 pseudo : _no_value transcript_id : XR_002291.2

name	LOC100040167 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268137 GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_031579.1

name	LOC100040496 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268187 GeneID:100040496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 1 Protein product : similar to myosin regulatory light chain-like pseudo : _no_value transcript_id : XR_031827.1

name	LOC100040440 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268178 GeneID:100040440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_031873.1

clone name	MSMg01-450K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-477G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-364J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-095D24.b
ACC	DH906242
length	1,101
definition	DH906242\|Mus musculus domesticus DNA, BAC clone: B6Ng01-095D24, 5' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcatttcctttgtcctgtctcaaagttttaaacataaattttcctg aaatacctttcccattttcaggaatgaatgtctttatagaaaactctaat tcaaaactcatgctgaatatcttacggatctgcacaccagttttgttgct atggcacctttctggctcgcccttcggtctagtcaggtcatcttcaaaaa ggtcacgaaatgcctctcactctctcatttccgaaactgtgccaccatca tcaactgaccaagatactccaggactgctctgtgcctctttagaagtaga tgaaattgtccaatcctagtgggatctttataatgtgggaaatctttggt catcagagagatgaatcagagtccaggttctttgattgagacaatacaca agacatattcttgaactagttggacattatctaaagtgtgtttggttgat aatgtgtccctcatgcatttgctcaatccctcctaattatcctaacgttt atttgctgccctgtgattacagcttcattaccatgcggggtcaatgcacc atgcatggtagcagagcaaatccagttcagcagcagcaaggggcacacgt cttctgccagtaacacacttgacttgaacaagtattttgttttaaatact ttcgttgtgctgattctaaattgtagcactaccaaaaggattgacatgat aggaaagagactgtcttgaaattatatctaccttgggatatactaaaact tcaaaactatgtatctgaaagatttcggttataaaaacataaattataaa gtatttattactcatgctaaggattgtgtcttagagaatcctatgagcaa tatattaattaatatctaaagttcaaattactgttttctctgtgagactc ctttgaagaaattcatatgcagctcttacacagttcttacaatgaaagta aattgcatctaaagtatataatgcagccttaaagatattgagagtcgttt aattcatattttacatgtgagaaacgagtttgaaaaaaggttatattact taacagccgaagctgctacgacaaatgttcctctgacatcaatggctgtc c
quality values	Open. Hide. 57 36 42 30 57 35 18 38 42 34 32 38 36 42 42 47 47 53 38 35 47 38 45 15 24 7 9 19 18 32 34 26 17 11 13 19 20 19 21 27 24 29 32 43 43 49 49 43 37 55 47 19 27 34 31 32 31 32 49 35 50 41 55 38 50 50 49 49 25 18 31 55 50 37 36 50 50 49 41 61 52 52 52 55 37 36 43 36 37 52 52 52 52 52 52 52 52 29 37 43 49 49 37 28 52 49 52 52 52 38 52 55 52 49 52 52 43 43 41 49 41 41 37 41 43 39 55 49 55 52 52 52 52 41 52 43 52 52 52 36 41 52 49 37 49 37 41 52 39 49 41 52 52 52 41 43 52 52 52 52 52 37 31 34 50 28 39 52 39 39 52 50 49 49 49 36 52 37 52 38 37 26 28 37 28 37 55 49 52 52 55 55 55 55 55 39 49 52 52 52 43 55 41 49 52 52 41 55 52 52 52 55 52 55 55 55 55 52 43 52 50 50 49 49 43 50 39 49 50 50 55 50 38 55 50 50 55 49 55 43 50 50 47 43 43 43 32 49 45 29 49 43 26 37 49 50 55 50 49 39 39 50 37 55 49 43 49 43 49 31 27 31 50 47 49 49 50 43 49 55 50 55 50 55 50 55 49 49 49 50 43 43 49 61 55 49 50 49 43 53 43 50 53 50 45 47 43 39 35 35 36 29 43 50 50 50 43 43 35 29 47 43 50 39 37 53 53 61 50 45 50 43 50 43 53 42 52 50 50 50 50 50 50 50 45 43 42 47 47 39 37 50 53 53 33 35 61 61 61 47 43 32 61 50 32 50 50 32 17 53 35 36 38 38 42 38 50 43 43 52 45 50 47 47 47 47 47 46 50 34 52 45 31 39 42 45 45 32 38 27 31 27 47 47 35 47 30 35 38 38 34 32 50 50 42 50 50 47 34 47 47 47 47 47 47 45 47 47 43 45 45 40 42 40 45 45 38 50 40 50 42 37 42 47 47 34 45 52 52 38 38 37 32 52 32 47 42 43 50 47 50 45 38 37 42 32 26 38 40 38 50 45 40 47 41 45 47 52 45 45 45 45 39 42 45 50 45 36 32 39 35 45 39 39 39 45 45 32 45 45 45 45 52 53 47 53 45 47 26 32 37 38 50 45 50 41 31 53 30 57 37 53 52 46 26 50 32 38 33 32 37 35 27 52 52 52 42 53 46 47 28 42 30 33 37 53 35 32 33 39 38 37 46 35 37 52 53 52 38 50 39 35 39 31 53 28 33 25 24 34 40 34 52 38 34 34 37 36 36 33 40 33 30 40 31 24 33 22 34 17 53 39 47 37 37 40 35 40 36 35 39 30 35 39 33 37 35 44 32 34 34 32 38 37 36 41 30 35 35 37 37 41 34 41 33 33 24 29 36 15 47 37 40 37 37 35 37 38 44 20 33 29 20 25 41 41 37 24 40 40 40 37 48 28 33 45 30 30 30 32 29 33 30 21 39 28 24 10 36 33 48 37 34 27 39 28 40 27 32 31 25 46 29 21 44 33 23 29 48 32 24 33 30 29 30 25 41 29 20 41 29 29 29 32 36 36 25 44 29 28 25 29 47 24 29 29 41 29 27 47 29 29 47 18 29 30 29 29 34 20 29 26 29 29 29 38 33 34 16 20 22 20 29 23 17 33 36 27 28 24 15 20 24 28 36 30 22 19 24 29 29 29 26 29 25 28 20 25 41 39 16 30 18 39 20 16 24 29 27 14 30 23 16 39 41 41 27 28 17 29 28 30 19 28 29 32 29 23 31 28 29 19 28 36 30 20 28 31 14 24 21 24 29 22 20 43 22 33 22 29 6 31 16 23 29 21 12 29 20 27 15 36 16 6 15 15 28 43 24 17 15 15 21 28 23 29 9 27 21 28 9 9 29 25 27 28 20 21 16 23 25 27 17 22 23 11 28 8 18 36 21 17 34 27 19 38 26 28 16 16 12 19 33 22 38 38 19 10 9 21 23 14 14 8 32 11 22 27 27 9 22 23 51 16 22 38 31 10 29 38 22 16 22 28 19 12 29 10 12 7 5 5 5 18 14 11 30 14 7 20 10 6 6 12 8 17 15 28 12 26 15 33 23 30 10 15 29 11 15 23 33 9 19 13 20 26 19 31 17 39 7 35 20 13 24 11 35 22 28 7 9 18 17 4 3 6 9 21 10 16 29 37 29 18 29 7 9 7 9 21 13 25 14 7 20 29 9 13 37 10 11 12 11 13 16 10 14 12 5 21 30 22 13 15 5 8 7 10 12 21 13 6 12 7 3 1 6 5 19 26 12 11 14 21 32 30 26 6 3 4 7 5 3 9 6 11 14 11 12 11 7 16 7 20 7 10 3 4 4 7 13 4 12 15 12 5 4 3 5 5 20 9 10 25 18 4 5 7 5 7 3 5 12 9 16 17 7 7 14 11 3 3 4 7 18 9 16 8 3 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_89390220_89391345
seq2: B6Ng01-095D24.b_47_1147

seq1  GAATTCATTTCCTTTGTCCTGTCTCAAAGTTTTAAACATAAATTTTCCTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTTCCTTTGTCCTGTCTCAAAGTTTTAAACATAAATTTTCCTG  50

seq1  AAATACCTTTCCCATTTTCAGGAATGAATGTCTTTATAGAAAACTCTAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACCTTTCCCATTTTCAGGAATGAATGTCTTTATAGAAAACTCTAAT  100

seq1  TCAAAACTCATGCTGAATATCTTACGGATCTGCACACCAGTTTTGTTGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAACTCATGCTGAATATCTTACGGATCTGCACACCAGTTTTGTTGCT  150

seq1  ATGGCACCTTTCTGGCTCGCCCTTCGGTCTAGTCAGGTCATCTTCAAAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCACCTTTCTGGCTCGCCCTTCGGTCTAGTCAGGTCATCTTCAAAAA  200

seq1  GGTCACGAAATGCCTCTCACTCTCTCATTTCCGAAACTGTGCCACCATCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCACGAAATGCCTCTCACTCTCTCATTTCCGAAACTGTGCCACCATCA  250

seq1  TCAACTGACCAAGATACTCCAGGACTGCTCTGTGCCTCTTTAGAAGTAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACTGACCAAGATACTCCAGGACTGCTCTGTGCCTCTTTAGAAGTAGA  300

seq1  TGAAATTGTCCAATCCTAGTGGGATCTTTATAATGTGGGAAATCTTTGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAATTGTCCAATCCTAGTGGGATCTTTATAATGTGGGAAATCTTTGGT  350

seq1  CATCAGAGAGATGAATCAGAGTCCAGGTTCTTTGATTGAGACAATACACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAGAGAGATGAATCAGAGTCCAGGTTCTTTGATTGAGACAATACACA  400

seq1  AGACATATTCTTGAACTAGTTGGACATTATCTAAAGTGTGTTTGGTTGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACATATTCTTGAACTAGTTGGACATTATCTAAAGTGTGTTTGGTTGAT  450

seq1  AATGTGTCCCTCATGCATTTGCTCAATCCCTCCTAATTATCCTAACGTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTGTCCCTCATGCATTTGCTCAATCCCTCCTAATTATCCTAACGTTT  500

seq1  ATTTGCTGCCCTGTGATTACAGCTTCATTACCATGCGGGGTCAATGCACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGCTGCCCTGTGATTACAGCTTCATTACCATGCGGGGTCAATGCACC  550

seq1  ATGCATGGTAGCAGAGCAAATCCAGTTCAGCAGCAGCAAGGGGCACACGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCATGGTAGCAGAGCAAATCCAGTTCAGCAGCAGCAAGGGGCACACGT  600

seq1  CTTCTGCCAGTAACACACTTGACTTGAACAAGTATTTTGTTTTAAATACT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGCCAGTAACACACTTGACTTGAACAAGTATTTTGTTTTAAATACT  650

seq1  TTCGTTGTGCTGATTCTAAATTGTAGCACTACCAAAAGGATTGACATGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGTTGTGCTGATTCTAAATTGTAGCACTACCAAAAGGATTGACATGAT  700

seq1  AGGAAAGAGACTGTCTTGAAATTATATCTACCTTGGGATATACTAAAACT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAGAGACTGTCTTGAAATTATATCTACCTTGGGATATACTAAAACT  750

seq1  TCAAAACTATGTATCTGAAAGATTTCGGTTAATAAAAACATAAATTATAA  800
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TCAAAACTATGTATCTGAAAGATTTCGGTT-ATAAAAACATAAATTATAA  799

seq1  AGTATTTATTACTCATGCTAAGGATTGTGTCTTAGAGAATCCTATGAGCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  AGTATTTATTACTCATGCTAAGGATTGTGTCTTAGAGAATCCTATGAGC-  848

seq1  AATATATTAATTAATATCTTAAAGTTCAAATTACTGTTTTCTCTGTGAAG  900
      |||||||||||||||||| |||||||||||||||||||||||||||| ||
seq2  AATATATTAATTAATATC-TAAAGTTCAAATTACTGTTTTCTCTGTG-AG  896

seq1  ACTCCTTTGAAGAAATTCATATGGCAGGCTCTTACAACAGTTCTTACAAT  950
      |||||||||||||||||||||| ||| |||||||| ||||||||||||||
seq2  ACTCCTTTGAAGAAATTCATAT-GCA-GCTCTTAC-ACAGTTCTTACAAT  943

seq1  GAAAAGTAAATTGCATCTTAAAGTATTATTAATGCGAGCCTTAAAAGAAT  1000
      | ||||||||||||||| ||||||||   |||||| |||||||||   ||
seq2  G-AAAGTAAATTGCATC-TAAAGTAT--ATAATGC-AGCCTTAAA--GAT  986

seq1  ATTGAGGAAGTCGTTTAATTCATATTTTACATGTGAGGAAACAGAGTTTG  1050
      ||||||  |||||||||||||||||||||||||||| ||||| |||||||
seq2  ATTGAG--AGTCGTTTAATTCATATTTTACATGTGA-GAAAC-GAGTTTG  1032

seq1  AAAAAAAGCGTTATATTACTAACCAAGGCAGAAGCTGCTCACGACAAATG  1100
      ||||||   ||||||||||| | ||  || ||||||||| ||||||||||
seq2  AAAAAA--GGTTATATTACTTAACA--GCCGAAGCTGCT-ACGACAAATG  1077

seq1  TTCACCCTGACATCAGTGGCTTGTCC  1126
      ||| | ||||||||| |||| |||||
seq2  TTC-CTCTGACATCAATGGC-TGTCC  1101

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information