MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-196B04
Chromosome	16 (Build37)
Map Location	21,937,342 - 21,938,308
singlet/doublet	singlet
Overlap gene	Tmem41a
Upstream gene	LOC625123, LOC676915, 2310042E22Rik, Ephb3, 6430590I03Rik, Vps8, 2510009E07Rik, Ehhadh, LOC100043489, LOC546659, Map3k13, LOC624037
Downstream gene	Liph, Senp2, EG239760, Igf2bp2, EG545152, EG666421, Sfrs10, LOC100043507, Etv5, Dgkg, LOC671242, LOC666459, Crygs, Tbccd1, Dnajb11, Ahsg, Fetub
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC625123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC676915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	2310042E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66561 MGI:1913811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ephb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13845 MGI:104770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430590I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76222 MGI:1923472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins

name	Vps8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209018 MGI:2146407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510009E07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72190 MGI:1919440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehhadh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74147 MGI:1277964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043489 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC546659 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 8 Proteins pseudo : _no_value

name	Map3k13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71751 MGI:2444243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624037
definition	note : proteasome (prosome, macropain) subunit, beta type 3 pseudogene pseudo : _no_value

name	Tmem41a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66664 MGI:1913914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Liph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239759 MGI:2388029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Senp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75826 MGI:1923076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG239760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239760 MGI:3645174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins

name	Igf2bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319765 MGI:1890358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545152 MGI:3647324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 176 ESTs

name	EG666421 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666421 MGI:3645751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins pseudo : _no_value

name	Sfrs10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20462 MGI:106016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 186 ESTs, 10 Proteins

name	Etv5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104156 MGI:1096867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgkg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110197 MGI:105060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 7 Proteins

name	LOC666459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Crygs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12970 MGI:1298216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbccd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70573 MGI:1917823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 86 ESTs, 3 Proteins

name	Dnajb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67838 MGI:1915088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahsg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11625 MGI:107189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fetub (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59083 MGI:1890221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC625123 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267470 GeneID:625123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : hypothetical LOC625123 transcript_id : XM_889664.2

name	2310042E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803385 GeneID:66561 MGI:1913811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310042E22 gene transcript_id : NM_025634.2

name	Ephb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859547 GeneID:13845 MGI:104770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B3 transcript_id : NM_010143.1

name	Vps8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486982 GeneID:209018 MGI:2146407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 8 homolog (S. cerevisiae) transcript_id : NM_001081366.1

name	2510009E07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49457852 GeneID:72190 MGI:1919440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510009E07 gene transcript_id : NM_001001881.1

name	Ehhadh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541814 GeneID:74147 MGI:1277964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase transcript_id : NM_023737.2

name	LOC100043489 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267473 GeneID:100043489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043489, transcript variant 2 transcript_id : XM_001480816.1

name	LOC100043489 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267471 GeneID:100043489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043489, transcript variant 1 transcript_id : XM_001480812.1

name	Map3k13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95113637 GeneID:71751 MGI:2444243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 13 transcript_id : NM_172821.2

name	Tmem41a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359794 GeneID:66664 MGI:1913914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 41a transcript_id : NM_025693.2

name	Liph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970703 GeneID:239759 MGI:2388029
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, member H transcript_id : NM_001083894.1

name	Liph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971804 GeneID:239759 MGI:2388029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, member H transcript_id : NM_153404.2

name	Senp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560058 GeneID:75826 MGI:1923076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO/sentrin specific peptidase 2 transcript_id : NM_029457.2

name	EG239760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400117 GeneID:239760 MGI:3645174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : predicted gene, EG239760 transcript_id : XM_983617.1

name	Igf2bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942111 GeneID:319765 MGI:1890358
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 mRNA binding protein 2 transcript_id : NM_183029.1

name	EG545152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267477 GeneID:545152 MGI:3647324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 176 ESTs product : predicted gene, EG545152 transcript_id : XM_619384.4

name	Sfrs10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802029 GeneID:20462 MGI:106016
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) transcript_id : NM_009186.3

name	LOC100043507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267480 GeneID:100043507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 186 ESTs, 10 Proteins product : similar to G protein gamma-5 subunit transcript_id : XM_001480840.1

name	Etv5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24528549 GeneID:104156 MGI:1096867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 5 transcript_id : NM_023794.2

name	Dgkg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149723 GeneID:110197 MGI:105060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, gamma transcript_id : NM_138650.1

name	LOC671242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267482 GeneID:671242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 7 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001480849.1

name	Crygs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753531 GeneID:12970 MGI:1298216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, gamma S transcript_id : NM_009967.1

name	Tbccd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267487 GeneID:70573 MGI:1917823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 86 ESTs, 3 Proteins product : TBCC domain containing 1 transcript_id : XM_001480852.1

name	Dnajb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376452 GeneID:67838 MGI:1915088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 11 transcript_id : NM_026400.4

name	Ahsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304874 GeneID:11625 MGI:107189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-2-HS-glycoprotein transcript_id : NM_013465.1

name	Fetub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226226 GeneID:59083 MGI:1890221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetuin beta transcript_id : NM_001083905.1

name	Fetub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226246 GeneID:59083 MGI:1890221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetuin beta transcript_id : NM_021564.2

name	Fetub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226208 GeneID:59083 MGI:1890221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetuin beta transcript_id : NM_001083904.1

name	LOC625123 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82959144 GeneID:625123
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894757.1

name	2310042E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385096 GeneID:66561 MGI:1913811
definition	codon_start : 1 product : hypothetical protein LOC66561 protein_id : NP_079910.1

name	Ephb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859548 CCDS:CCDS28060.1 GeneID:13845 MGI:104770
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008046 - axon guidance receptor activity [Evidence IDA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005005 - transmembrane-ephrin receptor activity [Evidence TAS] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : Eph receptor B3 protein_id : NP_034273.1

name	Vps8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486983 GeneID:209018 MGI:2146407
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 8 homolog protein_id : NP_001074835.1

name	2510009E07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457853 CCDS:CCDS28062.1 GeneID:72190 MGI:1919440
definition	codon_start : 1 product : hypothetical protein LOC72190 protein_id : NP_001001881.1

name	Ehhadh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541815 CCDS:CCDS28063.1 GeneID:74147 MGI:1277964
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003857 - 3-hydroxyacyl-CoA dehydrogenase activity [Evidence TAS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004165 - dodecenoyl-CoA delta-isomerase activity [Evidence IEA]; GO:0004300 - enoyl-CoA hydratase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : L-bifunctional enzyme product : L-specific multifunctional beta-oxdiation protein protein_id : NP_076226.2

name	LOC100043489 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267472 GeneID:100043489
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480862.1

name	LOC100043489 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267474 GeneID:100043489
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480866.1

name	Map3k13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:95113638 GeneID:71751 MGI:2444243
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase kinase kinase 13 protein_id : NP_766409.2

name	Tmem41a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313376 CCDS:CCDS28064.1 GeneID:66664 MGI:1913914
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 41a protein_id : NP_079969.1

name	Liph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510279 GeneID:239759 MGI:2388029
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lipase H product : lipase, member H isoform 2 protein_id : NP_700453.1

name	Liph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970704 GeneID:239759 MGI:2388029
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lipase H product : lipase, member H isoform 1 protein_id : NP_001077363.1

name	Senp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386400 CCDS:CCDS28065.1 GeneID:75826 MGI:1923076
definition	GO_component : GO:0005643 - nuclear pore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016929 - SUMO-specific protease activity [Evidence ISS] GO_process : GO:0016926 - protein desumoylation [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0030111 - regulation of Wnt receptor signaling pathway [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : SUMO-1/Smt3-specific isopeptidase 2; SUMO-1 protease-1 product : SUMO/sentrin specific protease 2 protein_id : NP_083733.1

name	EG239760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267300 GeneID:239760 MGI:3645174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988711.2

name	Igf2bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942112 GeneID:319765 MGI:1890358
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 note : insulin-like growth factor 2 mRNA-binding protein 2; insulin-like growth factor 2, binding protein 2 product : insulin-like growth factor 2 mRNA binding protein 2 protein_id : NP_898850.1

name	EG545152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959168 GeneID:545152 MGI:3647324
definition	codon_start : 1 product : similar to Transmembrane protein 97 protein_id : XP_619384.2

name	Sfrs10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677975 GeneID:20462 MGI:106016
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS] [Evidence IEA] codon_start : 1 note : silica-induced gene 41 product : splicing factor, arginine/serine-rich 10 protein_id : NP_033212.1

name	LOC100043507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267481 GeneID:100043507
definition	codon_start : 1 product : similar to G protein gamma-5 subunit protein_id : XP_001480890.1

name	Etv5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24528550 GeneID:104156 MGI:1096867
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : ets variant gene 5 protein_id : NP_076283.2

name	Dgkg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149724 CCDS:CCDS28068.1 GeneID:110197 MGI:105060
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : diacylglycerol kinase, gamma 3; diacylglycerol kinase, gamma 90kDa product : diacylglycerol kinase, gamma protein_id : NP_619591.1

name	LOC671242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267483 GeneID:671242
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480899.1

name	Crygs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753532 CCDS:CCDS28069.1 GeneID:12970 MGI:1298216
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IMP] [Evidence IEA] GO_process : GO:0002009 - morphogenesis of an epithelium [Evidence IMP]; GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 note : opacity due to poor secondary fiber cell junction; recessive nuclear cataract product : crystallin, gamma S protein_id : NP_034097.1

name	Tbccd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267488 GeneID:70573 MGI:1917823
definition	codon_start : 1 product : TBCC domain containing 1 protein_id : XP_001480902.1

name	Dnajb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625998 CCDS:CCDS28070.1 GeneID:67838 MGI:1915088
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence IDA] GO_process : GO:0006381 - mRNA editing [Evidence ISS] [Evidence IDA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily B, member 11 protein_id : NP_080676.3

name	Ahsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304875 CCDS:CCDS28071.1 GeneID:11625 MGI:107189
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0019210 - kinase inhibitor activity [Evidence ISS] GO_process : GO:0006953 - acute-phase response [Evidence ISS]; GO:0030502 - negative regulation of bone mineralization [Evidence IDA]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence ISS]; GO:0001503 - ossification [Evidence IDA]; GO:0006907 - pinocytosis [Evidence ISS]; GO:0050766 - positive regulation of phagocytosis [Evidence ISS]; GO:0050727 - regulation of inflammatory response [Evidence ISS] codon_start : 1 product : alpha-2-HS-glycoprotein protein_id : NP_038493.1

name	Fetub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947006 GeneID:59083 MGI:1890221
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : fetuin beta isoform 1 protein_id : NP_067539.1

name	Fetub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226227 GeneID:59083 MGI:1890221
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : fetuin beta isoform 3 protein_id : NP_001077374.1

name	Fetub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226209 GeneID:59083 MGI:1890221
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : fetuin beta isoform 2 protein_id : NP_001077373.1

name	LOC666459 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666459
definition	number : 1 pseudo : _no_value

name	LOC676915 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267298 GeneID:676915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to nuclear domain 10 protein 52 like 1 pseudo : _no_value transcript_id : XR_034101.1

name	6430590I03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94400115 GeneID:76222 MGI:1923472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins product : RIKEN cDNA 6430590I03 gene transcript_id : XR_002321.1

name	LOC546659 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267476 GeneID:546659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 8 Proteins product : similar to Ribosomal protein L12 pseudo : _no_value transcript_id : XR_034852.1

name	EG666421 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267478 GeneID:666421 MGI:3645751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins product : predicted gene, EG666421 pseudo : _no_value transcript_id : XR_035704.1

clone name	MSMg01-184L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-400A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370P08
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-051L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name		B6Ng01-196B04.g
ACC		GA018315
length		963
definition		B6Ng01-196B04.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence		gaattcagggagactcaagcaggaggacttacatgagtttgaggacaaaa tacaactgggctggggacacatctcagaagtaaggcacttgccctgccag cctaagggcctgcatgtgctcaccaatacccagctcaccaaacaaacaaa cagcctgcggcagaggcacaagcctggaaccccagtactgggagacagaa ggatccaggagcccagctactctagccgactcagtgtgctctaggctcag taaaagactcttcaaacacaaagtaggcagtgattgaggaagatatcagg agtaaacctctggcttccacacgtgctcacacatacacaagcctacacac acacaagcacagacacacacacacaagcacacgcataaaattaagtaaag taataaataaaaacattgttcccgggaaccgaagcagtcagaattttaac tcaaagtcacagagccacagagcaggtaatgaccagaactgaggcttggt cacaggtctgtgcttcctaaagacatcataagaaccagtccttcccagct cccaggtgggaagaaggagcactgtgggaaacttcaggtccacactgctc tccgcccatgagctgatgctccgggacccagtgctccaggtgtgcccccc ccccccccaccttaccttcttctgcagcagggccactttatcaggaaagt aggagatgaccagctgtttgccgaaaaagactggaagcaggtagcagcct gtggcacccacggatgtcaacacgcagcacagcaaaagtcccagccatgg cccgaacaaggcaccagccaaaaacattctgcaagaaagcagcctcagcc acggacatctagcagcttccaggggggcttgtcctgggtggggcatgtgc acttgctctttccctttcagtgactttcacagcccaaacccaagtcactc taaagagtgaatg
quality values		Open. Hide. 49 44 21 39 62 59 43 56 62 33 20 9 11 13 10 18 10 10 11 9 16 13 23 8 8 18 19 27 54 62 59 59 35 59 59 54 28 56 62 62 62 62 59 62 59 41 56 62 62 62 62 62 62 59 56 59 56 34 25 23 27 28 36 27 23 28 38 18 23 23 16 50 48 62 59 62 40 54 54 56 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 62 54 54 62 59 62 62 54 49 33 59 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 52 58 52 58 58 54 54 54 35 58 58 52 54 49 34 27 25 50 46 58 58 58 49 58 54 54 58 58 58 58 58 58 58 58 58 47 46 58 54 54 58 52 58 58 52 52 47 41 23 41 24 24 20 41 41 34 52 52 52 52 54 54 39 58 42 42 51 58 46 50 50 53 58 52 58 22 47 58 50 49 52 53 53 52 58 35 50 58 31 49 39 50 51 49 39 50 39 58 46 54 46 46 54 50 50 30 40 32 58 49 49 52 52 51 49 51 46 58 31 58 25 28 40 50 50 41 52 58 40 52 53 53 50 50 38 58 50 53 53 50 49 58 44 32 53 41 32 50 50 35 50 38 41 33 58 37 44 35 25 40 49 54 47 37 41 49 54 47 32 42 49 53 53 54 37 39 28 40 40 38 54 39 54 47 27 54 37 51 53 51 37 45 38 42 37 44 33 51 54 31 46 54 42 31 53 53 47 30 17 32 23 52 38 34 52 31 42 37 53 41 46 52 52 54 51 40 45 54 29 37 32 37 51 26 52 52 37 53 33 42 32 34 52 40 32 49 40 32 34 53 34 42 32 35 53 31 47 32 32 28 35 34 20 35 33 52 34 52 40 32 40 51 46 46 51 51 51 46 46 25 27 25 17 51 32 30 42 26 36 31 31 31 28 31 32 43 28 26 22 27 31 31 46 31 19 20 21 26 31 51 42 31 33 38 31 29 31 36 48 37 29 26 31 26 27 32 11 25 15 23 27 16 31 28 16 27 31 30 31 48 35 26 21 33 5 22 46 42 46 13 8 13 14 30 31 16 11 7 21 31 30 28 25 18 24 13 31 29 11 46 31 32 14 6 22 28 24 27 37 37 24 23 15 19 16 30 31 31 27 27 22 22 17 20 29 14 16 21 14 19 33 31 30 7 31 38 38 44 17 13 18 13 48 26 23 13 17 13 14 19 26 31 19 44 27 14 25 26 18 19 9 24 24 20 23 18 14 15 13 11 7 5 24 34 36 23 16 19 33 18 20 23 32 17 10 43 16 19 21 8 8 22 20 27 19 10 9 27 18 22 26 19 14 12 21 7 4 6 10 34 23 32 10 5 13 30 13 14 16 26 13 14 16 16 30 47 34 30 21 10 11 15 15 6 9 17 9 18 4 3 3 20 16 28 13 19 4 6 29 18 15 12 10 27 6 9 10 10 18 30 7 40 5 22 34 9 18 40 28 16 26 20 16 28 14 10 15 34 19 3 6 13 19 14 18 16 12 5 17 19 7 34 10 11 6 4 4 10 5 4 16 10 14 16 27 18 7 16 25 10 5 14 24 14 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_21937342_21938308
seq2: B6Ng01-196B04.g_65_1027

seq1  GAATTCAGGGAGACTCAAGCAGGAGGACTTACATGAGTTTGAGGACAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGGGAGACTCAAGCAGGAGGACTTACATGAGTTTGAGGACAAAA  50

seq1  TACAACTGGGCTGGGGACACATCTCAGAAGTAAGGCACTTGCCCTGCCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAACTGGGCTGGGGACACATCTCAGAAGTAAGGCACTTGCCCTGCCAG  100

seq1  CCTAAGGGCCTGCATGTGCTCACCAATACCCAGCTCACCAAACAAACAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAGGGCCTGCATGTGCTCACCAATACCCAGCTCACCAAACAAACAAA  150

seq1  CAGCCTGCGGCAGAGGCACAAGCCTGGAACCCCAGTACTGGGAGACAGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTGCGGCAGAGGCACAAGCCTGGAACCCCAGTACTGGGAGACAGAA  200

seq1  GGATCCAGGAGCCCAGCTACTCTAGCCGACTCAGTGTGCTCTAGGCTCAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCCAGGAGCCCAGCTACTCTAGCCGACTCAGTGTGCTCTAGGCTCAG  250

seq1  TAAAAGACTCTTCAAACACAAAGTAGGCAGTGATTGAGGAAGATATCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGACTCTTCAAACACAAAGTAGGCAGTGATTGAGGAAGATATCAGG  300

seq1  AGTAAACCTCTGGCTTCCACACGTGCTCACACATACACAAGCCTACACAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAACCTCTGGCTTCCACACGTGCTCACACATACACAAGCCTACACAC  350

seq1  ACACAAGCACAGACACACACACACAAGCACACGCATAAAATTAAGTAAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAAGCACAGACACACACACACAAGCACACGCATAAAATTAAGTAAAG  400

seq1  TAATAAATAAAAACATTGTTCCCGGGAACCGAAGCAGTCAGAATTTTAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAAATAAAAACATTGTTCCCGGGAACCGAAGCAGTCAGAATTTTAAC  450

seq1  TCAAAGTCACAGAGCCACAGAGCAGGTAATGACCAGAACTGAGGCTTGGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGTCACAGAGCCACAGAGCAGGTAATGACCAGAACTGAGGCTTGGT  500

seq1  CACAGGTCTGTGCTTCCTAAAGACATCATAAGAACCAGTCCTTCCCAGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGGTCTGTGCTTCCTAAAGACATCATAAGAACCAGTCCTTCCCAGCT  550

seq1  CCCAGGTGGGAAGAAGGAGCACTGTGGGAAACTTCAGGTCCACACTGCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGTGGGAAGAAGGAGCACTGTGGGAAACTTCAGGTCCACACTGCTC  600

seq1  TCCGCCCATGAGCTGATGCTCCGGGACCCAGTGCTCCAGGTGTG-CCCCC  649
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TCCGCCCATGAGCTGATGCTCCGGGACCCAGTGCTCCAGGTGTGCCCCCC  650

seq1  CCCCCCCCACCTTACCTTCTTCTGCAGCAGGGCCACTTTATCAGGAAAGT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCCCACCTTACCTTCTTCTGCAGCAGGGCCACTTTATCAGGAAAGT  700

seq1  AGGAGATGACCAGCTGTTTGCCG-AAAAGACTGGAAAGCAGGTAGCAGCC  748
      ||||||||||||||||||||||| |||||||||| |||||||||||||||
seq2  AGGAGATGACCAGCTGTTTGCCGAAAAAGACTGG-AAGCAGGTAGCAGCC  749

seq1  TGTGGCACCCACGGATGTCAACACGCAGCACAGCAAAAGTCCCAGCCATG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGCACCCACGGATGTCAACACGCAGCACAGCAAAAGTCCCAGCCATG  799

seq1  GCCCGAACAAGGCACCAGCC-AAAACATTCTGCAAAGAAAGCAGCCTCAG  847
      |||||||||||||||||||| |||||||||||| ||||||||||||||||
seq2  GCCCGAACAAGGCACCAGCCAAAAACATTCTGC-AAGAAAGCAGCCTCAG  848

seq1  CCACGGGACATCTAGCAGCTTCCAGGGGGGCTTGTCCTGGGTGGGGCCTG  897
      |||| |||||||||||||||||||||||||||||||||||||||||| ||
seq2  CCAC-GGACATCTAGCAGCTTCCAGGGGGGCTTGTCCTGGGTGGGGCATG  897

seq1  TGCACCTGCTCCTTCCCTTTCAGTGACTTTCACAGCCCCAAACCCAAGGC  947
      ||||| ||||| ||||||||||||||||||||||| ||||||||||||  
seq2  TGCACTTGCTCTTTCCCTTTCAGTGACTTTCACAG-CCCAAACCCAAG--  944

seq1  CCACTCTAAAGAGGTGAATG  967
       ||||||||||| |||||||
seq2  TCACTCTAAAGA-GTGAATG  963

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information