MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-210P22
Chromosome	16 (Build37)
Map Location	37,780,876 - 37,945,666
singlet/doublet	doublet
Overlap gene	Fstl1, LOC100043264, Lrrc58, Gpr156, LOC100043271
Upstream gene	Slc15a2, Eaf2, Iqcb1, LOC628101, Golgb1, Hcls1, Fbxo40, LOC100043252, Polq, Stxbp5l, Gtf2e1, Rabl3, Hgd, Ndufb4, LOC100043709
Downstream gene	LOC100043713, Gsk3b, Nr1i2, 4932425I24Rik, Cox17, LOC100043715, Popdc2, Pla1a, Adprh, Cd80, LOC667353, Ck-ps3, 4930455C21Rik, 9630046K23Rik, Tmem39a, Cdgap, B4galt4, LOC100043289, Upk1b, 4930435E12Rik, Igsf11
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc15a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57738 MGI:1890457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eaf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106389 MGI:2146616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320299 MGI:2443764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 20 ESTs

name	Golgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224139 MGI:1099447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 153 ESTs, 6 Proteins

name	Hcls1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15163 MGI:104568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207215 MGI:2443753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043252 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Polq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77782 MGI:2155399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stxbp5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207227 MGI:2443815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf2e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74197 MGI:1921447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67657 MGI:1914907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15233 MGI:96078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68194 MGI:1915444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043709 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1345 ESTs, 7 Proteins pseudo : _no_value

name	Fstl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14314 MGI:102793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lrrc58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320184 MGI:2443542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239845 MGI:2653880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043713 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs

name	Gsk3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56637 MGI:1861437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1i2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18171 MGI:1337040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932425I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320214 MGI:2443598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12856 MGI:1333806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Popdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64082 MGI:1930150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pla1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:85031 MGI:1934677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adprh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11544 MGI:1098234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd80 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12519 MGI:101775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667353 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 5 Proteins pseudo : _no_value

name	Ck-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12708 MGI:88406
definition	note : creatine kinase pseudogene 3 pseudo : _no_value

name	4930455C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76916 MGI:1922139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630046K23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224143 MGI:2444232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem39a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67846 MGI:1915096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdgap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12549 MGI:1333857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56375 MGI:1928387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Upk1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22268 MGI:98912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930435E12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74663 MGI:1921913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 1 Protein

name	Igsf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207683 MGI:2388477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc15a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227201 GeneID:57738 MGI:1890457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 15 (H+/peptide transporter), member 2 transcript_id : NM_021301.2

name	Eaf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254104 GeneID:106389 MGI:2146616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELL associated factor 2 transcript_id : NM_134111.2

name	Iqcb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377605 GeneID:320299 MGI:2443764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ calmodulin-binding motif containing 1 transcript_id : NM_177128.3

name	Golgb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267530 GeneID:224139 MGI:1099447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 153 ESTs, 6 Proteins product : golgi autoantigen, golgin subfamily b, macrogolgin 1 transcript_id : XM_001481060.1

name	Hcls1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680186 GeneID:15163 MGI:104568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic cell specific Lyn substrate 1 transcript_id : NM_008225.1

name	Fbxo40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82617543 GeneID:207215 MGI:2443753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 40 transcript_id : NM_001037321.1

name	Polq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30387614 GeneID:77782 MGI:2155399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), theta transcript_id : NM_029977.1

name	Stxbp5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374311 GeneID:207227 MGI:2443815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 5-like transcript_id : NM_172440.2

name	Gtf2e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351823 GeneID:74197 MGI:1921447
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II E, polypeptide 1 (alpha subunit) transcript_id : NM_028812.2

name	Rabl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948289 GeneID:67657 MGI:1914907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB, member of RAS oncogene family-like 3 transcript_id : NM_001042499.1

name	Hgd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152515 GeneID:15233 MGI:96078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homogentisate 1, 2-dioxygenase transcript_id : NM_013547.2

name	Ndufb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314825 GeneID:68194 MGI:1915444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4 transcript_id : NM_026610.1

name	Fstl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802756 GeneID:14314 MGI:102793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : follistatin-like 1 transcript_id : NM_008047.3

name	LOC100043264 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267398 GeneID:100043264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to hCG1657343 transcript_id : XM_001479854.1

name	Lrrc58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347494 GeneID:320184 MGI:2443542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 58 transcript_id : NM_177093.3

name	Gpr156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254200 GeneID:239845 MGI:2653880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 156 transcript_id : NM_153394.2

name	LOC100043713 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267533 GeneID:100043713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs product : hypothetical protein LOC100043713 transcript_id : XM_001481072.1

name	Gsk3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802072 GeneID:56637 MGI:1861437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycogen synthase kinase 3 beta transcript_id : NM_019827.4

name	Nr1i2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363671 GeneID:18171 MGI:1337040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group I, member 2 transcript_id : NM_010936.2

name	4932425I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486623 GeneID:320214 MGI:2443598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932425I24 gene transcript_id : NM_001081025.1

name	Cox17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816953 GeneID:12856 MGI:1333806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit XVII assembly protein homolog (yeast) transcript_id : NM_001017429.2

name	LOC100043715 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267535 GeneID:100043715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043715 transcript_id : XM_001481074.1

name	Popdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517507 GeneID:64082 MGI:1930150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : popeye domain containing 2 transcript_id : NM_001081984.1

name	Popdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517506 GeneID:64082 MGI:1930150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : popeye domain containing 2 transcript_id : NM_022318.2

name	Pla1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801864 GeneID:85031 MGI:1934677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A1 member A transcript_id : NM_134102.3

name	Adprh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87252722 GeneID:11544 MGI:1098234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylarginine hydrolase transcript_id : NM_007414.3

name	Cd80 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038144 GeneID:12519 MGI:101775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD80 antigen transcript_id : NM_009855.2

name	4930455C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13357215 GeneID:76916 MGI:1922139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930455C21 gene transcript_id : NM_024273.1

name	9630046K23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802439 GeneID:224143 MGI:2444232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630046K23 gene transcript_id : NM_172380.2

name	Tmem39a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754068 GeneID:67846 MGI:1915096
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 39a transcript_id : NM_026407.2

name	Cdgap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55770847 GeneID:12549 MGI:1333857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc42 GTPase-activating protein transcript_id : NM_020260.2

name	B4galt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344191 GeneID:56375 MGI:1928387
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4 transcript_id : NM_019804.2

name	Upk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384775 GeneID:22268 MGI:98912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroplakin 1B transcript_id : NM_178924.3

name	4930435E12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400187 GeneID:74663 MGI:1921913
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 1 Protein product : RIKEN cDNA 4930435E12 gene transcript_id : XM_156106.6

name	Igsf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254204 GeneID:207683 MGI:2388477
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 11 transcript_id : NM_170599.2

name	Slc15a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946598 CCDS:CCDS28156.1 GeneID:57738 MGI:1890457
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015334 - high affinity oligopeptide transporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006857 - oligopeptide transport [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : proton-dependent high affinity oligopeptide transporter PepT2 product : solute carrier family 15 (H+/peptide transporter), member 2 protein_id : NP_067276.1

name	Eaf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527340 GeneID:106389 MGI:2146616
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0008629 - induction of apoptosis by intracellular signals [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : testosterone regulated apoptosis inducer and tumor suppressor protein_id : NP_598872.1

name	Iqcb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893085 CCDS:CCDS28157.1 GeneID:320299 MGI:2443764
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : IQ calmodulin-binding motif containing 1 protein_id : NP_796102.1

name	Golgb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267531 GeneID:224139 MGI:1099447
definition	codon_start : 1 product : golgi autoantigen, golgin subfamily b, macrogolgin 1 protein_id : XP_001481110.1

name	Hcls1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680187 GeneID:15163 MGI:104568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042531 - positive regulation of tyrosine phosphorylation of STAT protein [Evidence IMP]; GO:0009725 - response to hormone stimulus [Evidence IDA] codon_start : 1 exception : mismatches in translation product : hematopoietic cell specific Lyn substrate 1 protein_id : NP_032251.1

name	Fbxo40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617544 GeneID:207215 MGI:2443753
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 40 protein_id : NP_001032398.1

name	Polq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387615 CCDS:CCDS28158.1 GeneID:77782 MGI:2155399
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP] [Evidence IGI]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : DNA polymerase theta protein_id : NP_084253.1

name	Stxbp5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369591 CCDS:CCDS28159.1 GeneID:207227 MGI:2443815
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : xb-tomosyn-2; s-tomosyn-2; b-tomosyn-2; m-tomosyn-2 product : syntaxin binding protein 5-like protein_id : NP_766028.1

name	Gtf2e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312660 CCDS:CCDS28160.1 GeneID:74197 MGI:1921447
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005673 - transcription factor TFIIE complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : general transcription factor IIE, polypeptide 1 (alpha subunit, 56kDa); general transcription factor II E, polypeptide 1 (alpha subunit, 56kDa) product : general transcription factor II E, polypeptide 1 (alpha subunit) protein_id : NP_083088.1

name	Rabl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948290 GeneID:67657 MGI:1914907
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB, member of RAS oncogene family-like 3 protein_id : NP_001035964.1

name	Hgd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549763 GeneID:15233 MGI:96078
definition	GO_function : GO:0004411 - homogentisate 1,2-dioxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006559 - L-phenylalanine catabolism [Evidence IEA]; GO:0006572 - tyrosine catabolism [Evidence IEA]; GO:0006570 - tyrosine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alkaptonuria product : homogentisate 1, 2-dioxygenase protein_id : NP_038575.1

name	Ndufb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314826 CCDS:CCDS28161.1 GeneID:68194 MGI:1915444
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH:ubiquinone oxidoreductase B15 subunit product : NADH dehydrogenase 1 beta subcomplex 4 protein_id : NP_080886.1

name	Fstl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560699 GeneID:14314 MGI:102793
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] codon_start : 1 note : follistatin-like product : follistatin-like 1 protein_id : NP_032073.2

name	LOC100043264 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267399 GeneID:100043264
definition	codon_start : 1 product : similar to hCG1657343 protein_id : XP_001479904.1

name	Lrrc58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347495 GeneID:320184 MGI:2443542
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 58 protein_id : NP_796067.2

name	Gpr156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254201 CCDS:CCDS28162.1 GeneID:239845 MGI:2653880
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004965 - GABA-B receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GABAB-related G-protein coupled receptor product : G protein-coupled receptor 156 protein_id : NP_700443.2

name	LOC100043713 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267534 GeneID:100043713
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481122.1

name	Gsk3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790077 CCDS:CCDS28163.1 GeneID:56637 MGI:1861437
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0004696 - glycogen synthase kinase 3 activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0050321 - tau-protein kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0008283 - cell proliferation [Evidence TAS]; GO:0045444 - fat cell differentiation [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0000320 - re-entry into mitotic cell cycle [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] [Evidence IGI] codon_start : 1 product : glycogen synthase kinase 3 beta protein_id : NP_062801.1

name	Nr1i2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468913 CCDS:CCDS28164.1 GeneID:18171 MGI:1337040
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Pregnane X receptor product : nuclear receptor subfamily 1, group I, member 2 protein_id : NP_035066.1

name	4932425I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486624 GeneID:320214 MGI:2443598
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320214 protein_id : NP_001074494.1

name	Cox17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945234 CCDS:CCDS28165.1 GeneID:12856 MGI:1333806
definition	GO_component : GO:0005758 - mitochondrial intermembrane space [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016531 - copper chaperone activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IDA]; GO:0008047 - enzyme activator activity [Evidence IMP]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cytochrome c oxidase assembly protein product : cytochrome c oxidase subunit XVII assembly protein homolog protein_id : NP_001017429.1

name	LOC100043715 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267536 GeneID:100043715
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481124.1

name	Popdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612497 GeneID:64082 MGI:1930150
definition	GO_component : GO:0016020 - membrane [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; popeye protein 2; popeye 2 product : popeye domain containing 2 isoform 2 protein_id : NP_071713.1

name	Popdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517508 GeneID:64082 MGI:1930150
definition	GO_component : GO:0016020 - membrane [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; popeye protein 2; popeye 2 product : popeye domain containing 2 isoform 1 protein_id : NP_001075453.1

name	Pla1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982575 CCDS:CCDS28166.1 GeneID:85031 MGI:1934677
definition	codon_start : 1 exception : mismatches in translation note : phosphatidylserine-specific phospholipase A1 product : phospholipase A1 member A protein_id : NP_598863.2

name	Adprh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680658 CCDS:CCDS28167.1 GeneID:11544 MGI:1098234
definition	GO_function : GO:0003875 - ADP-ribosylarginine hydrolase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : ADP-ribosylarginine hydrolase protein_id : NP_031440.1

name	Cd80 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983684 CCDS:CCDS28168.1 GeneID:12519 MGI:101775
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IDA] codon_start : 1 note : B7 protein product : CD80 antigen precursor protein_id : NP_033985.3

name	4930455C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13357216 CCDS:CCDS28169.1 GeneID:76916 MGI:1922139
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76916 protein_id : NP_077235.1

name	9630046K23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369505 CCDS:CCDS28170.1 GeneID:224143 MGI:2444232
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 product : RIKEN cDNA 9630046K23 protein_id : NP_759012.1

name	Tmem39a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754069 CCDS:CCDS28171.1 GeneID:67846 MGI:1915096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 39a protein_id : NP_080683.2

name	Cdgap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55770848 CCDS:CCDS28172.1 GeneID:12549 MGI:1333857
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 product : Cdc42 GTPase-activating protein protein_id : NP_064656.2

name	B4galt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789889 CCDS:CCDS28173.1 GeneID:56375 MGI:1928387
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003945 - N-acetyllactosamine synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : beta-1,4-galactosyltransferase IV product : UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4 protein_id : NP_062778.1

name	Upk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725788 CCDS:CCDS28174.1 GeneID:22268 MGI:98912
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : uroplakin 1B protein_id : NP_849255.1

name	4930435E12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28493910 GeneID:74663 MGI:1921913
definition	codon_start : 1 product : hypothetical protein LOC74663 protein_id : XP_156106.2

name	Igsf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254205 CCDS:CCDS28175.1 GeneID:207683 MGI:2388477
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] codon_start : 1 note : immunoglobulin superfamily, member 13 product : immunoglobulin superfamily, member 11 protein_id : NP_733548.2

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 1 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 2 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 3 pseudo : _no_value

name	LOC100043271 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043271
definition	number : 1 pseudo : _no_value

name	LOC100043271 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043271
definition	number : 2 pseudo : _no_value

name	LOC100043271 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043271
definition	number : 3 pseudo : _no_value

name	LOC100043289 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043289
definition	number : 2 pseudo : _no_value

name	LOC100043289 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043289
definition	number : 1 pseudo : _no_value

name	Ck-ps3 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	note : region homologous with murine creatine kinase B exon pseudo : _no_value

name	LOC628101 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267394 GeneID:628101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 20 ESTs product : hypothetical LOC628101 transcript_id : XR_035428.1

name	LOC100043709 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267532 GeneID:100043709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1345 ESTs, 7 Proteins product : similar to ribosomal protein L9 pseudo : _no_value transcript_id : XR_034971.1

name	LOC667353 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267403 GeneID:667353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 5 Proteins product : similar to SET domain-containing protein pseudo : _no_value transcript_id : XR_034433.1

clone name	MSMg01-205A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490I18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506A19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004G06
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-210P22.b	B6Ng01-210P22.g
ACC	GA029187	GA029188
length	713	791
definition	B6Ng01-210P22.b	B6Ng01-210P22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(37,780,876 - 37,781,587)	(37,944,877 - 37,945,666)
sequence	gaattccaggtataagtttgtgtgcccctggagtcttgaggaatgtatat tagttcctctgacatgacaggctagaggagacacacagcccaactgccag cttcaaaaggacaatcttagtaagtgtccaagtgtccccctatgcaccct ggcttagttttactctgcattctgggtctaggaattcattatgataaatt acatatacaagggacagatttaccgaggagatcactcactccagcaagga atccacacttgagccatgagctgggaatgtgtctcttgagacggtagtgt ggagagccaataacagctccacagacagatgcgctgtgcttagctgttag gcatgccatgctagcagactgtcagggctttgtccctaggaagctacact gcttaatgtcatttacatctcctcacatgcatgtagttaaccactaggtt agtatctgccaggctggggagggttgggagtgcctctgcattctatagaa ttgttcattaatctacagagtaaaccttccacccccacccccacccccaa ctacagcttcagaaagagcacttgcagcttacacatcagctagcaaaatg atctcctgtttgtcctgtagcaaataaactacttgctgtgatgctaaagg tgccgttgggaatccagaagttgaagcatagctagacaccactgaatagc ccaaaacagatgg	gaattcttgtgctgtctggacagatgactgaatattaaattacgaagcaa acaaggcatggctattcgtatcctaattttgttggaattccaacagaaag ggtctttctctctttttttctagccacaccctactttcctactgagtatt ctagcaatgagcaatgtgaggagtcacagagcaaactacactatggtagt ctggaaggacgtgtgtttttacattgtcttctccatcttagtggtaaacc aaagacctatttttggcttgataatgctttgttgtctggaccatcttttg aagagaggatgtttggcagcatgcctggccctctcctaacagtttcaaca actgccagtcactgccaactgtgcccagtatgtgccaaattgagactccc tggcgtcatgagaattttggtccctttaaaagcacagaaatgttaaggga ctatgtttttgttttaatcccaggtgtggggttgctttagactgtccaca gcagctgactatgatttgtctcatgctcgggcagggatgttattttgcca gctgaaaatagtttacatttggcattctggggacgcttcagagggtatac aaatgctgctgcccttccttcttctgctatagctgattgctggttggagg tatcctggtgatgaagatcacacttgccccaaggacttccttaatcaaca ggaagcagtctaacaagatcaacaccttctttcccctctaaccttcttgc tctcctacctagggtttggagggttggaaggttggagaagg
quality values	Open. Hide. 49 29 28 34 58 58 25 23 58 62 62 41 48 62 54 62 62 62 62 49 49 49 62 49 62 62 62 62 62 49 11 11 11 10 19 15 15 22 22 16 43 43 34 36 44 43 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 59 62 62 62 62 59 62 59 62 62 62 59 62 39 49 34 46 33 23 26 43 51 56 48 48 33 32 54 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 59 59 62 62 62 62 62 54 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 62 56 62 54 47 42 62 62 51 56 47 31 31 56 46 56 43 56 56 46 62 56 56 47 37 39 47 43 43 56 56 56 56 56 56 56 56 43 39 38 56 41 40 43 42 46 34 43 47 47 42 43 47 35 42 47 47 52 52 62 62 47 27 25 23 43 42 52 52 47 35 27 17 12 34 27 42 43 52 48 52 52 30 39 35 52 48 47 52 52 34 43 47 34 27 22 9 16 32 49 37 42 43 50 52 47 52 54 52 52 52 52 35 39 47 58 37 47 33 52 41 52 58 29 35 10 8 7 22 52 42 54 52 37 42 13 18 12 15 12 14 33 36 36 45 54 52 54 50 46 52 47 47 34 41 45 52 54 37 42 25 24 35 26 18 17 18 17 27 25 23 21 9 24 16 24 31 23 27 37 20 30 19 17 35 30 13 17 6 10 15 9 13 18 18 22 18 10 10 9 10 14 13 18 10 16 9 9 14 9 27 32 23 16 10 22 21 40 6 9 7	Open. Hide. 62 38 51 44 62 62 62 62 62 62 23 18 18 22 13 18 22 28 32 44 30 24 43 44 43 62 59 59 62 62 59 62 62 62 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 34 43 50 48 45 34 54 56 35 38 43 28 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 54 62 54 62 62 62 62 62 62 62 54 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 58 58 58 54 54 45 58 58 58 58 58 58 58 49 58 58 58 49 58 54 58 58 58 45 41 58 58 58 58 49 45 58 58 58 58 54 58 53 52 54 58 58 58 58 53 58 58 54 54 54 58 49 28 41 58 58 58 58 41 49 58 58 58 54 58 37 51 58 58 58 58 58 58 40 50 42 41 58 58 41 49 50 51 58 58 58 58 58 50 50 45 58 54 58 58 58 58 58 51 40 47 44 58 49 53 49 50 58 27 58 54 49 39 35 47 53 50 58 50 52 58 54 58 58 54 51 58 50 58 58 53 51 46 58 50 43 50 52 58 50 51 54 39 46 50 50 53 40 53 58 54 58 47 49 54 49 54 51 54 51 39 39 51 49 20 49 31 35 41 43 50 51 54 42 22 35 31 26 52 54 54 27 39 39 40 31 47 40 44 54 49 49 49 44 42 30 29 38 42 51 32 30 54 44 44 49 54 31 29 44 47 41 24 35 28 35 17 54 54 42 32 47 42 42 25 40 41 51 49 32 24 37 39 41 52 45 42 54 53 42 42 51 46 51 33 36 49 28 25 40 40 21 31 30 39 53 47 15 31 33 32 45 46 32 42 31 47 34 27 32 31 33 32 25 51 27 33 28 46 14 7 46 23 25 28 25 9 47 39 37 37 45 25 33 14 13 36 10 16 19 20 16 5 7 9 9 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_37780876_37781587
seq2: B6Ng01-210P22.b_48_760

seq1  GAATTCCAGGTATAAGTTTGTGTGCCCCTGGAGTCTTGAGGAATGTATAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGTATAAGTTTGTGTGCCCCTGGAGTCTTGAGGAATGTATAT  50

seq1  TAGTTCCTCTGACATGACAGGCTAGAGGAGACACACAGCCCAACTGCCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTCCTCTGACATGACAGGCTAGAGGAGACACACAGCCCAACTGCCAG  100

seq1  CTTCAAAAGGACAATCTTAGTAAGTGTCCAAGTGTCCCCCTATGCACCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAAAGGACAATCTTAGTAAGTGTCCAAGTGTCCCCCTATGCACCCT  150

seq1  GGCTTAGTTTTACTCTGCATTCTGGGTCTAGGAATTCATTATGATAAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTAGTTTTACTCTGCATTCTGGGTCTAGGAATTCATTATGATAAATT  200

seq1  ACATATACAAGGGACAGATTTACCGAGGAGATCACTCACTCCAGCAAGGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATATACAAGGGACAGATTTACCGAGGAGATCACTCACTCCAGCAAGGA  250

seq1  ATCCACACTTGAGCCATGAGCTGGGAATGTGTCTCTTGAGACGGTAGTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCACACTTGAGCCATGAGCTGGGAATGTGTCTCTTGAGACGGTAGTGT  300

seq1  GGAGAGCCAATAACAGCTCCACAGACAGATGCGCTGTGCTTAGCTGTTAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGCCAATAACAGCTCCACAGACAGATGCGCTGTGCTTAGCTGTTAG  350

seq1  GCATGCCATGCTAGCAGACTGTCAGGGCTTTGTCCCTAGGAAGCTACACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCCATGCTAGCAGACTGTCAGGGCTTTGTCCCTAGGAAGCTACACT  400

seq1  GCTTAATGTCATTTACATCTCCTCACATGCATGTAGTTAACCACTAGGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTAATGTCATTTACATCTCCTCACATGCATGTAGTTAACCACTAGGTT  450

seq1  AGTATCTGCCAGGCTGGGGAGGGTTGGGAGTGCCTCTGCATTCTATAGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATCTGCCAGGCTGGGGAGGGTTGGGAGTGCCTCTGCATTCTATAGAA  500

seq1  TTGTTCATTAATCTACAGAGTAAACCTTCCACCCCCACCCCCACCCCCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTCATTAATCTACAGAGTAAACCTTCCACCCCCACCCCCACCCCCAA  550

seq1  CTACAGCTTCAGAAAGAGCACTTGCAGCTTACACATCAGCTAGCAAAATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACAGCTTCAGAAAGAGCACTTGCAGCTTACACATCAGCTAGCAAAATG  600

seq1  ATCTCCTGTTTGTCCTGTAGCAAATAAACTACTTGCTGTGATGCTAAAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCCTGTTTGTCCTGTAGCAAATAAACTACTTGCTGTGATGCTAAAGG  650

seq1  TGCCGTTGGGAATCGAGAAGTTGAAGCATAGCTAGACACCACTGAATAG-  699
      |||||||||||||| |||||||||||||||||||||||||||||||||| 
seq2  TGCCGTTGGGAATCCAGAAGTTGAAGCATAGCTAGACACCACTGAATAGC  700

seq1  CCAAAACAGATGG  712
      |||||||||||||
seq2  CCAAAACAGATGG  713

seq1: chr16_37944877_37945666
seq2: B6Ng01-210P22.g_65_855 (reverse)

seq1  CCTTCTCCAACCTTCCAACCCTCC-AACCCTAGGTAGGAGAGCAAGAAGG  49
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  CCTTCTCCAACCTTCCAACCCTCCAAACCCTAGGTAGGAGAGCAAGAAGG  50

seq1  TTAGAGGGGAAAGAAGGTGTTGATCTTGTTAGACTGCTTCCTGTTGATTA  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAGGGGAAAGAAGGTGTTGATCTTGTTAGACTGCTTCCTGTTGATTA  100

seq1  AGGAAGTCCTTGGGGCAAGTGTGATCTTCATCACCAGGATACCTCCAACC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGTCCTTGGGGCAAGTGTGATCTTCATCACCAGGATACCTCCAACC  150

seq1  AGCAATCAGCTATAGCAGAAGAAGGAAGGGCAGCAGCATTTGTATACCCT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAATCAGCTATAGCAGAAGAAGGAAGGGCAGCAGCATTTGTATACCCT  200

seq1  CTGAAGCGTCCCCAGAATGCCAAATGTAAACTATTTTCAGCTGGCAAAAT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAGCGTCCCCAGAATGCCAAATGTAAACTATTTTCAGCTGGCAAAAT  250

seq1  AACATCCCTGCCCGAGCATGAGACAAATCATAGTCAGCTGCTGTGGACAG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATCCCTGCCCGAGCATGAGACAAATCATAGTCAGCTGCTGTGGACAG  300

seq1  TCTAAAGCAACCCCACACCTGGGATTAAAACAAAAACATAGTCCCTTAAC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAAGCAACCCCACACCTGGGATTAAAACAAAAACATAGTCCCTTAAC  350

seq1  ATTTCTGTGCTTTTAAAGGGACCAAAATTCTCATGACGCCAGGGAGTCTC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTGTGCTTTTAAAGGGACCAAAATTCTCATGACGCCAGGGAGTCTC  400

seq1  AATTTGGCACATACTGGGCACAGTTGGCAGTGACTGGCAGTTGTTGAAAC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTGGCACATACTGGGCACAGTTGGCAGTGACTGGCAGTTGTTGAAAC  450

seq1  TGTTAGGAGAGGGCCAGGCATGCTGCCAAACATCCTCTCTTCAAAAGATG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAGGAGAGGGCCAGGCATGCTGCCAAACATCCTCTCTTCAAAAGATG  500

seq1  GTCCAGACAACAAAGCATTATCAAGCCAAAAATAGGTCTTTGGTTTACCA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCAGACAACAAAGCATTATCAAGCCAAAAATAGGTCTTTGGTTTACCA  550

seq1  CTAAGATGGAGAAGACAATGTAAAAACACACGTCCTTCCAGACTACCATA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGATGGAGAAGACAATGTAAAAACACACGTCCTTCCAGACTACCATA  600

seq1  GTGTAGTTTGCTCTGTGACTCCTCACATTGCTCATTGCTAGAATACTCAG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTAGTTTGCTCTGTGACTCCTCACATTGCTCATTGCTAGAATACTCAG  650

seq1  TAGGAAAGTAGGGTGTGGCTAGAAAAAAAGAGAGAAAGACCCTTTCTGTT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGAAAGTAGGGTGTGGCTAGAAAAAAAGAGAGAAAGACCCTTTCTGTT  700

seq1  GGAATTCCAACAAAATTAGGATACGAATAGCCATGCCTTGTTTGCTTCGT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATTCCAACAAAATTAGGATACGAATAGCCATGCCTTGTTTGCTTCGT  750

seq1  AATTTAATATTCAGTCATCTGTCCAGACAGCACAAGAATTC  790
      |||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAATATTCAGTCATCTGTCCAGACAGCACAAGAATTC  791

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information