MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-216P06
Chromosome	16 (Build37)
Map Location	89,915,092 - 89,916,274
singlet/doublet	singlet
Overlap gene	Tiam1
Upstream gene	LOC100040191, AY026312, Krtap16-10, EG621595, LOC100040167, 1110032D16Rik, LOC100040201, Krtap6-1, LOC100040214, Krtap16-8, 1110025L11Rik, LOC100040249, LOC100040267, EG622794, LOC100040281, ENSMUSG00000044227, EG665661, LOC100040288, EG622935, EG622981, EG622998, EG623011, EG623026, LOC100040346, EG623049, LOC100040415, EG640636, LOC640652, LOC640654, LOC100040425, LOC100040374, LOC640656, LOC100040445, LOC100040456, Krtap21-1, Krtap6-2, 5430433J05Rik
Downstream gene	LOC100040496, LOC640694, LOC100040440, Sod1, Sfrs15, LOC545175, Hunk, 2610039C10Rik, Mrap, 4921511H13Rik, 4931408A02Rik, LOC665863
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	AY026312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	1110032D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC100040201 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins

name	Krtap6-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins

name	Krtap16-8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68484 MGI:1915734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110025L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins

name	LOC100040249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC100040267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG622794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	ENSMUSG00000044227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG665661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040288 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG622935 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG622981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG622998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG623011 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG623026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG623049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG640636 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC640652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC640654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040425 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC640656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Krtap21-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73716 MGI:1920966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap6-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16701 MGI:1330280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430433J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71363 MGI:1918613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tiam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21844 MGI:103306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 1 Protein pseudo : _no_value

name	LOC640694 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100040440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Sod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20655 MGI:98351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224432 MGI:2146350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545175 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 66 ESTs, 1 Protein

name	Hunk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26559 MGI:1347352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610039C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66578 MGI:1913828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77037 MGI:1924287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921511H13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207932 MGI:2146468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 101 ESTs, 4 Proteins

name	4931408A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70967 MGI:1918217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040191 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268138 GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cDNA sequence AY026312 transcript_id : XM_001474241.1

name	AY026312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801851 GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY026312 transcript_id : NM_133359.2

name	Krtap16-10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50080210 GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-10 transcript_id : NM_183296.1

name	EG621595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973040 GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG621595, transcript variant 3 transcript_id : XM_896462.1

name	1110032D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400724 GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : RIKEN cDNA 1110032D16 gene transcript_id : XM_897249.2

name	LOC100040201 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268140 GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins product : similar to glycine tyrosine-rich hair keratin protein transcript_id : XM_001474256.1

name	Krtap6-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374194 GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-1 transcript_id : NM_010672.3

name	LOC100040214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268142 GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins product : similar to keratin associated protein 6-1 transcript_id : XM_001474297.1

name	Krtap16-8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504469 GeneID:68484 MGI:1915734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-8 transcript_id : NM_130856.2

name	1110025L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268144 GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins product : RIKEN cDNA 1110025L11 gene transcript_id : XM_001474332.1

name	LOC100040249 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268146 GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474351.1

name	LOC100040267 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268148 GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MGC58416 protein transcript_id : XM_001474379.1

name	EG622794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268152 GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG622794 transcript_id : XM_897326.2

name	LOC100040281 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268154 GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474426.1

name	ENSMUSG00000044227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268150 GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, ENSMUSG00000044227 transcript_id : XM_001474147.1

name	EG665661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400725 GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG665661 transcript_id : XM_978513.1

name	LOC100040288 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268156 GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to MGC58416 protein transcript_id : XM_001474181.1

name	EG622935 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268158 GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG622935 transcript_id : XM_897414.2

name	EG622981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268160 GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG622981 transcript_id : XM_897445.2

name	EG622998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973291 GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG622998 transcript_id : XM_897455.1

name	EG623011 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973294 GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623011 transcript_id : XM_897466.1

name	EG623026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973298 GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623026 transcript_id : XM_897479.1

name	LOC100040346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268164 GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474233.1

name	EG623049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973304 GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623049 transcript_id : XM_897498.1

name	LOC100040415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268174 GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474343.1

name	EG640636 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268170 GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640636 transcript_id : XM_978919.2

name	LOC640652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268168 GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474284.1

name	LOC640654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268172 GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474324.1

name	LOC100040425 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268176 GeneID:100040425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474371.1

name	LOC100040374 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268166 GeneID:100040374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to MGC58416 protein transcript_id : XM_001474267.1

name	LOC640656 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268162 GeneID:640656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to keratin associated protein 6-2 transcript_id : XM_001474501.1

name	LOC100040445 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268179 GeneID:100040445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474391.1

name	LOC100040456 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268181 GeneID:100040456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to keratin associated protein 21-1 transcript_id : XM_001474418.1

name	Krtap21-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802943 GeneID:73716 MGI:1920966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 21-1 transcript_id : NM_028621.2

name	Krtap6-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195693 GeneID:16701 MGI:1330280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-2 transcript_id : NM_010673.2

name	5430433J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268183 GeneID:71363 MGI:1918613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 5430433J05 gene transcript_id : XM_001474473.1

name	Tiam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372435 GeneID:21844 MGI:103306
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell lymphoma invasion and metastasis 1 transcript_id : NM_009384.2

name	Sod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45597446 GeneID:20655 MGI:98351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : superoxide dismutase 1, soluble transcript_id : NM_011434.1

name	Sfrs15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150408 GeneID:224432 MGI:2146350
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 15 transcript_id : NM_178923.3

name	LOC545175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268190 GeneID:545175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 66 ESTs, 1 Protein product : similar to LOC635138 protein transcript_id : XM_001474656.1

name	Hunk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131024 GeneID:26559 MGI:1347352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hormonally upregulated Neu-associated kinase transcript_id : NM_015755.2

name	2610039C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909368 GeneID:66578 MGI:1913828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610039C10 gene transcript_id : NM_025642.1

name	Mrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376890 GeneID:77037 MGI:1924287
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanocortin 2 receptor accessory protein transcript_id : NM_029844.2

name	4921511H13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268185 GeneID:207932 MGI:2146468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 101 ESTs, 4 Proteins product : RIKEN cDNA 4921511H13 gene transcript_id : XM_489612.5

name	4931408A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625808 GeneID:70967 MGI:1918217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931408A02 gene transcript_id : NM_027627.1

name	LOC100040191 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268139 GeneID:100040191
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474291.1

name	AY026312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111168 GeneID:170939 MGI:2181750
definition	codon_start : 1 note : high-glycine/tyrosine protein type I E5 product : cDNA sequence AY026312 protein_id : NP_579937.1

name	Krtap16-10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080211 GeneID:71369 MGI:1918619
definition	codon_start : 1 product : keratin associated protein 16-10 protein_id : NP_899119.1

name	EG621595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973041 GeneID:621595 MGI:3644653
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_901555.1

name	1110032D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973182 GeneID:68740 MGI:1915990
definition	codon_start : 1 product : hypothetical protein LOC68740 protein_id : XP_902342.1

name	LOC100040201 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268141 GeneID:100040201
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474306.1

name	Krtap6-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754494 GeneID:16700 MGI:1330228
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.1 product : keratin associated protein 6-1 protein_id : NP_034802.1

name	LOC100040214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268143 GeneID:100040214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474347.1

name	Krtap16-8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536240 GeneID:68484 MGI:1915734
definition	codon_start : 1 product : keratin associated protein 16-8 protein_id : NP_570926.1

name	1110025L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268145 GeneID:68637 MGI:1915887
definition	codon_start : 1 product : RIKEN cDNA 1110025L11 protein_id : XP_001474382.1

name	LOC100040249 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268147 GeneID:100040249
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474401.1

name	LOC100040267 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268149 GeneID:100040267
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474429.1

name	EG622794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268153 GeneID:622794 MGI:3643237
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902419.2

name	LOC100040281 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268155 GeneID:100040281
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474476.1

name	ENSMUSG00000044227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268151 GeneID:640627 MGI:3642043
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474197.1

name	EG665661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400726 GeneID:665661 MGI:3649168
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983607.1

name	LOC100040288 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268157 GeneID:100040288
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474231.1

name	EG622935 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268159 GeneID:622935 MGI:3647747
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902507.2

name	EG622981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268161 GeneID:622981 MGI:3645349
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902538.2

name	EG622998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973292 GeneID:622998 MGI:3648365
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902548.1

name	EG623011 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973295 GeneID:623011 MGI:3643299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902559.1

name	EG623026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973299 GeneID:623026 MGI:3646232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902572.1

name	LOC100040346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268165 GeneID:100040346
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474283.1

name	EG623049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973305 GeneID:623049 MGI:3646961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902591.1

name	LOC100040415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268175 GeneID:100040415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474393.1

name	EG640636 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268171 GeneID:640636 MGI:3646423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984013.2

name	LOC640652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268169 GeneID:640652
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474334.1

name	LOC640654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268173 GeneID:640654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474374.1

name	LOC100040425 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268177 GeneID:100040425
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474421.1

name	LOC100040374 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268167 GeneID:100040374
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474317.1

name	LOC640656 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268163 GeneID:640656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474551.1

name	LOC100040445 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268180 GeneID:100040445
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474441.1

name	LOC100040456 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268182 GeneID:100040456
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474468.1

name	Krtap21-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229158 CCDS:CCDS28311.1 GeneID:73716 MGI:1920966
definition	codon_start : 1 exception : mismatches in translation product : keratin associated protein 21-1 protein_id : NP_082897.1

name	Krtap6-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195694 GeneID:16701 MGI:1330280
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.2; keratin-associated protein 6-2 product : keratin associated protein 6-2 protein_id : NP_034803.2

name	5430433J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268184 GeneID:71363 MGI:1918613
definition	codon_start : 1 product : hypothetical protein LOC71363 protein_id : XP_001474523.1

name	Tiam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678351 CCDS:CCDS28314.1 GeneID:21844 MGI:103306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046875 - ephrin receptor binding [Evidence IPI]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0048013 - ephrin receptor signaling pathway [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IMP]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation product : T-cell lymphoma invasion and metastasis 1 protein_id : NP_033410.1

name	Sod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597447 GeneID:20655 MGI:98351
definition	EC_number : 1.15.1.1 GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0004785 - copper, zinc superoxide dismutase activity [Evidence IDA] [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004784 - superoxide dismutase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence IDA]; GO:0019430 - removal of superoxide radicals [Evidence TAS]; GO:0006979 - response to oxidative stress [Evidence IDA]; GO:0006801 - superoxide metabolism [Evidence IEA]; GO:0042554 - superoxide release [Evidence IDA] codon_start : 1 note : Cu(2+)-Zn2+ superoxide dismutase product : superoxide dismutase 1, soluble protein_id : NP_035564.1

name	Sfrs15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150409 GeneID:224432 MGI:2146350
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : CTD-binding SR-like protein RA4 product : splicing factor, arginine/serine-rich 15 protein_id : NP_849254.2

name	LOC545175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268191 GeneID:545175
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_001474706.1

name	Hunk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657216 CCDS:CCDS28315.1 GeneID:26559 MGI:1347352
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA] codon_start : 1 product : hormonally upregulated Neu-associated kinase protein_id : NP_056570.1

name	2610039C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909369 CCDS:CCDS28316.1 GeneID:66578 MGI:1913828
definition	codon_start : 1 product : 2610039C10Rik protein protein_id : NP_079918.1

name	Mrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229245 CCDS:CCDS28317.1 GeneID:77037 MGI:1924287
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : fat cell-specific low molecular weight protein protein_id : NP_084120.1

name	4921511H13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268186 GeneID:207932 MGI:2146468
definition	codon_start : 1 product : hypothetical protein LOC207932 protein_id : XP_489612.5

name	4931408A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625809 CCDS:CCDS28319.1 GeneID:70967 MGI:1918217
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70967 protein_id : NP_081903.1

name	LOC640694 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640694
definition	number : 1 pseudo : _no_value

name	LOC640694 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640694
definition	number : 2 pseudo : _no_value

name	LOC665863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665863
definition	number : 1 pseudo : _no_value

name	LOC665863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665863
definition	number : 2 pseudo : _no_value

name	LOC100040167 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268137 GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_031579.1

name	LOC100040496 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268187 GeneID:100040496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 1 Protein product : similar to myosin regulatory light chain-like pseudo : _no_value transcript_id : XR_031827.1

name	LOC100040440 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268178 GeneID:100040440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_031873.1

clone name	MSMg01-190C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-530J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-364J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-216P06.b	B6Ng01-216P06.g
ACC	GA033503	GA033504
length	1,170	1,207
definition	B6Ng01-216P06.b	B6Ng01-216P06.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctttccccatgaggctccaaaaaaaaaaaaaattttttttttttg agacccacttgcctttgcctcctgagtgctggtaccagcacacctggttc agtctccatcttttagaagaagatccaagactggaatttatagactagga tgtatcataagatggatcaacataggtatattcaaagggcttgaagtccc gggtccctgtctggactcctagtacaaaacacacttccactcacagtcat tttcaaatataaggcatctttccaaatgacctcaatacttcacttgaaga tcacttcaggttgtttgctaactacacaattaagacttcaagttttagca gacgaagcacaatcatttcatgatttcaagaacaaacgaacaatttccgc tttaggagctctgaaactgaatgcatcttaatagcacaatggtatatttg gctttaattggcagatacttttctcccttcccagtgtggcatcaagcaat ggtgcatcttacaaacaatgaacggagtgcgtataaatagattttataat agttatatttggactggctaaaacctgtctaaaaactgtcaatgttttca gctcaagtagaattatccaggtaaaagctataccattccgtagagctcag ccaaggcttgctgagcagatgatgtatgcccgaggtgagggacgagacca ttttctcggggtgcccataacccggaaagaagggtgaccactaacttgcc cacaagcaatggctgcttgctctgtattagcgaatgagggaatagatcag ctctgcaagtcagctgttggacctggtctttaaagggaagcaacatctag cttaagaggatgagaagaaatggccagggatgggatctactgtaccaaag aggaagggaaaattaaataaataaaagatttctagaattaaaacatacta ctttgaacctgttatagtatcgaaaacaaaaactaaaaatgcttttttaa agagaaaaaatttgaaattatctcttctgtgatatcagttcatgcttcta taataaacacttattgctgataatctgtaacagtggaaatgttatccctc caaggtcctggaattctaagtctcaattcagaaagcggggcgaactggct tcaggtaagggctgcttctc	gaattctcctctgaggaaacagactgggaggaagaagcagcccattacca gccagctaattggtcaagaaaaaagccaaaagcggctggcgaaggccagt ttgctgattggcctcagggcagtcggcttcaaggtccgccctatgcggag tccccgccctgcgtagtgcgtcagcaatgcgcagagaggcagtgcgcaga gaggcagtgcgcagactcattcattcccagagaggaacaaaggaaaatac aacaggcatttccagtctttgaaggagccgagggtgggcgtgtccacgct ccggtagaatacttacaaattaaagaaattgccgagtcggtccgtaaata tggaaccaatgctaattttaccttggtgaagttagacaggctcgctggca tggcactaactcctgctgactggcaaacggttgtaaaagccgctctccct agtatgggcaaatacatggaatggagagcgctttggcacgaagctgcaca agcgcaggcccgagcaaacgcagctgctttgactccagagcagagagatt ggacttttgacttgttaacgggtcagggagcttattctgctgatcagaca aactaccattggggagcttatgcccagatttcttccacggctattagggc ctggaaagcgctctctcgagcaggtgaaaccactggtcagttaacaaaga taatccagggacctcaggaatccttctcagattttgtggccagaatgaca gagggcagcagagcgtatttttggagagtcagagcaagctgcgcctctaa tagaacagctaatctatgagcaagccacaaaggagtgccgagcggccata gccccaagaagaacaaaggcttacaagactggctcagggtctgtcagaga gcttgggggacctctcagcaatgcaaggtttagcggctgccatccttcaa tcccaaaccgcttccatgagcagaaatgatcaaaggacatgtttaactgc ggaaagcctggcatttagaaaagatggcagagctccagaataaacaggga ggactcctcactctttgctctaagtgtgcaggttatcatagagctgaaca gtgctcgctcgtggaggaattaaaaggcaaagtcctcccactgaaggtca aatcactgtatgtgcccaaaaactggactatctggcccctcgggtcctca gaggatc
quality values	Open. Hide. 58 38 21 26 58 58 58 58 58 58 58 58 38 21 58 58 54 62 54 52 62 62 41 12 62 62 62 62 62 62 62 62 56 56 56 46 37 43 62 62 62 62 62 62 62 62 62 62 62 44 62 50 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 59 59 62 49 56 62 59 59 39 62 56 45 62 56 50 59 59 62 62 49 56 56 59 59 62 62 62 59 62 62 62 54 59 62 59 59 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 56 59 56 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 56 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 54 46 59 62 62 62 62 62 62 62 62 62 62 62 59 59 56 46 62 59 59 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 56 62 59 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 54 62 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 52 58 58 54 58 58 58 58 54 54 30 58 58 58 54 58 58 58 58 58 58 58 58 58 52 54 58 54 58 54 54 54 52 58 58 54 46 54 54 34 58 58 58 52 52 42 58 54 54 58 58 49 49 49 53 58 58 58 58 51 51 43 58 58 45 42 47 52 58 58 49 37 58 58 58 54 53 50 53 49 58 58 51 54 58 58 53 39 35 58 50 58 50 58 58 54 51 33 49 58 51 46 46 58 49 46 47 50 58 41 41 39 39 50 50 39 34 53 51 37 32 49 39 58 33 41 43 31 51 37 37 58 39 54 51 47 50 41 35 53 29 53 52 50 53 42 42 31 49 49 36 53 39 58 50 51 37 50 39 51 37 44 19 53 39 30 53 34 52 41 31 53 45 45 53 35 17 54 54 38 54 52 54 32 53 41 23 46 42 50 23 31 33 33 41 40 37 28 51 54 54 35 35 32 39 35 54 54 51 37 52 31 54 40 31 34 21 53 42 49 41 32 54 42 54 46 32 44 33 33 54 45 34 52 33 19 35 25 27 34 34 32 32 40 42 53 30 52 47 31 32 25 33 26 28 17 27 33 53 52 31 32 32 31 32 32 52 32 32 42 37 45 28 23 32 32 31 21 31 21 43 30 30 31 6 10 30 24 27 31 31 34 32 31 31 33 31 28 31 34 33 31 31 21 18 30 15 21 31 35 30 43 31 31 22 30 31 33 31 9 41 29 20 31 12 31 32 48 31 30 40 18 26 46 33 33 30 16 20 12 21 29 16 31 32 29 32 25 29 28 8 14 25 12 30 25 20 32 25 34 43 23 33 27 16 43 48 24 31 38 35 20 37 16 27 36 32 23 31 32 44 25 10 24 30 31 46 11 27 36 11 8 25 31 22 22 31 18 36 17 14 18 20 27 44 24 12 41 44 44 10 16 28 44 20 26 22 41 16 25 19 36 48 22 10 20 25 48 34 31 19 30 11 28 26 13 14 28 31 39 9 9 8 20 24 31 32 26 17 7 30 20 32 14 19 9 21 17 14 9 33 10 20 23 32 32 30 22 32 14 30 48 39 19 21 10 48 48 48 27 21 9 16 22 39 31 24 4 16 10 22 47 34 38 47 23 18 28 8 17 28 7 13 34 34 34 16 3 5 27 10 11 12 29 24 11 30 15 17 13 6 21 15 16 18 11 27 11 13 20 5 3 4 20 6 3 3 6 10 11 12 27 21 24 10 20 7 4 5 11 9 7 20 27 12 9 6 12 6 13 4 7 12 8 17 11 27 9 13 10 22 7 9 6 11 7 24 4 16 5 20 10 16 12 5 15 7 15 23 6 6 4 4 4 11 5 22 6 6 6 5 8 4 1 3 4 5 12 11 8 8 6 7 5 7 15 9 4 4 12 10 5 18 10 5 5 3 7 4 11 16 6 2 3 3 6 18 8 7 4 11 9 5 7 3 5 4 3 7 8 6 8 3 1 2 4 2 14 5 3 7 12 4 2 4 6 8 7	Open. Hide. 62 47 43 47 62 62 62 62 62 62 56 51 56 21 18 30 18 30 30 50 44 62 54 54 62 54 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 54 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 58 58 54 58 45 58 54 58 54 58 58 52 58 58 58 54 42 58 48 54 54 54 52 54 54 34 54 50 41 41 52 44 40 54 54 58 54 54 54 58 52 53 58 54 51 53 58 58 58 49 51 47 58 51 58 50 47 45 30 54 58 46 58 26 58 52 39 29 58 58 49 58 39 58 58 58 58 58 51 37 58 51 58 40 41 50 51 51 51 54 58 52 53 47 16 49 43 46 32 51 58 53 50 53 54 53 53 41 39 51 54 41 39 52 45 40 53 37 34 38 48 50 46 41 47 43 50 49 51 54 32 41 50 54 19 50 58 52 39 42 51 53 58 43 50 53 52 39 58 52 50 42 42 39 53 32 50 49 58 40 49 42 52 33 50 41 54 54 35 54 49 54 50 50 54 41 32 37 46 51 54 53 54 46 37 52 32 49 32 41 37 10 49 27 49 40 54 45 39 51 41 54 37 54 51 35 42 37 40 39 42 33 33 28 21 54 52 40 40 31 37 34 40 42 33 37 32 54 49 19 13 39 30 39 28 13 49 33 27 37 37 53 36 41 41 42 42 42 28 35 24 52 49 36 35 31 33 35 15 52 31 28 33 33 36 53 32 33 26 31 29 6 49 31 25 35 32 39 34 30 53 13 52 36 31 31 34 53 53 53 46 47 32 45 20 42 33 26 27 23 26 46 17 31 31 29 31 31 31 31 31 26 29 29 38 34 42 33 25 34 31 22 37 33 31 28 21 31 25 15 27 28 43 30 26 31 26 38 13 34 29 29 29 22 27 23 31 15 40 8 9 31 33 18 28 26 31 32 17 29 19 32 24 19 7 20 20 36 28 21 31 36 40 27 13 37 25 46 18 18 31 26 18 12 19 18 12 22 23 43 35 29 20 7 31 21 26 9 26 31 39 27 42 31 26 27 47 27 33 32 31 31 21 17 5 5 14 12 16 16 29 23 21 26 41 44 44 31 19 16 22 10 13 31 28 21 21 26 11 20 21 31 11 8 11 19 25 33 48 24 34 28 29 24 23 21 24 26 14 27 17 32 21 21 22 17 18 33 11 25 17 48 24 33 48 23 4 5 10 18 17 21 33 25 17 31 9 9 9 15 14 12 33 48 17 10 10 23 32 17 14 31 19 24 18 26 21 22 20 23 17 47 33 8 7 34 24 24 21 22 31 26 27 24 18 8 16 15 13 7 12 20 29 47 19 4 3 11 40 25 8 7 21 25 9 10 8 8 9 30 8 17 13 9 33 13 13 12 28 6 6 40 9 10 5 9 40 21 8 7 21 11 13 11 9 9 13 15 11 13 19 12 7 29 18 11 18 16 5 3 3 15 4 4 8 7 11 3 5 5 6 13 7 7 8 4 3 7 6 5 11 5 9 19 7 10 16 7 5 2 3 3 2 2 4 5 10 10 5 3 5 7 5 8 11 17 6 5 4 4 5 30 16 9 7 13 3 3 3 5 3 2 5 6 15 15 17 8 5 5 1 2 2 1 3 6 6 6 6 16 5 9 8 5 5 10 16 9 21 10 10 10 7 9 12 7 15 28 28 6 11 4 6 24 6 1 3 5 4 4 13 4 3 5 3 3 9 4 5 4 6 7 5 5 11 18 5 25 5 2 3 19 11 4 4 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_89915092_89916274
seq2: B6Ng01-216P06.b_46_1215

seq1  GAATTCTTTCCCCATGAGGCTCCAAAAAAAAAAAAAATTTTTTTTTTTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCCCCATGAGGCTCCAAAAAAAAAAAAAATTTTTTTTTTTTG  50

seq1  AGACCCACTTGCCTTTGCCTCCTGAGTGCTGGTACCAGCACACCTGGTTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCACTTGCCTTTGCCTCCTGAGTGCTGGTACCAGCACACCTGGTTC  100

seq1  AGTCTCCATCTTTTAGAAGAAGATCCAAGACTGGAATTTATAGACTAGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTCCATCTTTTAGAAGAAGATCCAAGACTGGAATTTATAGACTAGGA  150

seq1  TGTATCATAAGATGGATCAACATAGGTATATTCAAAGGGCTTGAAGTCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATCATAAGATGGATCAACATAGGTATATTCAAAGGGCTTGAAGTCCC  200

seq1  GGGTCCCTGTCTGGACTCCTAGTACAAAACACACTTCCACTCACAGTCAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCCCTGTCTGGACTCCTAGTACAAAACACACTTCCACTCACAGTCAT  250

seq1  TTTCAAATATAAGGCATCTTTCCAAATGACCTCAATACTTCACTTGAAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAAATATAAGGCATCTTTCCAAATGACCTCAATACTTCACTTGAAGA  300

seq1  TCACTTCAGGTTGTTTGCTAACTACACAATTAAGACTTCAAGTTTTAGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTCAGGTTGTTTGCTAACTACACAATTAAGACTTCAAGTTTTAGCA  350

seq1  GACGAAGCACAATCATTTCATGATTTCAAGAACAAACGAACAATTTCCGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGAAGCACAATCATTTCATGATTTCAAGAACAAACGAACAATTTCCGC  400

seq1  TTTAGGAGCTCTGAAACTGAATGCATCTTAATAGCACAATGGTATATTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGGAGCTCTGAAACTGAATGCATCTTAATAGCACAATGGTATATTTG  450

seq1  GCTTTAATTGGCAGATACTTTTCTCCCTTCCCAGTGTGGCATCAAGCAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTAATTGGCAGATACTTTTCTCCCTTCCCAGTGTGGCATCAAGCAAT  500

seq1  GGTGCATCTTACAAACAATGAACGGAGTGCGTATAAATAGATTTTATAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCATCTTACAAACAATGAACGGAGTGCGTATAAATAGATTTTATAAT  550

seq1  AGTTATATTTGGACTGGCTAAAACCTGTCTAAAAACTGTCAATGTTTTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTATATTTGGACTGGCTAAAACCTGTCTAAAAACTGTCAATGTTTTCA  600

seq1  GCTCAAGTAGAATTATCCAGGTAAAAGCTATACCATTCCGTAGAGCTCAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAAGTAGAATTATCCAGGTAAAAGCTATACCATTCCGTAGAGCTCAG  650

seq1  CCAAGGCTTGCTGAGCAGATGATGTATGCCCGAGGTGAGGGACGAGACCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGGCTTGCTGAGCAGATGATGTATGCCCGAGGTGAGGGACGAGACCA  700

seq1  TTTTCTCGGGGTGCCCATAACCCGGAAAGAAGGGTGACCACTAACTTGCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTCGGGGTGCCCATAACCCGGAAAGAAGGGTGACCACTAACTTGCC  750

seq1  CACAAGCAATGGCTGCTTGCTCTGTATTAGCGAATGAGGGGAATAGATCA  800
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CACAAGCAATGGCTGCTTGCTCTGTATTAGCGAATGA-GGGAATAGATCA  799

seq1  GCTCTGCAAGTCAGCTGTTGGACCTGGTCTTTAAAGGGAAGCAACATCTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGCAAGTCAGCTGTTGGACCTGGTCTTTAAAGGGAAGCAACATCTA  849

seq1  GCTTAAGAGGATGAGAAGAAATGGCCAGGGATGGGATCTAACTGTACCAA  900
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GCTTAAGAGGATGAGAAGAAATGGCCAGGGATGGGATCT-ACTGTACCAA  898

seq1  AGAGGAAGGGAAAAATAAATAAATAAAAGATTTCTAAGAATTAAAACATA  950
      |||||||||||||| |||||||||||||||||||| ||||||||||||||
seq2  AGAGGAAGGGAAAATTAAATAAATAAAAGATTTCT-AGAATTAAAACATA  947

seq1  CTAC-TTGAACCTGTTATAGTATCGAAAACAAAAACTAAAAAATGCTTTT  999
      |||| |||||||||||||||||||||||||||||||| ||||||||||||
seq2  CTACTTTGAACCTGTTATAGTATCGAAAACAAAAACT-AAAAATGCTTTT  996

seq1  TTAAAGAGAAAAAAATTGAAATTATCTCCTTCTGTGAATTAATCAGTTCA  1049
      |||||||||||||| |||||||||||| |||||||||    |||||||||
seq2  TTAAAGAGAAAAAATTTGAAATTATCT-CTTCTGTGA---TATCAGTTCA  1042

seq1  TGCTTCTATAATAAAACACCTTATGCTGGATAATCTGTAAACAGTGGAAA  1099
      |||||||||||| |||||| |  |||| |||||||||| |||||||||||
seq2  TGCTTCTATAAT-AAACACTTATTGCT-GATAATCTGT-AACAGTGGAAA  1089

seq1  TG-TATCCCT-CACAGTCCTGG-ATTCTAAAAAGTCTCAAATCAAGAGAG  1146
      || ||||||| ||  ||||||| |||||   ||||||||| || ||| ||
seq2  TGTTATCCCTCCAAGGTCCTGGAATTCT---AAGTCTCAATTC-AGAAAG  1135

seq1  CCGGCAGATCTGGCTTCCAGGGAAAGGGCTGCTTCTC  1183
      | ||  || ||||||||   || ||||||||||||||
seq2  CGGGGCGAACTGGCTTC--AGGTAAGGGCTGCTTCTC  1170

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information