MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233F16
Chromosome	16 (Build37)
Map Location	13,938,216 - 14,114,995
singlet/doublet	doublet
Overlap gene	Mpv17l, Ifitm7, 2900011O08Rik, 4921513D23Rik
Upstream gene	LOC622553, Ercc4, Gt4-1, Mkl2, Parn, LOC100043196, 3110001I22Rik, Pla2g10, A930007A09Rik, LOC622757, Rrn3, Ntan1, Pdxdc1
Downstream gene	Nde1, Myh11, 0610037P05Rik, Abcc1, Gm1758, Snai2, Efcab1, LOC100042737
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC622553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ercc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50505 MGI:1354163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gt4-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107459 MGI:107691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mkl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239719 MGI:3050795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74108 MGI:1921358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043196 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs

name	3110001I22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66598 MGI:1913848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26565 MGI:1347522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930007A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432999 MGI:3045309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs

name	LOC622757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins

name	Rrn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106298 MGI:1925255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18203 MGI:108471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94184 MGI:1920909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mpv17l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93734 MGI:2135951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifitm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74482 MGI:1921732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900011O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67254 MGI:1914504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921513D23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223989 MGI:2444505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nde1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67203 MGI:1914453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17880 MGI:102643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610037P05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66086 MGI:1913336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17250 MGI:102676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385737 MGI:2686604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Snai2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20583 MGI:1096393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66793 MGI:1914043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Ercc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657063 GeneID:50505 MGI:1354163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency, complementation group 4 transcript_id : NM_015769.1

name	Gt4-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469512 GeneID:107459 MGI:107691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene trap insertion site 4-1 transcript_id : NM_181860.1

name	Mkl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956387 GeneID:239719 MGI:3050795
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MKL/myocardin-like 2 transcript_id : NM_153588.1

name	Parn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803094 GeneID:74108 MGI:1921358
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A)-specific ribonuclease (deadenylation nuclease) transcript_id : NM_028761.2

name	LOC100043196 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267367 GeneID:100043196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs product : hypothetical protein LOC100043196 transcript_id : XM_001480276.1

name	3110001I22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358124 GeneID:66598 MGI:1913848
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110001I22 gene transcript_id : NM_025653.2

name	Pla2g10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129973 GeneID:26565 MGI:1347522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group X transcript_id : NM_011987.2

name	A930007A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400071 GeneID:432999 MGI:3045309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs product : RIKEN cDNA A930007A09 gene transcript_id : XM_484524.3

name	Rrn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299629 GeneID:106298 MGI:1925255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RRN3 RNA polymerase I transcription factor homolog (yeast) transcript_id : NM_001039521.1

name	Ntan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299633 GeneID:18203 MGI:108471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-terminal Asn amidase transcript_id : NM_010946.3

name	Pdxdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88758583 GeneID:94184 MGI:1920909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyridoxal-dependent decarboxylase domain containing 1 transcript_id : NM_001039533.1

name	Pdxdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88758581 GeneID:94184 MGI:1920909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyridoxal-dependent decarboxylase domain containing 1 transcript_id : NM_053181.2

name	Mpv17l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802470 GeneID:93734 MGI:2135951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mpv17 transgene, kidney disease mutant-like transcript_id : NM_033564.2

name	Ifitm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539642 GeneID:74482 MGI:1921732
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon induced transmembrane protein 7 transcript_id : NM_028968.1

name	2900011O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625872 GeneID:67254 MGI:1914504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900011O08 gene transcript_id : NM_144518.3

name	4921513D23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487212 GeneID:223989 MGI:2444505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921513D23 gene transcript_id : NM_001081154.1

name	Nde1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963634 GeneID:67203 MGI:1914453
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear distribution gene E homolog 1 (A nidulans) transcript_id : NM_023317.1

name	Myh11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305294 GeneID:17880 MGI:102643
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 11, smooth muscle transcript_id : NM_013607.1

name	0610037P05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560259 GeneID:66086 MGI:1913336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610037P05 gene transcript_id : NM_025345.2

name	Abcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60218873 GeneID:17250 MGI:102676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 1 transcript_id : NM_008576.2

name	Gm1758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400074 GeneID:385737 MGI:2686604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : gene model 1758, (NCBI) transcript_id : XM_358926.5

name	Snai2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476308 GeneID:20583 MGI:1096393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : snail homolog 2 (Drosophila) transcript_id : NM_011415.2

name	Efcab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382593 GeneID:66793 MGI:1914043
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF hand calcium binding domain 1 transcript_id : NM_025769.2

name	Ercc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657064 GeneID:50505 MGI:1354163
definition	GO_component : GO:0000109 - nucleotide-excision repair complex [Evidence ISS] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation function : remove DNA damage in nucleotide excision repair pathway product : excision repair cross-complementing rodent repair deficiency, complementation group 4 protein_id : NP_056584.1

name	Gt4-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469513 GeneID:107459 MGI:107691
definition	codon_start : 1 product : gene trap insertion site 4-1 protein_id : NP_862908.1

name	Mkl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956388 GeneID:239719 MGI:3050795
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA] GO_process : GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0045844 - positive regulation of striated muscle development [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0051145 - smooth muscle cell differentiation [Evidence IMP]; GO:0007519 - striated muscle development [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myocardin-related transcription factor B product : MKL/myocardin-like 2 protein_id : NP_705816.1

name	Parn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311877 GeneID:74108 MGI:1921358
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004535 - poly(A)-specific ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence IEA] codon_start : 1 product : poly(A)-specific ribonuclease (deadenylation nuclease) protein_id : NP_083037.1

name	LOC100043196 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267368 GeneID:100043196
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480326.1

name	3110001I22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313406 GeneID:66598 MGI:1913848
definition	codon_start : 1 product : hypothetical protein LOC66598 protein_id : NP_079929.1

name	Pla2g10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21356649 CCDS:CCDS27967.1 GeneID:26565 MGI:1347522
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006644 - phospholipid metabolism [Evidence IEA] codon_start : 1 product : phospholipase A2, group X protein_id : NP_036117.1

name	A930007A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769343 GeneID:432999 MGI:3045309
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484524.1

name	Rrn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299630 CCDS:CCDS27968.1 GeneID:106298 MGI:1925255
definition	codon_start : 1 note : transcription initiation factor TIF-IA product : RRN3 RNA polymerase I transcription factor homolog protein_id : NP_001034610.1

name	Ntan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754902 CCDS:CCDS27969.1 GeneID:18203 MGI:108471
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008418 - protein N-terminal asparagine amidohydrolase activity [Evidence IDA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007613 - memory [Evidence IMP] codon_start : 1 note : N-terminal asparagine amidohydrolase; asparagine-specific N-terminal amidase product : N-terminal Asn amidase protein_id : NP_035076.1

name	Pdxdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88758584 GeneID:94184 MGI:1920909
definition	GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0019752 - carboxylic acid metabolism [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : pyridoxal-dependent decarboxylase domain containing 1 isoform 3 protein_id : NP_001034622.1

name	Pdxdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88758582 GeneID:94184 MGI:1920909
definition	GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0019752 - carboxylic acid metabolism [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : pyridoxal-dependent decarboxylase domain containing 1 isoform 1 protein_id : NP_444411.2

name	Mpv17l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024193 CCDS:CCDS27970.1 GeneID:93734 MGI:2135951
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Mpv17-like product : Mpv17 transgene, kidney disease mutant-like protein_id : NP_291042.2

name	Ifitm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539643 GeneID:74482 MGI:1921732
definition	codon_start : 1 note : interferon induced transmembrane protein 4 like; interferon induced transmembrane protein like 4 product : interferon induced transmembrane protein 7 protein_id : NP_083244.1

name	2900011O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362305 CCDS:CCDS27971.1 GeneID:67254 MGI:1914504
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC67254 protein_id : NP_653101.1

name	4921513D23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487213 GeneID:223989 MGI:2444505
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : limkain b1 product : hypothetical protein LOC223989 protein_id : NP_001074623.1

name	Nde1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963635 GeneID:67203 MGI:1914453
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005819 - spindle [Evidence IDA]; GO:0031616 - spindle pole centrosome [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0008017 - microtubule binding [Evidence IMP] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0051298 - centrosome duplication [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007020 - microtubule nucleation [Evidence IDA]; GO:0007067 - mitosis [Evidence IEA]; GO:0051227 - mitotic spindle assembly [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0007405 - neuroblast proliferation [Evidence IMP]; GO:0047496 - vesicle transport along microtubule [Evidence IGI] codon_start : 1 product : nuclear distribution gene E homolog 1 protein_id : NP_075806.1

name	Myh11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305295 CCDS:CCDS27972.1 GeneID:17880 MGI:102643
definition	GO_component : GO:0005859 - muscle myosin [Evidence IDA]; GO:0016459 - myosin [Evidence IEA]; GO:0005863 - striated muscle thick filament [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006939 - smooth muscle contraction [Evidence IMP]; GO:0006941 - striated muscle contraction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myosin heavy chain 11, smooth muscle product : myosin, heavy polypeptide 11, smooth muscle protein_id : NP_038635.1

name	0610037P05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313614 CCDS:CCDS27973.1 GeneID:66086 MGI:1913336
definition	codon_start : 1 product : hypothetical protein LOC66086 protein_id : NP_079621.1

name	Abcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678848 GeneID:17250 MGI:102676
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 note : multiple drug resistance-associated protein; ATP-binding cassette, sub-family C (CFTR/MRP), member 1b; ATP-binding cassette, sub-family C (CFTR/MRP), member 1a product : ATP-binding cassette, sub-family C, member 1 protein_id : NP_032602.1

name	Gm1758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400075 GeneID:385737 MGI:2686604
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358926.5

name	Snai2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755576 CCDS:CCDS27974.1 GeneID:20583 MGI:1096393
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045884 - regulation of survival gene product activity [Evidence IC]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009314 - response to radiation [Evidence IDA] [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : slug, chicken homolog product : snail homolog 2 protein_id : NP_035545.1

name	Efcab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313314 CCDS:CCDS27975.1 GeneID:66793 MGI:1914043
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : EF hand calcium binding domain 1 protein_id : NP_080045.1

name	LOC622553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622553
definition	number : 1 pseudo : _no_value

name	LOC622757 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267374 GeneID:622757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : LOC622757 gene transcript_id : XR_034626.1

name	LOC100042737 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267282 GeneID:100042737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) pseudo : _no_value transcript_id : XR_033852.1

clone name	MSMg01-323J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141O15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-401P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120D20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233F16.b	B6Ng01-233F16.g
ACC	GA045438	GA045439
length	1,088	1,000
definition	B6Ng01-233F16.b	B6Ng01-233F16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(13,938,216 - 13,939,291)	(14,114,000 - 14,114,995)
sequence	gaattccagggactggagaggaaggatctattagtatgtgtacactgtga taataagattgcagaccaggagcagtagaaaaacatttttcaaacaactt tttttaacagttcaggaagaaaaaaaaaaagtctgggcagtggtggcgca cgcctttaatcccaccagcacttgggaggcagaggcaggcagatttctgc attggagtctagcctgctttacagagtgagttccaggacagccagggcta cacagagaaaccctgtctcgaaaaaccaaaacccaaaacaaaacagttca ggaaggtcggatgggttttattctgactcctctttctttggtctacagat tgccaccttcttctcccttacctttcagtttccttctccttgactgcctt cttcctttttttttactccctgcctctctgtgtttgtgtctttctttctg tgtgcatatttatatataagtgcacatggcatttgggaaggtcatagaac actttgtagcagtctgccacatgggttctggagattgaagtcatgagcat ttaccccagagctgtccttgctgcccctcattttggtttataaaatcaga gtctatagagtccaagcttgtctcagactcactgtatagttggaaataat cttgaacccttgactgttatgcctccactcccacttagaaatacaagcaa ggacaccacaaatagaccaaatagccagttatcatcttatgtttttcttc tatatgaattcaccatgggtgtctcttgctgcatccgtatcctctcatga aggcaccgtacagactgtattgcctagctcagaacctcactttaactgga tcacttctttaaggtctccaaatatagtcacattctggaagagctaaaag taggggcctcaatgtataaaatatgataggaggaccaattcagcttataa aaaatggacttataattagtgacaatcccttgagaagaatgggtctatgg gtcaaggttgaggacctaaaggaaacactattagcagtccagctttgggt tgttggaatgaaagaaagtgacttcccacatcagctta	gaattctgtagacttggatttcaccgtgtgtatgaagatcccattaagag ggatgctcttataacatcacaagtagctagaaggattactgttcctgctc taagagaaaagttaatgtttccagcatctgacattgctgaggcttcttac cctagctgcctccttccactgtccccaaccttctgtaattttgtgtctcc tccaatggcccttttcctttttgggcctcttcagagtccactgttctaaa gaacaaaaatcttcagcagactgttggctttggtttattgtttgccatga gtcttctttctgatagtggcgtacgtgtttggttgtttttgtttatgtat atatattaatatgatatatgatatacatacacacacatatatatatatat gaatgaatgaatgaatgaatgaatgactatgggagagaaagagcatgcgc tgcttgattacttgatgctgacttcggaggctgaggaaagcctcaggcag acctctgtgcctgtctgactatagctgtctgtctcctccctctctgcagg acccagccagatggagcaggagcttctgcacctggccagcagctcccccg ttgacctgctctgtgctcctgttccttcatgcctgccatcccctcagcta agaccagatcctgtcatcctgaagcccgctgatctcattcagtttgagga acaccctcaagagcctttgggtaggttgcagcctatatggtggacacttg tctgtgggtctaacagatgactcacgatgccagtgtaggaggtgcctgat gaacacaggaaaaagcaatactgttttcaggtgtaaagtacctgtgccga ctattcagcctctgcccgcccttgttggagtgttctgctaataggattta caaacctggtatatcttacccgccgttcttgcgaccggccaggaagaacg caacaaaccgggaatcttcttgcggcaaactttatttgcttacatcttca
quality values	Open. Hide. 58 31 17 29 58 58 32 16 62 49 47 20 31 62 54 62 41 47 47 54 62 49 56 62 62 21 31 62 62 62 62 32 24 15 21 22 26 28 39 43 43 49 62 46 46 62 59 59 59 59 62 62 62 62 62 62 62 59 54 62 62 62 62 62 59 62 59 59 62 62 59 59 62 62 62 59 59 43 46 32 32 34 32 34 46 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 56 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 47 58 58 58 58 54 58 52 58 58 52 52 58 58 58 58 54 46 58 54 58 58 52 58 58 58 58 54 58 52 58 52 58 58 58 58 58 52 58 58 58 58 45 35 54 43 58 58 58 58 52 54 54 42 54 58 58 52 58 54 54 58 54 52 58 58 58 58 42 52 58 42 58 58 58 52 54 58 54 54 54 58 54 52 54 58 58 58 49 53 52 52 58 58 58 58 41 39 58 58 53 53 50 58 47 37 47 53 52 46 58 46 50 49 53 49 41 47 40 50 50 52 54 40 34 51 53 58 58 39 51 50 53 53 46 51 16 58 27 50 46 37 41 37 51 53 39 50 53 49 42 58 58 48 28 38 58 36 37 46 52 54 50 58 54 50 40 34 38 58 50 50 51 41 50 50 58 35 41 46 40 17 25 53 42 39 53 31 33 21 19 58 53 39 39 53 53 40 34 58 58 26 32 29 51 26 33 31 47 32 40 58 58 40 47 22 49 51 24 49 37 50 34 50 37 52 42 40 25 18 53 45 42 53 32 54 53 29 52 41 40 38 53 53 35 37 45 39 32 25 29 35 30 54 54 54 32 39 39 45 52 31 42 42 34 40 33 35 26 24 48 35 26 52 41 37 25 30 54 26 27 39 20 41 42 45 37 46 30 24 33 39 39 30 39 34 34 37 33 32 34 20 53 38 37 40 40 32 40 40 28 33 16 47 20 16 30 34 32 32 32 33 24 28 32 34 31 52 16 18 52 19 34 13 25 16 39 23 31 32 35 29 10 46 43 34 35 30 37 9 31 42 46 31 32 26 30 30 44 31 25 31 25 28 33 18 51 28 33 33 31 31 15 12 38 22 25 28 29 32 33 41 27 30 12 12 30 28 20 16 13 25 24 26 41 31 28 17 6 9 26 9 40 18 17 21 9 48 46 32 21 23 16 15 31 31 29 26 42 29 27 22 12 12 16 29 11 11 27 46 46 11 9 11 25 31 31 15 21 28 7 25 6 7 29 10 16 21 29 19 37 22 14 21 37 37 26 14 14 19 44 41 41 46 31 24 20 9 11 31 20 30 20 18 22 38 18 31 21 31 22 32 21 21 24 35 32 19 48 19 34 32 34 25 14 23 31 13 16 12 14 6 29 31 10 8 14 23 15 10 43 10 11 4 4 6 16 23 10 25 19 22 5 10 11 8 8 11 8 25 19 18 12 33 39 15 29 11 21 27 17 9 7 17 15 24 25 27 13 16 14 6 6 18 14 48 26 6 33 10 27 11 19 5 20 9 21 9 16 20 6 6 5 7 16 11 47 28 13 5 7 17 24 21 15 13 28 12 7 20 7 19 14 23 12 16 13 9 34	Open. Hide. 62 38 40 44 62 62 49 49 62 62 62 43 41 28 28 28 25 20 44 45 62 46 43 62 62 62 59 59 59 62 59 62 59 62 62 62 62 59 59 62 62 59 49 62 59 62 62 62 62 62 62 62 59 49 62 62 59 62 54 35 48 59 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 47 47 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 62 62 42 62 56 62 62 62 47 62 46 62 62 62 62 62 62 62 56 62 62 43 62 43 47 42 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 35 62 62 62 54 52 62 62 62 54 62 62 62 62 58 52 58 58 54 52 47 54 58 52 58 54 54 58 53 50 30 58 34 26 58 58 52 54 58 58 52 54 54 46 58 58 54 52 52 52 37 58 54 50 58 58 54 58 52 58 52 52 42 54 52 54 47 43 48 47 44 52 52 30 54 54 53 58 54 54 48 45 54 54 41 32 35 58 54 58 51 51 46 51 58 41 58 50 51 49 58 46 58 40 35 58 58 47 37 50 52 50 58 40 50 48 58 33 58 39 52 46 58 58 58 51 46 30 47 58 39 41 58 32 51 35 46 36 46 52 52 50 40 50 51 39 52 35 53 39 49 50 53 37 51 32 53 58 50 47 50 40 46 52 46 41 50 39 29 52 52 38 32 29 41 52 50 35 50 32 52 40 40 32 32 50 51 49 52 47 28 35 25 51 24 50 50 32 53 50 51 58 51 29 41 23 39 29 39 33 32 42 29 49 54 35 40 45 30 42 39 51 18 13 21 35 32 34 35 35 41 41 29 41 26 51 32 52 54 35 32 30 29 30 29 37 33 39 34 24 31 42 25 37 31 34 33 29 51 29 32 22 35 8 14 23 47 34 42 40 30 26 22 30 25 41 29 30 26 28 21 23 37 32 28 27 28 35 21 32 35 34 52 51 52 36 21 32 23 29 35 31 40 35 40 27 47 46 18 28 9 22 30 21 36 19 46 46 41 23 39 25 13 17 31 33 12 18 33 34 20 33 23 12 14 23 31 43 28 20 31 40 25 14 14 31 17 40 32 19 33 48 46 31 13 21 31 18 31 13 32 15 26 31 7 7 16 31 34 31 31 33 21 31 32 26 17 24 27 42 33 22 21 18 33 24 33 16 32 27 33 13 23 31 18 10 21 23 42 27 26 39 28 16 13 10 13 26 18 31 24 33 17 24 31 34 26 12 12 17 7 28 14 21 13 26 17 6 17 24 20 28 22 29 6 24 9 38 24 11 21 11 44 12 44 31 31 23 11 33 7 7 7 8 17 8 29 12 28 33 23 4 12 43 30 17 21 34 11 28 23 18 25 31 10 6 13 7 14 30 10 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_13938216_13939291
seq2: B6Ng01-233F16.b_49_1136

seq1  GAATTCCAGGGACTGGAGAGGAAGGATCTATTAGTATGTGTACACTGTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGGACTGGAGAGGAAGGATCTATTAGTATGTGTACACTGTGA  50

seq1  TAATAAGATTGCAGACCAGGAGCAGTAGAAAAACATTTTTCAAACAACTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAAGATTGCAGACCAGGAGCAGTAGAAAAACATTTTTCAAACAACTT  100

seq1  TTTTTAACAGTTCAGGAAGAAAAAAAAAAAGTCTGGGCAGTGGTGGCGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAACAGTTCAGGAAGAAAAAAAAAAAGTCTGGGCAGTGGTGGCGCA  150

seq1  CGCCTTTAATCCCACCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCTTTAATCCCACCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCTGC  200

seq1  ATTGGAGTCTAGCCTGCTTTACAGAGTGAGTTCCAGGACAGCCAGGGCTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGAGTCTAGCCTGCTTTACAGAGTGAGTTCCAGGACAGCCAGGGCTA  250

seq1  CACAGAGAAACCCTGTCTCGAAAAACCAAAACCCAAAACAAAACAGTTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGAGAAACCCTGTCTCGAAAAACCAAAACCCAAAACAAAACAGTTCA  300

seq1  GGAAGGTCGGATGGGTTTTATTCTGACTCCTCTTTCTTTGGTCTACAGAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGTCGGATGGGTTTTATTCTGACTCCTCTTTCTTTGGTCTACAGAT  350

seq1  TGCCACCTTCTTCTCCCTTACCTTTCAGTTTCCTTCTCCTTGACTGCCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCACCTTCTTCTCCCTTACCTTTCAGTTTCCTTCTCCTTGACTGCCTT  400

seq1  CTTCCTTTTTTTTTACTCCCTGCCTCTCTGTGTTTGTGTCTTTCTTTCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTTTTTTTTTACTCCCTGCCTCTCTGTGTTTGTGTCTTTCTTTCTG  450

seq1  TGTGCATATTTATATATAAGTGCACATGGCATTTGGGAAGGTCATAGAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCATATTTATATATAAGTGCACATGGCATTTGGGAAGGTCATAGAAC  500

seq1  ACTTTGTAGCAGTCTGCCACATGGGTTCTGGAGATTGAAGTCATGAGCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTGTAGCAGTCTGCCACATGGGTTCTGGAGATTGAAGTCATGAGCAT  550

seq1  TTACCCCAGAGCTGTCCTTGCTGCCCCTCATTTTGGTTTATAAAATCAGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCCAGAGCTGTCCTTGCTGCCCCTCATTTTGGTTTATAAAATCAGA  600

seq1  GTCTATAGAGTCCAAGCTTGTCTCAGACTCACTGTATAGTTGGAAATAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTATAGAGTCCAAGCTTGTCTCAGACTCACTGTATAGTTGGAAATAAT  650

seq1  CTTGAACCCTTGACTGTTATGCCTCCACTCCCACTTAGAAATACAAGCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAACCCTTGACTGTTATGCCTCCACTCCCACTTAGAAATACAAGCAA  700

seq1  GGACACCACAAATAGACCAAATAGCCAGTTATCATCTTATGTTTTTCTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACACCACAAATAGACCAAATAGCCAGTTATCATCTTATGTTTTTCTTC  750

seq1  TATATGAATTCACCAT-GGTGTCTCTTGCTGCATCCGTATCCTCTCATGA  799
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TATATGAATTCACCATGGGTGTCTCTTGCTGCATCCGTATCCTCTCATGA  800

seq1  AGGCACCGTACAGACTGTATTGCCTAGCTCAGAACCTCACTTTAACTGGA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCACCGTACAGACTGTATTGCCTAGCTCAGAACCTCACTTTAACTGGA  850

seq1  TCACTTCTTTAAGGTCTCCAAATATAGTCACATTCT-GAAGAGCTAAAAG  898
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TCACTTCTTTAAGGTCTCCAAATATAGTCACATTCTGGAAGAGCTAAAAG  900

seq1  TTAGGGCCTCAATGTATAAAATATGATAGGAG--ACAATTCAGCTTATAA  946
      |  |||||||||||||||||||||||||||||   |||||||||||||||
seq2  TAGGGGCCTCAATGTATAAAATATGATAGGAGGACCAATTCAGCTTATAA  950

seq1  AAAAT-GACTTATAATTAGTGACAAT-CCTTGAG-AGAATTGGTCTATGG  993
      ||||| |||||||||||||||||||| ||||||| ||||| |||||||||
seq2  AAAATGGACTTATAATTAGTGACAATCCCTTGAGAAGAATGGGTCTATGG  1000

seq1  TTC-AGGTTGAAGACCT-AAGGAAACACTA-TAGCAGTCCAGCTTT-GGT  1039
       || ||||||| ||||| |||||||||||| ||||||||||||||| |||
seq2  GTCAAGGTTGAGGACCTAAAGGAAACACTATTAGCAGTCCAGCTTTGGGT  1050

seq1  TGTTGG-ATGAGAGAAAGTGACTTCCCACATCAGCTTA  1076
      |||||| |||| ||||||||||||||||||||||||||
seq2  TGTTGGAATGAAAGAAAGTGACTTCCCACATCAGCTTA  1088

seq1: chr16_14114000_14114995
seq2: B6Ng01-233F16.g_68_1067 (reverse)

seq1  TGAAGATGTAAGC-AATAAAGTTTTGCCGC-AGAAGATT-CCGGTTTGTT  47
      ||||||||||||| ||||||| |||||||| |||||||| ||||||||||
seq2  TGAAGATGTAAGCAAATAAAG-TTTGCCGCAAGAAGATTCCCGGTTTGTT  49

seq1  GCGTTCTTCCTGGCCGGTCGCAAGAAC-GCGGGTAAGATATACCAGGTTT  96
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  GCGTTCTTCCTGGCCGGTCGCAAGAACGGCGGGTAAGATATACCAGGTTT  99

seq1  GTAAATCCTATTAGCAG-ACACTCCAACAAGGGCGGGCAGAGGCTGAATA  145
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  GTAAATCCTATTAGCAGAACACTCCAACAAGGGCGGGCAGAGGCTGAATA  149

seq1  GTCGGCACAGGTACTTTTACACCTG-AAACAGTATTGCTTTTTCCTGTGT  194
      |||||||||||||| |||||||||| ||||||||||||||||||||||||
seq2  GTCGGCACAGGTAC-TTTACACCTGAAAACAGTATTGCTTTTTCCTGTGT  198

seq1  TCATCAGGCACCTCCTACACTGGCATCGTGAGTCATCTGTTAGACCCACA  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCAGGCACCTCCTACACTGGCATCGTGAGTCATCTGTTAGACCCACA  248

seq1  GACAAGTGTCCACCATATAGGCTGCAACCTACCCAAAGGCTCTTGAGGGT  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAGTGTCCACCATATAGGCTGCAACCTACCCAAAGGCTCTTGAGGGT  298

seq1  GTTCCTCAAACTGAATGAGATCAGCGGGCTTCAGGATGACAGGATCTGGT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCTCAAACTGAATGAGATCAGCGGGCTTCAGGATGACAGGATCTGGT  348

seq1  CTTAGCTGAGGGGATGGCAGGCATGAAGGAACAGGAGCACAGAGCAGGTC  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGCTGAGGGGATGGCAGGCATGAAGGAACAGGAGCACAGAGCAGGTC  398

seq1  AACGGGGGAGCTGCTGGCCAGGTGCAGAAGCTCCTGCTCCATCTGGCTGG  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGGGGGAGCTGCTGGCCAGGTGCAGAAGCTCCTGCTCCATCTGGCTGG  448

seq1  GTCCTGCAGAGAGGGAGGAGACAGACAGCTATAGTCAGACAGGCACAGAG  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTGCAGAGAGGGAGGAGACAGACAGCTATAGTCAGACAGGCACAGAG  498

seq1  GTCTGCCTGAGGCTTTCCTCAGCCTCCGAAGTCAGCATCAAGTAATCAAG  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGCCTGAGGCTTTCCTCAGCCTCCGAAGTCAGCATCAAGTAATCAAG  548

seq1  CAGCGCATGCTCTTTCTCTCCCATAGTCATTCATTCATTCATTCATTCAT  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCGCATGCTCTTTCTCTCCCATAGTCATTCATTCATTCATTCATTCAT  598

seq1  TCATATATATATATATGTGTGTGTATGTATATCATATATCATATTAATAT  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATATATATATATATGTGTGTGTATGTATATCATATATCATATTAATAT  648

seq1  ATATACATAAACAAAAACAACCAAACACGTACGCCACTATCAGAAAGAAG  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATACATAAACAAAAACAACCAAACACGTACGCCACTATCAGAAAGAAG  698

seq1  ACTCATGGCAAACAATAAACCAAAGCCAACAGTCTGCTGAAGATTTTTGT  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATGGCAAACAATAAACCAAAGCCAACAGTCTGCTGAAGATTTTTGT  748

seq1  TCTTTAGAACAGTGGACTCTGAAGAGGCCCAAAAAGGAAAAGGGCCATTG  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTAGAACAGTGGACTCTGAAGAGGCCCAAAAAGGAAAAGGGCCATTG  798

seq1  GAGGAGACACAAAATTACAGAAGGTTGGGGACAGTGGAAGGAGGCAGCTA  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAGACACAAAATTACAGAAGGTTGGGGACAGTGGAAGGAGGCAGCTA  848

seq1  GGGTAAGAAGCCTCAGCAATGTCAGATGCTGGAAACATTAACTTTTCTCT  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTAAGAAGCCTCAGCAATGTCAGATGCTGGAAACATTAACTTTTCTCT  898

seq1  TAGAGCAGGAACAGTAATCCTTCTAGCTACTTGTGATGTTATAAGAGCAT  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGCAGGAACAGTAATCCTTCTAGCTACTTGTGATGTTATAAGAGCAT  948

seq1  CCCTCTTAATGGGATCTTCATACACACGGTGAAATCCAAGTCTACAGAAT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTTAATGGGATCTTCATACACACGGTGAAATCCAAGTCTACAGAAT  998

seq1  TC  996
      ||
seq2  TC  1000

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information