MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-306L19
Chromosome	16 (Build37)
Map Location	10,435,030 - 10,592,627
singlet/doublet	doublet
Overlap gene	BC068110, Ciita, LOC669998, Dexi, 4932416N17Rik
Upstream gene	Grin2a, LOC665291, LOC100042534, 4930517K11Rik, Atf7ip2, Emp2, Tekt5, Nubp1
Downstream gene	Socs1, Tnp2, Prm3, Prm2, Prm1, A630055G03Rik, Litaf, LOC100043147, LOC100042597, Snn, Txndc11, Zc3h7a, LOC665450, LOC622271, Rsl1d1, Gspt1, Tnfrsf17, 4933437K13Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Grin2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14811 MGI:95820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	LOC100042534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	4930517K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68172 MGI:1915422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf7ip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75329 MGI:1922579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein

name	Emp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13731 MGI:1098726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70426 MGI:1917676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 7 Proteins

name	Nubp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26425 MGI:1347073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC068110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383103 MGI:3665441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciita (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12265 MGI:108445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Dexi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58239 MGI:1926236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932416N17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74374 MGI:1921624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Socs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12703 MGI:1354910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21959 MGI:98785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19120 MGI:106601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19119 MGI:97766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19118 MGI:97765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630055G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223970 MGI:2685383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Litaf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56722 MGI:1929512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Snn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20621 MGI:1276549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106200 MGI:1923620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zc3h7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106205 MGI:2445044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 8 Proteins pseudo : _no_value

name	LOC622271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 120 ESTs, 8 Proteins pseudo : _no_value

name	Rsl1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66409 MGI:1913659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gspt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14852 MGI:1316728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21935 MGI:1343050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933437K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74478 MGI:1921728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41680704 GeneID:14811 MGI:95820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA2A (epsilon 1) transcript_id : NM_008170.2

name	4930517K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803088 GeneID:68172 MGI:1915422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930517K11 gene transcript_id : NM_026594.2

name	Atf7ip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400043 GeneID:75329 MGI:1922579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein product : activating transcription factor 7 interacting protein 2, transcript variant 1 transcript_id : XM_148109.5

name	Emp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154058 GeneID:13731 MGI:1098726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epithelial membrane protein 2 transcript_id : NM_007929.2

name	Tekt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400059 GeneID:70426 MGI:1917676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 7 Proteins product : tektin 5 transcript_id : XM_358761.3

name	Nubp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754905 GeneID:26425 MGI:1347073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleotide binding protein 1 transcript_id : NM_011955.1

name	BC068110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701471 GeneID:383103 MGI:3665441
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC068110 transcript_id : NM_001013778.1

name	Ciita (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131183 GeneID:12265 MGI:108445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : class II transactivator transcript_id : NM_007575.2

name	LOC669998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267318 GeneID:669998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC669998 transcript_id : XM_001480173.1

name	Dexi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109809749 GeneID:58239 MGI:1926236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dexamethasone-induced transcript transcript_id : NM_021428.4

name	4932416N17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130442 GeneID:74374 MGI:1921624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932416N17 gene transcript_id : NM_177562.4

name	Socs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044896 GeneID:12703 MGI:1354910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of cytokine signaling 1 transcript_id : NM_009896.2

name	Tnp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62461573 GeneID:21959 MGI:98785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transition protein 2 transcript_id : NM_013694.4

name	Prm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326494 GeneID:19120 MGI:106601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protamine 3 transcript_id : NM_013638.2

name	Prm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679474 GeneID:19119 MGI:97766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protamine 2 transcript_id : NM_008933.1

name	Prm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50657349 GeneID:19118 MGI:97765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protamine 1 transcript_id : NM_013637.4

name	A630055G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701779 GeneID:223970 MGI:2685383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630055G03 gene transcript_id : NM_001033278.1

name	Litaf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910577 GeneID:56722 MGI:1929512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LPS-induced TN factor transcript_id : NM_019980.1

name	LOC100043147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267322 GeneID:100043147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043147 transcript_id : XM_001480214.1

name	Snn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233915 GeneID:20621 MGI:1276549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stannin transcript_id : NM_009223.2

name	Txndc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130624 GeneID:106200 MGI:1923620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 11 transcript_id : NM_029582.2

name	Txndc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383937 GeneID:106200 MGI:1923620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 11 transcript_id : NM_134105.2

name	Zc3h7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122350 GeneID:106205 MGI:2445044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 7 A transcript_id : NM_145931.1

name	Rsl1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385918 GeneID:66409 MGI:1913659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal L1 domain containing 1 transcript_id : NM_025546.2

name	Gspt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203748 GeneID:14852 MGI:1316728
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G1 to S phase transition 1 transcript_id : NM_146066.1

name	Tnfrsf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755822 GeneID:21935 MGI:1343050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 17 transcript_id : NM_011608.1

name	4933437K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385413 GeneID:74478 MGI:1921728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933437K13 gene transcript_id : NM_028964.2

name	Grin2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41680705 CCDS:CCDS27943.1 GeneID:14811 MGI:95820
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA]; GO:0042734 - presynaptic membrane [Evidence IEP]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence TAS]; GO:0048167 - regulation of synaptic plasticity [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GluRepsilon1 product : glutamate receptor, ionotropic, NMDA2A (epsilon 1) protein_id : NP_032196.2

name	4930517K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386082 GeneID:68172 MGI:1915422
definition	codon_start : 1 product : ribosomal protein L39-like protein protein_id : NP_080870.1

name	Atf7ip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38079693 GeneID:75329 MGI:1922579
definition	codon_start : 1 product : activating transcription factor 7 interacting protein 2 isoform 1 protein_id : XP_148109.3

name	Emp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154059 GeneID:13731 MGI:1098726
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : epithelial membrane protein 2 protein_id : NP_031955.2

name	Tekt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38080173 GeneID:70426 MGI:1917676
definition	codon_start : 1 product : tektin 5 protein_id : XP_358761.1

name	Nubp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754906 CCDS:CCDS27948.1 GeneID:26425 MGI:1347073
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : nucleotide binding protein 1 protein_id : NP_036085.1

name	BC068110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701472 CCDS:CCDS27949.1 GeneID:383103 MGI:3665441
definition	codon_start : 1 product : hypothetical protein LOC383103 protein_id : NP_001013800.1

name	Ciita (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671654 CCDS:CCDS27950.1 GeneID:12265 MGI:108445
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : class II transactivator protein_id : NP_031601.1

name	LOC669998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267319 GeneID:669998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480223.1

name	Dexi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19920321 GeneID:58239 MGI:1926236
definition	codon_start : 1 product : dexamethasone-induced protein protein_id : NP_067403.2

name	4932416N17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656175 GeneID:74374 MGI:1921624
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74374 protein_id : NP_808230.2

name	Socs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753424 CCDS:CCDS27952.1 GeneID:12703 MGI:1354910
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0019210 - kinase inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA] [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence IDA]; GO:0046426 - negative regulation of JAK-STAT cascade [Evidence IMP]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0042518 - negative regulation of tyrosine phosphorylation of Stat3 protein [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : cytokine inducible SH2-containing protein 7; cytokine inducible SH2-containing protein 1; JAK-binding protein; JAK2-binding protein; STAT-induced STAT inhibitor 1 product : suppressor of cytokine signaling 1 protein_id : NP_034026.1

name	Tnp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981239 CCDS:CCDS27953.1 GeneID:21959 MGI:98785
definition	GO_component : GO:0001673 - male germ cell nucleus [Evidence TAS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007341 - penetration of zona pellucida [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : transition protein 2 (alt.) product : transition protein 2 protein_id : NP_038722.3

name	Prm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326495 CCDS:CCDS27954.1 GeneID:19120 MGI:106601
definition	codon_start : 1 product : protamine 3 protein_id : NP_038666.2

name	Prm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679475 CCDS:CCDS27955.1 GeneID:19119 MGI:97766
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0030261 - chromosome condensation [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0006997 - nuclear organization and biogenesis [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : protamine 2 protein_id : NP_032959.1

name	Prm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305409 CCDS:CCDS27956.1 GeneID:19118 MGI:97765
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0030261 - chromosome condensation [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0006997 - nuclear organization and biogenesis [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : protamine 1 protein_id : NP_038665.1

name	A630055G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701780 GeneID:223970 MGI:2685383
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223970 protein_id : NP_001028450.1

name	Litaf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910578 CCDS:CCDS27958.1 GeneID:56722 MGI:1929512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LPS-induced TNF-alpha factor; Nedd4 WW domain-binding protein 3 product : LPS-induced TN factor protein_id : NP_064364.1

name	LOC100043147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267323 GeneID:100043147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480264.1

name	Snn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678051 GeneID:20621 MGI:1276549
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : stannin protein_id : NP_033249.1

name	Txndc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077061 CCDS:CCDS27960.1 GeneID:106200 MGI:1923620
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; EF-hand binding protein 1 product : thioredoxin domain containing 11 isoform 1 protein_id : NP_083858.1

name	Txndc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527336 GeneID:106200 MGI:1923620
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; EF-hand binding protein 1 product : thioredoxin domain containing 11 isoform 2 protein_id : NP_598866.1

name	Zc3h7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122351 GeneID:106205 MGI:2445044
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger CCCH type domain containing 7 product : zinc finger CCCH type containing 7 protein_id : NP_666043.1

name	Rsl1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794470 GeneID:66409 MGI:1913659
definition	codon_start : 1 product : ribosomal L1 domain containing 1 protein_id : NP_079822.1

name	Gspt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203749 CCDS:CCDS27961.1 GeneID:14852 MGI:1316728
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003747 - translation release factor activity [Evidence ISS] GO_process : GO:0000082 - G1/S transition of mitotic cell cycle [Evidence ISS]; GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence ISS] codon_start : 1 note : eukaryotic polypeptide chain release factor 3; guanine nucleotide regulatory protein; G1-to-S transition GTP binding protein; G1 to phase transition 1 product : G1 to S phase transition 1 protein_id : NP_666178.1

name	Tnfrsf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755823 CCDS:CCDS27962.1 GeneID:21935 MGI:1343050
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : tumor necrosis factor receptor superfamily, member 17 protein_id : NP_035738.1

name	4933437K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312778 CCDS:CCDS27963.1 GeneID:74478 MGI:1921728
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74478 protein_id : NP_083240.1

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 1 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 2 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 3 pseudo : _no_value

name	LOC665291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665291
definition	number : 4 pseudo : _no_value

name	LOC100042534 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042534
definition	number : 1 pseudo : _no_value

name	LOC100042597 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042597
definition	number : 2 pseudo : _no_value

name	LOC100042597 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042597
definition	number : 1 pseudo : _no_value

name	LOC665450 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267276 GeneID:665450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 8 Proteins product : similar to MGC27348 protein pseudo : _no_value transcript_id : XR_033740.1

name	LOC622271 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267277 GeneID:622271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 120 ESTs, 8 Proteins product : similar to Wdr45 like pseudo : _no_value transcript_id : XR_033745.1

clone name	MSMg01-058D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-413B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090G06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-306L19.b	B6Ng01-306L19.g
ACC	GA099690	GA099691
length	1,092	1,137
definition	B6Ng01-306L19.b	B6Ng01-306L19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(10,435,030 - 10,436,136)	(10,591,496 - 10,592,627)
sequence	gaattccctgttcttaacctacaggaaagaactttggaatgatcgagcat ggtaagatgtctgttagcatttgtgcggttcttttgttgatgtatggact gatccagttactttgaaatacggtctcgtgtagtccagaccaaccttgaa ctccctatataggtgaggatgaccttgaccttgacttctgatcctcttgc ctctattccaacgtgcagggatcacaggagtatacctttatgcctgccct catagtgctattcttaaagcacactttcaaaatcctttcatggggctaga gagatggctcatctgcaagagcactggctgctctccaggggtcctgggtt cacttcccagcacacaccaggcagctcacgacagtctgcaactccaggcc cagggaatcccatcccctttctgacctccattagcactaggtgcgcacgt ggtgcacatatgtgtacattcaaagtgttttacaagtaatttttttaatt tctaaaagaaaatcttttaaaaagatattttaaatccttttatgcatatt aatctaaagatttatttctcaagttaacatatccagtggccataatttac agttcttttgtttgaagtttcactgaacattaaaatgttccaccatcctg aaatagtacattttgtatgcagtgtttaggtgtatttttgtttgcagctt agtttggcattcaaagtaaccagcaatgagcagtaatagtgcgttcagat aagcctgatggcctcaggtcagcccctgccacctacatgatggaaggaga gactcctataagttgtcctcaaacctccaaaaatctccaagacacatgac acccacctcaacacacacacacacacacacacacacacacacacacacac acacacacacactttttaaaaatgctcaaggacacagaaattaattttat ataaattccaattttattacttatacttcaaacacactaatgattgagct taaacataccattgattgggccgcccacttgttgctgggcttagctaggc cagagttgcacaaccaggcccatgctggtccttcccactgtg	gaattcagatgggtgtaatgctgcacacctttaatcccagcactcagaag gtagaggcagagagatctctattagttcaaggctacccctgactacatag tgagttccaagccagccagaactatatgatcagaccctgtctctacaaag aaaaaaagaaagaaaaaagaatttaagaactttccaaggaaatttacttt tctgtctagccaggtactgggtggaggtaaggtacagagaatgggaattt atgtctctaagactataatcatttagcactagctggaaacatgtagagaa ggcccatgggtgaggaagggttatgaaactctggtcagccatggctgcag tgggagtccacatagatgacaaagactgaagtccagacttgtgacatggc tcaacgggtaatacacttactgagctactaactgacctgcaaaacacccc cacttcaggccaggatagacaggacctagaactcaaagccagtagggaac cacatgttcaggtccacctccctggcaagtgccaagccatggctactgct gaccactatcccccttgtaggcttcaacttccccatcatcccaagggcat cctatcagcttctccctgagggctgctgagaagtacagagacagccacct ctgtcggtctttcctgggagtccttttcccctgatactagtgagcacttg agagcctcacactgctaggaggatcttgcacatttgtgcaggagcttgcc tctagccccctcacactgtaacggggagctagaatggaatccagtgtcca gcagaccactgctcctttccatagcacttgctgtgctacccaacaggccc ggcctctagaagcactgaggggaaaactgagccataatctgtgtgtggtg gtgcatacttataatcccagcacatgggaggctgaagtaggaggactagt ttcaaggccggtgtaggctacttggagaagaccttgtcttacaagccatt aaatagtgtaagtcagtatacatctgaccacagggaaaagcagtactatg tagaccaaaagcttatggctttattttggttttttaggtctttagtacag ctgcaattgaattagggctctcattacaccaccacac
quality values	Open. Hide. 58 36 15 23 58 58 46 43 58 58 46 62 62 62 54 50 62 62 62 62 62 47 47 62 62 47 62 62 62 62 56 26 32 26 21 21 19 22 21 20 27 35 29 32 34 59 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 51 56 32 33 48 56 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 59 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 52 58 52 58 58 58 54 54 46 58 58 58 58 58 54 52 58 58 58 58 58 58 48 58 58 58 54 58 58 58 54 54 58 54 58 58 58 52 58 58 58 58 52 54 39 54 54 58 58 58 58 58 58 58 58 58 58 58 58 47 52 46 58 51 52 53 52 58 49 50 58 58 58 54 51 58 58 51 54 37 58 54 52 58 58 58 58 58 45 40 58 53 58 54 52 58 50 51 58 52 53 58 51 46 58 46 58 51 49 53 40 51 46 52 51 58 51 40 52 47 51 49 54 53 53 58 58 58 53 40 58 58 49 58 58 42 53 58 53 52 53 39 58 49 58 49 53 40 54 58 50 58 58 40 41 51 41 40 50 52 42 51 51 50 52 50 58 50 58 58 41 39 39 50 28 52 39 42 42 47 54 54 41 50 41 40 41 49 52 32 40 37 54 14 49 44 37 31 51 42 52 52 38 41 54 54 54 49 53 34 54 54 47 39 30 35 37 33 46 53 14 54 54 36 28 40 35 37 53 46 35 32 54 54 52 40 40 40 31 53 40 35 41 34 53 40 40 35 23 53 37 31 33 33 28 47 32 31 39 45 34 39 30 52 41 30 29 53 32 32 53 26 42 41 34 52 53 33 35 51 31 33 28 31 26 21 28 16 31 31 22 30 51 51 51 33 51 29 32 26 31 37 32 31 31 22 39 42 45 23 26 46 32 45 12 40 25 16 46 21 21 23 43 38 37 36 36 37 29 32 30 33 37 41 33 34 31 30 31 31 46 35 25 34 43 30 32 13 46 46 46 26 26 31 36 25 31 19 27 30 41 16 18 30 13 31 38 33 19 29 18 31 12 31 15 16 38 31 17 22 27 23 23 15 15 18 13 18 14 9 11 9 21 27 31 21 10 11 15 19 20 19 11 11 32 32 31 31 32 29 17 17 21 33 38 22 34 21 44 30 44 9 29 7 36 17 38 13 11 13 11 28 47 48 44 24 13 33 39 39 19 30 32 16 21 18 13 22 25 13 13 12 12 11 6 23 22 48 14 32 24 27 28 27 48 48 33 20 7 9 7 30 39 25 8 14 30 20 17 12 19 39 39 21 11 10 20 11 9 25 10 5 3 10 16 19 27 7 15 40 27 7 5 5 3 14 24 24 27 9 16 20 14 8 20 19 26 28 29 27 13 34 11 12 22 5 13 13 21 11 21 11 11 24 14 10 19 30 19 7 6 6 11 28 15 8 15 13 7 7 14 24 17 18 6 6 19 11 2 6 17 7 6 5 18 12 9 8 13 8 12 7 20 5 4 4 5 5 4 3 3 3 3 3 5 4 6 17 28 9 3 1 3 10 5 5 5 5 5 11 5 5 21 15 4 6 9 4 7 8 3	Open. Hide. 62 47 35 38 62 47 41 56 54 47 62 22 16 13 20 18 10 20 18 22 26 27 32 24 42 56 51 62 62 62 62 49 62 62 62 62 62 59 59 62 59 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 51 45 39 23 33 19 35 46 46 46 62 43 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 58 58 54 54 58 49 52 58 58 58 54 58 54 58 42 42 58 58 58 54 58 58 54 58 58 50 58 58 58 58 58 54 58 54 58 40 58 58 58 54 48 58 52 58 54 58 58 58 58 58 54 44 49 58 58 54 50 54 58 58 58 58 58 54 58 58 52 58 54 54 54 58 58 54 49 58 58 58 51 52 52 58 58 58 58 53 58 58 58 54 58 58 41 35 48 41 58 53 53 54 54 58 58 58 58 58 58 58 41 50 35 58 49 58 58 50 46 51 51 53 53 54 58 58 52 52 51 51 46 58 51 58 49 46 48 50 58 54 50 52 52 53 58 49 52 50 41 40 52 52 58 53 52 53 53 58 58 48 48 41 16 58 50 40 51 51 53 52 53 53 28 58 58 37 50 43 50 49 35 58 31 37 50 30 50 51 58 42 58 58 44 49 50 51 41 53 50 54 37 53 34 58 43 36 51 40 49 54 54 46 40 45 52 49 40 54 54 44 27 54 54 54 42 51 35 29 40 45 42 39 39 52 50 49 32 40 42 38 38 50 29 38 32 53 26 38 47 53 40 39 35 52 51 37 47 31 42 37 13 45 39 13 44 28 24 45 44 34 37 31 37 40 26 39 54 19 33 40 33 31 34 30 42 53 24 35 33 33 52 23 38 21 32 43 40 29 32 53 40 46 45 52 36 35 32 29 35 32 53 21 42 32 32 24 53 53 32 28 19 40 40 35 32 28 29 32 32 31 29 32 31 25 34 27 29 36 51 31 35 36 35 35 36 31 9 42 22 37 32 31 31 39 33 42 28 38 34 51 43 33 28 21 32 36 32 33 24 23 26 12 30 30 30 35 26 39 35 36 32 31 46 31 30 29 30 27 25 42 11 46 13 28 27 24 32 43 38 34 32 14 24 16 19 27 11 21 33 38 22 14 46 46 22 29 46 46 29 31 32 32 31 23 37 37 33 36 26 19 24 32 32 31 13 31 29 32 17 23 48 14 29 31 10 30 30 30 22 24 35 26 33 19 26 21 34 27 34 48 35 15 19 31 23 33 12 18 32 44 30 13 10 17 27 32 20 20 9 26 17 26 22 16 31 25 25 22 20 28 25 11 11 42 21 16 22 10 28 10 25 14 25 14 8 18 31 21 17 16 17 33 21 29 27 28 10 19 8 6 19 12 7 18 18 24 9 11 28 12 7 6 19 20 33 15 16 11 25 8 27 9 8 16 11 12 10 24 21 7 32 9 12 22 32 34 31 27 12 13 13 10 18 32 8 10 10 7 11 28 8 12 4 10 15 13 30 8 28 28 30 21 12 15 28 9 27 20 27 27 24 13 28 16 16 7 8 6 21 9 28 38 26 20 27 28 24 20 5 3 3 3 3 18 6 9 7 31 21 8 16 5 16 40 18 40 15 4 6 8 11 11 10 7 10 5 2 1 10 5 2 2 4 10 4 1 1 1 4 17 5 4 7 17 3 8 5 11 24 25 5 10 6 5 4 7 4 4 5 11 8 18 6 3 14 18 4 5 8 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_10435030_10436136
seq2: B6Ng01-306L19.b_50_1141

seq1  GAATTCCCTGTTCTTAACCTACAGGAAAGAACTTTGGAATGATCGAGCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTGTTCTTAACCTACAGGAAAGAACTTTGGAATGATCGAGCAT  50

seq1  GGTAAGATGTCTGTTAGCATTTGTGCGGTTCTTTTGTTGATGTATGGACT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAAGATGTCTGTTAGCATTTGTGCGGTTCTTTTGTTGATGTATGGACT  100

seq1  GATCCAGTTACTTTGAAATACGGTCTCGTGTAGTCCAGACCAACCTTGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCAGTTACTTTGAAATACGGTCTCGTGTAGTCCAGACCAACCTTGAA  150

seq1  CTCCCTATATAGGTGAGGATGACCTTGACCTTGACTTCTGATCCTCTTGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCTATATAGGTGAGGATGACCTTGACCTTGACTTCTGATCCTCTTGC  200

seq1  CTCTATTCCAACGTGCAGGGATCACAGGAGTATACCTTTATGCCTGCCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATTCCAACGTGCAGGGATCACAGGAGTATACCTTTATGCCTGCCCT  250

seq1  CATAGTGCTATTCTTAAAGCACACTTTCAAAATCCTTTCATGGGGCTAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGTGCTATTCTTAAAGCACACTTTCAAAATCCTTTCATGGGGCTAGA  300

seq1  GAGATGGCTCATCTGCAAGAGCACTGGCTGCTCTCCAGGGGTCCTGGGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATGGCTCATCTGCAAGAGCACTGGCTGCTCTCCAGGGGTCCTGGGTT  350

seq1  CACTTCCCAGCACACACCAGGCAGCTCACGACAGTCTGCAACTCCAGGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTCCCAGCACACACCAGGCAGCTCACGACAGTCTGCAACTCCAGGCC  400

seq1  CAGGGAATCCCATCCCCTTTCTGACCTCCATTAGCACTAGGTGCGCACGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGAATCCCATCCCCTTTCTGACCTCCATTAGCACTAGGTGCGCACGT  450

seq1  GGTGCACATATGTGTACATTCAAAGTGTTTTACAAGTAATTTTTTTAATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCACATATGTGTACATTCAAAGTGTTTTACAAGTAATTTTTTTAATT  500

seq1  TCTAAAAGAAAATCTTTTAAAAAGATATTTTAAATCCTTTTATGCATATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAAAGAAAATCTTTTAAAAAGATATTTTAAATCCTTTTATGCATATT  550

seq1  AATCTAAAGATTTATTTCTCAAGTTAACATATCCAGTGGCCATAATTTAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTAAAGATTTATTTCTCAAGTTAACATATCCAGTGGCCATAATTTAC  600

seq1  AGTTCTTTTGTTTGAAGTTTCACTGAACATTAAAATGTTCCACCATCCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCTTTTGTTTGAAGTTTCACTGAACATTAAAATGTTCCACCATCCTG  650

seq1  AAATAGTACATTTTGTATGCAGTGTTTAGGTGTATTTTTGTTTGCAGCTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGTACATTTTGTATGCAGTGTTTAGGTGTATTTTTGTTTGCAGCTT  700

seq1  AGTTTGGCATTCAAAGTAACCAGCAATGAGCAGTAATAGTGCGTTCAGAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGGCATTCAAAGTAACCAGCAATGAGCAGTAATAGTGCGTTCAGAT  750

seq1  AAGCCTGATGGCCTCAGGTCAGCCCCTGCCACCTACATGATGGAAGGAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCTGATGGCCTCAGGTCAGCCCCTGCCACCTACATGATGGAAGGAGA  800

seq1  GACTCCTATAAGTTGTCCTCAAACCTCCAAAAATCTCCAAGACACATGAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCCTATAAGTTGTCCTCAAACCTCCAAAAATCTCCAAGACACATGAC  850

seq1  ACCCACCTCAACACACACACACACACACACACACACACACACACACACAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCACCTCAACACACACACACACACACACACACACACACACACACACAC  900

seq1  ACACACACACACTTTTTAAAAATGCTCAAGGACACAG-AATTAATTTTAT  949
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  ACACACACACACTTTTTAAAAATGCTCAAGGACACAGAAATTAATTTTAT  950

seq1  AATAAAATTCCCAATTTTATTACTTTAATACTTTCAAAACAACCACTAAA  999
       |||||  | |||||||||||||||  ||||||   |||||  |||| ||
seq2  -ATAAA--TTCCAATTTTATTACTT--ATACTT--CAAACA--CACT-AA  990

seq1  TGAATTGAGCTTTAAACAATAACCCATTGATTGGG-CGCCCACTGTTTGC  1048
      || ||||||| |||||| |||  |||||||||||| ||||||||  ||||
seq2  TG-ATTGAGC-TTAAAC-ATA--CCATTGATTGGGCCGCCCACTTGTTGC  1035

seq1  TGGGCTTAGGCTAGGCCAGAG-TGCACCAAACACAGCCCAGTGCTGTTCC  1097
      |||||||| |||||||||||| |||||  ||| ||| ||  ||||| |||
seq2  TGGGCTTA-GCTAGGCCAGAGTTGCAC--AAC-CAGGCCCATGCTGGTCC  1081

seq1  -TCCCACTGTG  1107
       ||||||||||
seq2  TTCCCACTGTG  1092

seq1: chr16_10591496_10592627
seq2: B6Ng01-306L19.g_69_1205 (reverse)

seq1  GTGTGGT-GTGT-ATGAGACCCTAAATTCAATCCCAGCTCTACTAAAAGA  48
      ||||||| |||| |||||| ||  ||||||||  ||||| |||| |||||
seq2  GTGTGGTGGTGTAATGAGAGCCCTAATTCAATTGCAGCTGTACT-AAAGA  49

seq1  CCTAAAAA--CAAATAAAACTCATAAGCTTTTGGTCTACATAGTACTTGC  96
      ||||||||  ||||  |||  ||||||||||||||||||||||||| |||
seq2  CCTAAAAAACCAAAATAAAGCCATAAGCTTTTGGTCTACATAGTAC-TGC  98

seq1  TTTTCCTGTTGGTCAGATGTATACTTGACTTACACTATTTATTGGCTTGT  146
      ||||||   ||||||||||||||| |||||||||||||||| ||||||||
seq2  TTTTCCCTGTGGTCAGATGTATAC-TGACTTACACTATTTAATGGCTTGT  147

seq1  -AGACCAGGTC-TCTCCAAGTAGCCTACACCGGCCTTG-AACTAGTCCTC  193
       |||| ||||| |||||||||||||||||||||||||| |||||||||||
seq2  AAGACAAGGTCTTCTCCAAGTAGCCTACACCGGCCTTGAAACTAGTCCTC  197

seq1  CTACCTCAGCCTCCCATGTGCTGGGATTATAAGTATGCACCACCACACAC  243
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTCAGCCTCCCATGTGCTGGGATTATAAGTATGCACCACCACACAC  247

seq1  AGATTATGGCTCAGTTTTCCCCTCAGTGCTTCTAGAGGCC-GGCCTGTTG  292
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AGATTATGGCTCAGTTTTCCCCTCAGTGCTTCTAGAGGCCGGGCCTGTTG  297

seq1  GGTAGCACAGCAAGTGCTATGGAAAGGAGCAGTGGTCTGCTGGACACTGG  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGCACAGCAAGTGCTATGGAAAGGAGCAGTGGTCTGCTGGACACTGG  347

seq1  ATTCCATTCTAGCTCCCCGTTACAGTGTGAGGGGGCTAGAGGCAAGCTCC  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCATTCTAGCTCCCCGTTACAGTGTGAGGGGGCTAGAGGCAAGCTCC  397

seq1  TGCACAAATGTGCAAGATCCTCCTAGCAGTGTGAGGCTCTCAAGTGCTCA  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACAAATGTGCAAGATCCTCCTAGCAGTGTGAGGCTCTCAAGTGCTCA  447

seq1  CTAGTATCAGGGGAAAAGGACTCCCAGGAAAGACCGACAGAGGTGGCTGT  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGTATCAGGGGAAAAGGACTCCCAGGAAAGACCGACAGAGGTGGCTGT  497

seq1  CTCTGTACTTCTCAGCAGCCCTCAGGGAGAAGCTGATAGGATGCCCTTGG  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTACTTCTCAGCAGCCCTCAGGGAGAAGCTGATAGGATGCCCTTGG  547

seq1  GATGATGGGGAAGTTGAAGCCTACAAGGGGGATAGTGGTCAGCAGTAGCC  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGATGGGGAAGTTGAAGCCTACAAGGGGGATAGTGGTCAGCAGTAGCC  597

seq1  ATGGCTTGGCACTTGCCAGGGAGGTGGACCTGAACATGTGGTTCCCTACT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTTGGCACTTGCCAGGGAGGTGGACCTGAACATGTGGTTCCCTACT  647

seq1  GGCTTTGAGTTCTAGGTCCTGTCTATCCTGGCCTGAAGTGGGGGTGTTTT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTGAGTTCTAGGTCCTGTCTATCCTGGCCTGAAGTGGGGGTGTTTT  697

seq1  GCAGGTCAGTTAGTAGCTCAGTAAGTGTATTACCCGTTGAGCCATGTCAC  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGTCAGTTAGTAGCTCAGTAAGTGTATTACCCGTTGAGCCATGTCAC  747

seq1  AAGTCTGGACTTCAGTCTTTGTCATCTATGTGGACTCCCACTGCAGCCAT  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTGGACTTCAGTCTTTGTCATCTATGTGGACTCCCACTGCAGCCAT  797

seq1  GGCTGACCAGAGTTTCATAACCCTTCCTCACCCATGGGCCTTCTCTACAT  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGACCAGAGTTTCATAACCCTTCCTCACCCATGGGCCTTCTCTACAT  847

seq1  GTTTCCAGCTAGTGCTAAATGATTATAGTCTTAGAGACATAAATTCCCAT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCAGCTAGTGCTAAATGATTATAGTCTTAGAGACATAAATTCCCAT  897

seq1  TCTCTGTACCTTACCTCCACCCAGTACCTGGCTAGACAGAAAAGTAAATT  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGTACCTTACCTCCACCCAGTACCTGGCTAGACAGAAAAGTAAATT  947

seq1  TCCTTGGAAAGTTCTTAAATTCTTTTTTCTTTCTTTTTTTCTTTGTAGAG  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGGAAAGTTCTTAAATTCTTTTTTCTTTCTTTTTTTCTTTGTAGAG  997

seq1  ACAGGGTCTGATCATATAGTTCTGGCTGGCTTGGAACTCACTATGTAGTC  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGGTCTGATCATATAGTTCTGGCTGGCTTGGAACTCACTATGTAGTC  1047

seq1  AGGGGTAGCCTTGAACTAATAGAGATCTCTCTGCCTCTACCTTCTGAGTG  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGTAGCCTTGAACTAATAGAGATCTCTCTGCCTCTACCTTCTGAGTG  1097

seq1  CTGGGATTAAAGGTGTGCAGCATTACACCCATCTGAATTC  1132
      ||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGATTAAAGGTGTGCAGCATTACACCCATCTGAATTC  1137

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information