MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-330D18
Chromosome	16 (Build37)
Map Location	21,296,027 - 21,425,039
singlet/doublet	doublet
Overlap gene	6430590I03Rik, Vps8
Upstream gene	Parl, EG224044, Abcc5, Eif2b5, Dvl3, Ap2m1, LOC100042948, Abcf3, BC052055, EG328644, Alg3, 1810009K13Rik, Camk2n2, Ece2, Psmd2, LOC100043475, Eif4g1, 2900046G09Rik, Clcn2, Polr2h, Thpo, Chrd, LOC666255, LOC671504, EG666274, EG625060, LOC625123, LOC676915, 2310042E22Rik, Ephb3
Downstream gene	2510009E07Rik, Ehhadh, LOC100043489, LOC546659, Map3k13, LOC624037, Tmem41a, Liph, Senp2, EG239760, Igf2bp2, EG545152, EG666421, Sfrs10, LOC100043507, Etv5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Parl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381038 MGI:1277152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG224044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224044 MGI:3644957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27416 MGI:1351644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eif2b5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224045 MGI:2446176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dvl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13544 MGI:108100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap2m1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11773 MGI:1298405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Abcf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27406 MGI:1351656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328643 MGI:2681859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG328644 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328644 MGI:3646631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208624 MGI:1098592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810009K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66275 MGI:1913525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk2n2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73047 MGI:1920297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 4 Proteins

name	Ece2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107522 MGI:1101356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21762 MGI:1096584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043475 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 11 Proteins pseudo : _no_value

name	Eif4g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208643 MGI:2384784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2900046G09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78408 MGI:1925658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12724 MGI:105061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245841 MGI:2384309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21832 MGI:101875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12667 MGI:1313268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666255 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	LOC671504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG666274 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666274 MGI:3645627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1279 ESTs, 8 Proteins

name	EG625060 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625060 MGI:3644103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 8 ESTs, 8 Proteins

name	LOC625123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC676915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	2310042E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66561 MGI:1913811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ephb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13845 MGI:104770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430590I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76222 MGI:1923472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins

name	Vps8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209018 MGI:2146407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510009E07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72190 MGI:1919440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehhadh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74147 MGI:1277964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043489 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC546659 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 8 Proteins pseudo : _no_value

name	Map3k13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71751 MGI:2444243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624037
definition	note : proteasome (prosome, macropain) subunit, beta type 3 pseudogene pseudo : _no_value

name	Tmem41a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66664 MGI:1913914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Liph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239759 MGI:2388029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Senp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75826 MGI:1923076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG239760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239760 MGI:3645174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins

name	Igf2bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319765 MGI:1890358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545152 MGI:3647324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 176 ESTs

name	EG666421 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666421 MGI:3645751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins pseudo : _no_value

name	Sfrs10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20462 MGI:106016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 186 ESTs, 10 Proteins

name	Etv5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104156 MGI:1096867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379687 GeneID:381038 MGI:1277152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : presenilin associated, rhomboid-like transcript_id : NM_001005767.2

name	EG224044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353947 GeneID:224044 MGI:3644957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG224044 transcript_id : NM_183158.2

name	Abcc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932953 GeneID:27416 MGI:1351644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 5 transcript_id : NM_013790.2

name	Abcc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932955 GeneID:27416 MGI:1351644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 5 transcript_id : NM_176839.1

name	Eif2b5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986556 GeneID:224045 MGI:2446176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2B, subunit 5 epsilon transcript_id : NM_172265.1

name	Dvl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168286 GeneID:13544 MGI:108100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dishevelled 3, dsh homolog (Drosophila) transcript_id : NM_007889.2

name	Ap2m1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892644 GeneID:11773 MGI:1298405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, mu1 transcript_id : NM_009679.2

name	Abcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490362 GeneID:27406 MGI:1351656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family F (GCN20), member 3 transcript_id : NM_013852.2

name	BC052055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351230 GeneID:328643 MGI:2681859
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052055 transcript_id : NM_182636.3

name	EG328644 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348499 GeneID:328644 MGI:3646631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG328644 transcript_id : NM_198629.1

name	Alg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122364 GeneID:208624 MGI:1098592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) transcript_id : NM_145939.1

name	1810009K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953155 GeneID:66275 MGI:1913525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009K13 gene transcript_id : NM_025462.2

name	Camk2n2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400097 GeneID:73047 MGI:1920297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 4 Proteins product : calcium/calmodulin-dependent protein kinase II inhibitor 2 transcript_id : XM_990809.1

name	Ece2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314839 GeneID:107522 MGI:1101356
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelin converting enzyme 2 transcript_id : NM_139293.1

name	Psmd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19882200 GeneID:21762 MGI:1096584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 transcript_id : NM_134101.1

name	Eif4g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699431 GeneID:208643 MGI:2384784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4, gamma 1 transcript_id : NM_145941.2

name	Eif4g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699433 GeneID:208643 MGI:2384784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4, gamma 1 transcript_id : NM_001005331.1

name	2900046G09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345536 GeneID:78408 MGI:1925658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900046G09 gene transcript_id : NM_133778.2

name	Clcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753431 GeneID:12724 MGI:105061
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 2 transcript_id : NM_009900.1

name	Polr2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892587 GeneID:245841 MGI:2384309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide H transcript_id : NM_145632.2

name	Thpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364337 GeneID:21832 MGI:101875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thrombopoietin transcript_id : NM_009379.3

name	Chrd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753417 GeneID:12667 MGI:1313268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chordin transcript_id : NM_009893.1

name	EG666274 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267468 GeneID:666274 MGI:3645627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1279 ESTs, 8 Proteins product : predicted gene, EG666274 transcript_id : XM_982692.2

name	EG625060 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400114 GeneID:625060 MGI:3644103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 8 ESTs, 8 Proteins product : predicted gene, EG625060 transcript_id : XM_889601.2

name	LOC625123 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267470 GeneID:625123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : hypothetical LOC625123 transcript_id : XM_889664.2

name	2310042E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803385 GeneID:66561 MGI:1913811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310042E22 gene transcript_id : NM_025634.2

name	Ephb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859547 GeneID:13845 MGI:104770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B3 transcript_id : NM_010143.1

name	Vps8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486982 GeneID:209018 MGI:2146407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 8 homolog (S. cerevisiae) transcript_id : NM_001081366.1

name	2510009E07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49457852 GeneID:72190 MGI:1919440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510009E07 gene transcript_id : NM_001001881.1

name	Ehhadh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541814 GeneID:74147 MGI:1277964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase transcript_id : NM_023737.2

name	LOC100043489 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267473 GeneID:100043489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043489, transcript variant 2 transcript_id : XM_001480816.1

name	LOC100043489 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267471 GeneID:100043489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043489, transcript variant 1 transcript_id : XM_001480812.1

name	Map3k13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95113637 GeneID:71751 MGI:2444243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 13 transcript_id : NM_172821.2

name	Tmem41a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359794 GeneID:66664 MGI:1913914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 41a transcript_id : NM_025693.2

name	Liph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970703 GeneID:239759 MGI:2388029
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, member H transcript_id : NM_001083894.1

name	Liph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971804 GeneID:239759 MGI:2388029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, member H transcript_id : NM_153404.2

name	Senp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560058 GeneID:75826 MGI:1923076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO/sentrin specific peptidase 2 transcript_id : NM_029457.2

name	EG239760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400117 GeneID:239760 MGI:3645174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : predicted gene, EG239760 transcript_id : XM_983617.1

name	Igf2bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942111 GeneID:319765 MGI:1890358
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 mRNA binding protein 2 transcript_id : NM_183029.1

name	EG545152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267477 GeneID:545152 MGI:3647324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 176 ESTs product : predicted gene, EG545152 transcript_id : XM_619384.4

name	Sfrs10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802029 GeneID:20462 MGI:106016
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) transcript_id : NM_009186.3

name	LOC100043507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267480 GeneID:100043507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 186 ESTs, 10 Proteins product : similar to G protein gamma-5 subunit transcript_id : XM_001480840.1

name	Etv5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24528549 GeneID:104156 MGI:1096867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 5 transcript_id : NM_023794.2

name	Parl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261813 CCDS:CCDS28044.1 GeneID:381038 MGI:1277152
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : presenilin associated, rhomboid-like protein_id : NP_001005767.1

name	EG224044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147185 GeneID:224044 MGI:3644957
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC224044 protein_id : NP_898981.1

name	Abcc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66932954 CCDS:CCDS28045.1 GeneID:27416 MGI:1351644
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ATP-binding cassette, sub-family C (CFTR/MRP), member 5a; ATP-binding cassette, sub-family C (CFTR/MRP), member 5b product : ATP-binding cassette, sub-family C, member 5 isoform 1 protein_id : NP_038818.2

name	Abcc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66932956 CCDS:CCDS28046.1 GeneID:27416 MGI:1351644
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ATP-binding cassette, sub-family C (CFTR/MRP), member 5a; ATP-binding cassette, sub-family C (CFTR/MRP), member 5b product : ATP-binding cassette, sub-family C, member 5 isoform 2 protein_id : NP_789809.1

name	Eif2b5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986557 CCDS:CCDS28047.1 GeneID:224045 MGI:2446176
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005851 - eukaryotic translation initiation factor 2B complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045948 - positive regulation of translational initiation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 2B, subunit 5 epsilon protein_id : NP_758469.1

name	Dvl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168287 GeneID:13544 MGI:108100
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : dishevelled 3 protein_id : NP_031915.2

name	Ap2m1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753074 CCDS:CCDS28048.1 GeneID:11773 MGI:1298405
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : adaptor-related protein complex AP-2, mu1; clathrin-associated AP-2 product : adaptor protein complex AP-2, mu1 protein_id : NP_033809.1

name	Abcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789050 CCDS:CCDS28049.1 GeneID:27406 MGI:1351656
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family F (GCN20), member 3 protein_id : NP_038880.1

name	BC052055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922584 GeneID:328643 MGI:2681859
definition	codon_start : 1 product : hypothetical protein LOC328643 protein_id : NP_872574.2

name	EG328644 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348500 CCDS:CCDS28050.1 GeneID:328644 MGI:3646631
definition	codon_start : 1 product : hypothetical protein LOC328644 protein_id : NP_941031.1

name	Alg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122365 GeneID:208624 MGI:1098592
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000030 - mannosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation product : alpha-1,3-mannosyltransferase ALG3 protein_id : NP_666051.1

name	1810009K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953156 GeneID:66275 MGI:1913525
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66275 protein_id : NP_079738.2

name	Camk2n2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400098 GeneID:73047 MGI:1920297
definition	codon_start : 1 product : calcium/calmodulin-dependent protein kinase II inhibitor 2 protein_id : XP_995903.1

name	Ece2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314840 CCDS:CCDS28052.1 GeneID:107522 MGI:1101356
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence ISS]; GO:0005802 - Golgi trans face [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016511 - endothelin-converting enzyme activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence ISS] [Evidence IMP]; GO:0010002 - cardioblast differentiation [Evidence ISS] [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence ISS]; GO:0009790 - embryonic development [Evidence ISS]; GO:0007507 - heart development [Evidence ISS] [Evidence IMP]; GO:0016486 - peptide hormone processing [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0042310 - vasoconstriction [Evidence ISS] codon_start : 1 exception : mismatches in translation product : endothelin converting enzyme 2 protein_id : NP_647454.1

name	Psmd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882201 CCDS:CCDS28053.1 GeneID:21762 MGI:1096584
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : testis expressed gene 190 product : proteasome 26S non-ATPase subunit 2 protein_id : NP_598862.1

name	Eif4g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699432 CCDS:CCDS28055.1 GeneID:208643 MGI:2384784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : eukaryotic translation initiation factor 4, gamma 1 isoform a protein_id : NP_666053.2

name	Eif4g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699434 CCDS:CCDS28054.1 GeneID:208643 MGI:2384784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : eukaryotic translation initiation factor 4, gamma 1 isoform b protein_id : NP_001005331.1

name	2900046G09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789331 CCDS:CCDS28056.1 GeneID:78408 MGI:1925658
definition	codon_start : 1 product : hypothetical protein LOC78408 protein_id : NP_598539.1

name	Clcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753432 CCDS:CCDS28057.1 GeneID:12724 MGI:105061
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : chloride channel 2 protein_id : NP_034030.1

name	Polr2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704118 CCDS:CCDS28058.1 GeneID:245841 MGI:2384309
definition	GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide H protein_id : NP_663607.1

name	Thpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678341 GeneID:21832 MGI:101875
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0030099 - myeloid cell differentiation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : myeloproliferative leukemia virus oncogene ligand product : thrombopoietin protein_id : NP_033405.1

name	Chrd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753418 CCDS:CCDS28059.1 GeneID:12667 MGI:1313268
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0045545 - syndecan binding [Evidence IDA] GO_process : GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence IDA]; GO:0001649 - osteoblast differentiation [Evidence IDA]; GO:0007389 - pattern specification [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : chordin protein_id : NP_034023.1

name	EG666274 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400113 GeneID:666274 MGI:3645627
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987786.1

name	EG625060 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959136 GeneID:625060 MGI:3644103
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894694.1

name	LOC625123 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82959144 GeneID:625123
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894757.1

name	2310042E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385096 GeneID:66561 MGI:1913811
definition	codon_start : 1 product : hypothetical protein LOC66561 protein_id : NP_079910.1

name	Ephb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859548 CCDS:CCDS28060.1 GeneID:13845 MGI:104770
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008046 - axon guidance receptor activity [Evidence IDA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005005 - transmembrane-ephrin receptor activity [Evidence TAS] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : Eph receptor B3 protein_id : NP_034273.1

name	Vps8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486983 GeneID:209018 MGI:2146407
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 8 homolog protein_id : NP_001074835.1

name	2510009E07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457853 CCDS:CCDS28062.1 GeneID:72190 MGI:1919440
definition	codon_start : 1 product : hypothetical protein LOC72190 protein_id : NP_001001881.1

name	Ehhadh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541815 CCDS:CCDS28063.1 GeneID:74147 MGI:1277964
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003857 - 3-hydroxyacyl-CoA dehydrogenase activity [Evidence TAS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004165 - dodecenoyl-CoA delta-isomerase activity [Evidence IEA]; GO:0004300 - enoyl-CoA hydratase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS]; GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : L-bifunctional enzyme product : L-specific multifunctional beta-oxdiation protein protein_id : NP_076226.2

name	LOC100043489 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267472 GeneID:100043489
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480862.1

name	LOC100043489 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267474 GeneID:100043489
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480866.1

name	Map3k13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:95113638 GeneID:71751 MGI:2444243
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase kinase kinase 13 protein_id : NP_766409.2

name	Tmem41a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313376 CCDS:CCDS28064.1 GeneID:66664 MGI:1913914
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 41a protein_id : NP_079969.1

name	Liph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510279 GeneID:239759 MGI:2388029
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lipase H product : lipase, member H isoform 2 protein_id : NP_700453.1

name	Liph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970704 GeneID:239759 MGI:2388029
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lipase H product : lipase, member H isoform 1 protein_id : NP_001077363.1

name	Senp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386400 CCDS:CCDS28065.1 GeneID:75826 MGI:1923076
definition	GO_component : GO:0005643 - nuclear pore [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016929 - SUMO-specific protease activity [Evidence ISS] GO_process : GO:0016926 - protein desumoylation [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0030111 - regulation of Wnt receptor signaling pathway [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : SUMO-1/Smt3-specific isopeptidase 2; SUMO-1 protease-1 product : SUMO/sentrin specific protease 2 protein_id : NP_083733.1

name	EG239760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267300 GeneID:239760 MGI:3645174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988711.2

name	Igf2bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942112 GeneID:319765 MGI:1890358
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 note : insulin-like growth factor 2 mRNA-binding protein 2; insulin-like growth factor 2, binding protein 2 product : insulin-like growth factor 2 mRNA binding protein 2 protein_id : NP_898850.1

name	EG545152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959168 GeneID:545152 MGI:3647324
definition	codon_start : 1 product : similar to Transmembrane protein 97 protein_id : XP_619384.2

name	Sfrs10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677975 GeneID:20462 MGI:106016
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS] [Evidence IEA] codon_start : 1 note : silica-induced gene 41 product : splicing factor, arginine/serine-rich 10 protein_id : NP_033212.1

name	LOC100043507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267481 GeneID:100043507
definition	codon_start : 1 product : similar to G protein gamma-5 subunit protein_id : XP_001480890.1

name	Etv5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24528550 GeneID:104156 MGI:1096867
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : ets variant gene 5 protein_id : NP_076283.2

name	LOC100042948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042948
definition	number : 2 pseudo : _no_value

name	LOC100042948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042948
definition	number : 1 pseudo : _no_value

name	LOC671504 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671504
definition	number : 1 pseudo : _no_value

name	LOC671504 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671504
definition	number : 2 pseudo : _no_value

name	LOC100043475 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267461 GeneID:100043475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 11 Proteins product : similar to eukaryotic translation elongation factor 1 gamma pseudo : _no_value transcript_id : XR_034831.1

name	LOC666255 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267467 GeneID:666255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : similar to hCG1641837 pseudo : _no_value transcript_id : XR_034839.1

name	LOC676915 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267298 GeneID:676915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to nuclear domain 10 protein 52 like 1 pseudo : _no_value transcript_id : XR_034101.1

name	6430590I03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94400115 GeneID:76222 MGI:1923472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins product : RIKEN cDNA 6430590I03 gene transcript_id : XR_002321.1

name	LOC546659 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267476 GeneID:546659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 8 Proteins product : similar to Ribosomal protein L12 pseudo : _no_value transcript_id : XR_034852.1

name	EG666421 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267478 GeneID:666421 MGI:3645751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 21 Proteins product : predicted gene, EG666421 pseudo : _no_value transcript_id : XR_035704.1

clone name	MSMg01-414M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-436C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-400A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-330D18.b	B6Ng01-330D18.g
ACC	GA116972	GA116973
length	1,162	472
definition	B6Ng01-330D18.b	B6Ng01-330D18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(21,423,874 - 21,425,039)	(21,296,027 - 21,296,504)
sequence	gaattcaaggacagcctggtgtactggacaaccaaggctacacaaagaaa ccttgtctcgaggaggggaaaaaaggccttactgaattgagaagacagtt cagtcagcacactgtcagccctgcaagcacaaaagtatagtgatttgatg gcatctgtcattaagtccccagaacacacaaaaaaagccaggccaattgc ggcccacttttgtaatcccagcactagggaggtggagataagcagactcc tggccctagggacaaaaagaagaggacttcacaaagttgtgctcttactg ccacatgtgtgcctctcaaggcttagtcagtaaagtgtttgaggcacaaa tatgagaacctgagtttgataccccaaagcctacacttacaaagctgagc atggtggtaagagcctgtaaacctggaaaggagggagagatggagacatg gccccgaaggcttattagctcatctagctgaatcagcaggctgtgccttg agcaataggtcctgtctcaaaatagaggggtgggagagatggctcagcga ttaaaaaggtatactgctcttatatagggccagagtttggttcccagcac caacacggggtagctcacaacagctcgtaactccagctctagggccttac ttctcctatcccaatggctaaaatgtttatggactagtggggataacact aagagtcactaagaaacccccaaattctggaagacagaatgcactcaacg actgccaacagtccaattacaaaagaaacatataaagaaaaaaaaatcag caccttattctgttagaggtctgtaaagaattttctcacataactcagtc acttcccgcatacaaggctcaacagttcaaacaaaactgctccatttatc tttattgtgtattctacagaccaggtcagctagtgctagaggagtcaata cttttctgcttagatgtcaacgtgagcaaacccatgacttaaacacatgt gggttccccatcctcatctatatggaggcacttcaaacacagaagtgtta acataaacccacacacaacgatgtgccatttttctcccaaacagagacac tgacagaagttagcggcactagccaacattctgtgctacgtacttgggct ttttgggggggg	attcccatatgagagaaagactcactagctcttttcttcaagaagccaac tccattagtgcattaaaatacgactcaagttgccaaatgtgatttcatat gcaatccctctccccgcccccaacatacttctcactcttgatccctaagg aatactccgccttgaataaagagaggttcgcctgggggtgggggggactg ctaaccaacatggcaaacacatgtcctggattttctgagactggctcact ttctaatattaggtttccattgtcccatgagaactcttggaacgatcagg ccttggggactggccatacaaatggtcactatagagaggacagtgtcctg tctgacccccctttccagcattgcagggcttaggggcaaggcaggttgga gagccctgtggcggtagagagggtaaagagagttctaggattgggaagct tcgtggggtggggggtgttgga
quality values	Open. Hide. 38 49 42 47 62 37 31 39 56 62 39 56 44 62 62 62 59 62 28 49 28 62 59 59 62 62 62 59 51 49 51 50 44 21 27 25 43 27 31 43 56 51 59 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 56 54 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 59 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 49 49 49 62 59 62 62 62 62 54 62 62 62 62 54 54 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 49 49 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 62 58 58 54 58 58 58 58 58 58 54 54 54 58 58 58 58 58 58 58 39 58 54 54 58 58 58 58 58 58 58 58 58 54 54 58 54 58 58 49 42 54 47 58 58 52 58 58 58 58 42 41 54 58 58 58 49 54 58 53 58 54 39 58 58 54 58 58 58 49 58 54 58 54 58 58 58 50 50 47 58 58 40 58 58 58 58 58 51 58 49 54 58 51 45 35 49 58 58 52 58 52 49 58 58 40 58 54 58 50 51 49 51 51 54 54 58 53 58 52 51 58 44 40 58 50 58 58 48 49 53 58 58 41 41 58 32 58 51 54 46 58 58 37 32 41 51 51 49 58 58 58 58 41 39 50 39 49 52 52 51 28 46 52 58 40 52 53 52 47 49 50 53 50 58 58 50 37 58 58 58 51 41 58 51 44 40 41 53 53 51 38 47 39 50 27 42 32 54 31 35 54 39 32 43 51 37 26 54 52 39 49 41 35 53 35 41 37 51 41 36 28 35 53 52 31 38 51 49 31 53 30 54 54 47 40 52 54 37 45 32 52 40 53 21 54 54 29 42 54 54 54 54 54 54 54 37 42 40 33 35 53 32 26 42 32 53 35 26 52 37 33 53 31 40 36 26 41 17 36 27 32 40 52 40 42 49 34 40 52 52 29 52 49 46 37 40 35 33 32 31 45 34 33 39 43 31 42 13 43 36 34 35 31 48 31 51 31 31 31 26 31 31 31 13 43 30 33 25 43 38 31 33 31 29 32 46 30 20 20 51 51 27 26 48 48 43 31 31 41 26 33 26 32 33 31 48 31 22 26 43 42 48 24 28 31 19 19 18 31 31 34 38 37 36 32 32 31 26 25 31 32 31 30 26 30 31 35 34 26 31 30 20 26 26 38 33 38 32 33 39 14 30 37 22 38 32 21 33 20 30 33 38 46 46 26 34 28 38 28 32 21 25 8 33 21 31 20 20 22 21 33 22 25 28 37 24 32 32 37 32 14 28 18 23 20 25 31 26 21 15 13 38 21 17 10 11 11 17 15 18 21 48 31 23 32 37 33 31 24 8 30 32 33 20 9 21 15 23 11 8 9 5 23 6 15 4 5 13 20 14 18 8 24 27 25 37 5 7 6 15 11 8 18 25 5 9 18 12 8 22 11 14 10 8 7 27 20 17 27 12 10 15 10 7 5 9 11 17 28 15 19 11 7 10 16 11 7 13 3 31 40 28 10 6 17 11 29 7 9 17 9 16 9 9 7 4 3 9 6 20 6 3 2 1 3 5 12 23 5 17 7 12 11 18 9 16 7 12 20 14 12 7 11 15 22 16 9 4 6 16 20 16 13 13 15 12 18 6 17 5 19 7 10 13 9 17 24 21 14 14 26 17 28 14 9 25 28 28 28 24 17 9	Open. Hide. 49 62 62 43 43 49 14 28 25 28 28 43 28 49 34 56 56 62 62 59 59 62 59 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 59 51 59 62 62 62 62 62 59 62 59 59 56 43 42 30 49 54 62 54 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 42 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 46 58 58 58 49 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 46 58 58 47 39 47 39 47 34 39 34 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_21423874_21425039
seq2: B6Ng01-330D18.b_51_1212 (reverse)

seq1  CCCCCCCCAAAAAGCCCAAGTAACGTAAGCACAG-ATGTTGGCTAGTGCC  49
      ||||||||||||||||||||| |||| ||||||| |||||||||||||||
seq2  CCCCCCCCAAAAAGCCCAAGT-ACGT-AGCACAGAATGTTGGCTAGTGCC  48

seq1  GCTAAC-TCTGTTCCAGGTGTCTCTGTTTGGGAG-AAAATTGCACATCGT  97
      |||||| |||||  || ||||||||||||||||| ||||| |||||||||
seq2  GCTAACTTCTGT--CA-GTGTCTCTGTTTGGGAGAAAAATGGCACATCGT  95

seq1  TGTGTGTGGGTTTATGTT-ACACTTCTGTGTTTGAAGTGCTTCCAATATA  146
      |||||||||||||||||| ||||||||||||||||||||| ||| |||||
seq2  TGTGTGTGGGTTTATGTTAACACTTCTGTGTTTGAAGTGCCTCC-ATATA  144

seq1  GATTGAGGATGGGGGAACCCACATGTGTTTAAGTCATGGGTTTGCTCACG  196
      || ||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GA-TGAGGAT-GGGGAACCCACATGTGTTTAAGTCATGGGTTTGCTCACG  192

seq1  TTGACATCTAAGCAGAAAAGTATTGACTCCTCTAGCACTAGCTGACCTGG  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACATCTAAGCAGAAAAGTATTGACTCCTCTAGCACTAGCTGACCTGG  242

seq1  TCTGTAGAATACACAATAAAGATAAATGGAGCAGTTTTGTTTGAACTGTT  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTAGAATACACAATAAAGATAAATGGAGCAGTTTTGTTTGAACTGTT  292

seq1  GAGCCTTGTATGCGGGAAGTGACTGAGTTATGTGAGAAAATTCTTTACAG  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTTGTATGCGGGAAGTGACTGAGTTATGTGAGAAAATTCTTTACAG  342

seq1  ACCTCTAACAGAATAAGGTGCTGATTTTTTTTTCTTTATATGTTTCTTTT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCTAACAGAATAAGGTGCTGATTTTTTTTTCTTTATATGTTTCTTTT  392

seq1  GTAATTGGACTGTTGGCAGTCGTTGAGTGCATTCTGTCTTCCAGAATTTG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATTGGACTGTTGGCAGTCGTTGAGTGCATTCTGTCTTCCAGAATTTG  442

seq1  GGGGTTTCTTAGTGACTCTTAGTGTTATCCCCACTAGTCCATAAACATTT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTTTCTTAGTGACTCTTAGTGTTATCCCCACTAGTCCATAAACATTT  492

seq1  TAGCCATTGGGATAGGAGAAGTAAGGCCCTAGAGCTGGAGTTACGAGCTG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCATTGGGATAGGAGAAGTAAGGCCCTAGAGCTGGAGTTACGAGCTG  542

seq1  TTGTGAGCTACCCCGTGTTGGTGCTGGGAACCAAACTCTGGCCCTATATA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGAGCTACCCCGTGTTGGTGCTGGGAACCAAACTCTGGCCCTATATA  592

seq1  AGAGCAGTATACCTTTTTAATCGCTGAGCCATCTCTCCCACCCCTCTATT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCAGTATACCTTTTTAATCGCTGAGCCATCTCTCCCACCCCTCTATT  642

seq1  TTGAGACAGGACCTATTGCTCAAGGCACAGCCTGCTGATTCAGCTAGATG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGACAGGACCTATTGCTCAAGGCACAGCCTGCTGATTCAGCTAGATG  692

seq1  AGCTAATAAGCCTTCGGGGCCATGTCTCCATCTCTCCCTCCTTTCCAGGT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAATAAGCCTTCGGGGCCATGTCTCCATCTCTCCCTCCTTTCCAGGT  742

seq1  TTACAGGCTCTTACCACCATGCTCAGCTTTGTAAGTGTAGGCTTTGGGGT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAGGCTCTTACCACCATGCTCAGCTTTGTAAGTGTAGGCTTTGGGGT  792

seq1  ATCAAACTCAGGTTCTCATATTTGTGCCTCAAACACTTTACTGACTAAGC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAACTCAGGTTCTCATATTTGTGCCTCAAACACTTTACTGACTAAGC  842

seq1  CTTGAGAGGCACACATGTGGCAGTAAGAGCACAACTTTGTGAAGTCCTCT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAGAGGCACACATGTGGCAGTAAGAGCACAACTTTGTGAAGTCCTCT  892

seq1  TCTTTTTGTCCCTAGGGCCAGGAGTCTGCTTATCTCCACCTCCCTAGTGC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTTGTCCCTAGGGCCAGGAGTCTGCTTATCTCCACCTCCCTAGTGC  942

seq1  TGGGATTACAAAAGTGGGCCGCAATTGGCCTGGCTTTTTTTGTGTGTTCT  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGATTACAAAAGTGGGCCGCAATTGGCCTGGCTTTTTTTGTGTGTTCT  992

seq1  GGGGACTTAATGACAGATGCCATCAAATCACTATACTTTTGTGCTTGCAG  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGACTTAATGACAGATGCCATCAAATCACTATACTTTTGTGCTTGCAG  1042

seq1  GGCTGACAGTGTGCTGACTGAACTGTCTTCTCAATTCAGTAAGGCCTTTT  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGACAGTGTGCTGACTGAACTGTCTTCTCAATTCAGTAAGGCCTTTT  1092

seq1  TTCCCCTCCTCGAGACAAGGTTTCTTTGTGTAGCCTTGGTTGTCCAGTAC  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCTCCTCGAGACAAGGTTTCTTTGTGTAGCCTTGGTTGTCCAGTAC  1142

seq1  ACCAGGCTGTCCTTGAATTC  1166
      ||||||||||||||||||||
seq2  ACCAGGCTGTCCTTGAATTC  1162

seq1: chr16_21296027_21296504
seq2: B6Ng01-330D18.g_67_544

seq1  GAATTCATTCCCATATGAGAGAAAGACTCACTAGCTCTTTTCTTCAAGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTCCCATATGAGAGAAAGACTCACTAGCTCTTTTCTTCAAGAA  50

seq1  GCCAACTCCATTAGTGCATTAAAATACGACTCAAGTTGCCAAATGTGATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAACTCCATTAGTGCATTAAAATACGACTCAAGTTGCCAAATGTGATT  100

seq1  TCATATGCAATCCCTCTCCCCGCCCCCAACATACTTCTCACTCTTGATCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATATGCAATCCCTCTCCCCGCCCCCAACATACTTCTCACTCTTGATCC  150

seq1  CTAAGGAATACTCCGCCTTGAATAAAGAGAGGTTCGCCTGGGGGTGGGGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGGAATACTCCGCCTTGAATAAAGAGAGGTTCGCCTGGGGGTGGGGG  200

seq1  GGACTGCTAACCAACATGGCAAACACATGTCCTGGATTTTCTGAGACTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTGCTAACCAACATGGCAAACACATGTCCTGGATTTTCTGAGACTGG  250

seq1  CTCACTTTCTAATATTAGGTTTCCATTGTCCCATGAGAACTCTTGGAACG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTTTCTAATATTAGGTTTCCATTGTCCCATGAGAACTCTTGGAACG  300

seq1  ATCAGGCCTTGGGGACTGGCCATACAAATGGTCACTATAGAGAGGACAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGGCCTTGGGGACTGGCCATACAAATGGTCACTATAGAGAGGACAGT  350

seq1  GTCCTGTCTGACCCCCCTTTCCAGCATTGCAGGGCTTAGGGGCAAGGCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTGTCTGACCCCCCTTTCCAGCATTGCAGGGCTTAGGGGCAAGGCAG  400

seq1  GTTGGAGAGCCCTGTGGCGGTAGAGAGGGTAAAGAGAGTTCTAGGATTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGAGAGCCCTGTGGCGGTAGAGAGGGTAAAGAGAGTTCTAGGATTGG  450

seq1  GAAGCTTCGTGGGGTGGGGGGTGTTGGA  478
      ||||||||||||||||||||||||||||
seq2  GAAGCTTCGTGGGGTGGGGGGTGTTGGA  478

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information