MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-349K04
Chromosome	16 (Build37)
Map Location	88,144,115 - 88,271,433
singlet/doublet	doublet
Overlap gene	Grik1
Upstream gene	N6amt1, Zfp294, ORF5, LOC100040088, Usp16, Cct8, B130034C11Rik, LOC435486, ORF63, Bach1, LOC100039901
Downstream gene	EG622373, Cldn17, Cldn8, Gm312, 2310079G19Rik, 2310002B14Rik, EG665513, 2310061N02Rik, Krtap13-1, Krtap13, 2310034C09Rik, 2310057N15Rik, EG546672, EG433047, 4930553J12Rik, Krtap14, Krtap15, Krtap16-9, Krtap16-1, Krtap16-5, Krtap16-4, Krtap8-2, LOC100040191, AY026312, Krtap16-10, EG621595, LOC100040167, 1110032D16Rik, LOC100040201, Krtap6-1, LOC100040214, Krtap16-8, 1110025L11Rik, LOC100040249, LOC100040267, EG622794, LOC100040281, ENSMUSG00000044227, EG665661, LOC100040288, EG622935, EG622981, EG622998, EG623011, EG623026, LOC100040346, EG623049, LOC100040415, EG640636, LOC640652, LOC640654
Link	Open Mouse BAC browser

Click to get alignment info.

name	N6amt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67768 MGI:1915018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp294 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78913 MGI:1926163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ORF5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53858 MGI:1858215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040088 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Usp16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74112 MGI:1921362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12469 MGI:107183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B130034C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414095 MGI:3041186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC435486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	ORF63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224419 MGI:2446584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bach1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12013 MGI:894680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Grik1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14805 MGI:95814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG622373 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622373 MGI:3645674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cldn17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239931 MGI:2652030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54420 MGI:1859286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239932 MGI:2685158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	2310079G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69699 MGI:1916949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	2310002B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69533 MGI:1916783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665513 MGI:3648908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins pseudo : _no_value

name	2310061N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69661 MGI:1916911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 6 Proteins

name	Krtap13-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268905 MGI:2146359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16699 MGI:1330835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310034C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117172 MGI:2152338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310057N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69696 MGI:1916946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546672 MGI:3645197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 7 Proteins

name	EG433047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433047 MGI:3647686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	4930553J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75351 MGI:1922601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 5 Proteins

name	Krtap14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23927 MGI:1346079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26560 MGI:1347350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170657 MGI:2157769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170651 MGI:2157572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77918 MGI:1925168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170654 MGI:2157757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap8-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16704 MGI:1330295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	AY026312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	1110032D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC100040201 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins

name	Krtap6-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins

name	Krtap16-8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68484 MGI:1915734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110025L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins

name	LOC100040249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC100040267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG622794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	ENSMUSG00000044227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG665661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040288 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG622935 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG622981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG622998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG623011 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG623026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG623049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG640636 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC640652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC640654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	N6amt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39540505 GeneID:67768 MGI:1915018
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-6 adenine-specific DNA methyltransferase 1 (putative) transcript_id : NM_026366.1

name	Zfp294 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486726 GeneID:78913 MGI:1926163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 294 transcript_id : NM_001081068.1

name	ORF5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360351 GeneID:53858 MGI:1858215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 5 transcript_id : NM_016924.2

name	LOC100040088 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268134 GeneID:100040088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100040088 transcript_id : XM_001474061.1

name	Usp16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195675 GeneID:74112 MGI:1921362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 16 transcript_id : NM_024258.1

name	Cct8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723460 GeneID:12469 MGI:107183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 8 (theta) transcript_id : NM_009840.3

name	B130034C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268117 GeneID:414095 MGI:3041186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA B130034C11 gene transcript_id : XM_001473307.1

name	ORF63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450068 GeneID:224419 MGI:2446584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 63 transcript_id : NM_144854.1

name	Bach1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82659113 GeneID:12013 MGI:894680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB and CNC homology 1 transcript_id : NM_007520.2

name	LOC100039901 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268120 GeneID:100039901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039901 transcript_id : XM_001473375.1

name	Grik1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348035 GeneID:14805 MGI:95814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 1 transcript_id : NM_010348.2

name	Grik1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381111 GeneID:14805 MGI:95814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 1 transcript_id : NM_146072.3

name	Cldn17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801892 GeneID:239931 MGI:2652030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 17 transcript_id : NM_181490.3

name	Cldn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542405 GeneID:54420 MGI:1859286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 8 transcript_id : NM_018778.2

name	Gm312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400718 GeneID:239932 MGI:2685158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : gene model 312, (NCBI) transcript_id : XM_977282.1

name	2310079G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268136 GeneID:69699 MGI:1916949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : RIKEN cDNA 2310079G19 gene transcript_id : XM_484566.3

name	2310002B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351733 GeneID:69533 MGI:1916783
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310002B14 gene transcript_id : NM_027105.2

name	2310061N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268129 GeneID:69661 MGI:1916911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 6 Proteins product : RIKEN cDNA 2310061N02 gene transcript_id : XM_001473644.1

name	Krtap13-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147241 GeneID:268905 MGI:2146359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 13-1 transcript_id : NM_183189.1

name	Krtap13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754491 GeneID:16699 MGI:1330835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 13 transcript_id : NM_010671.1

name	2310034C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368102 GeneID:117172 MGI:2152338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310034C09 gene transcript_id : NM_054100.2

name	2310057N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386207 GeneID:69696 MGI:1916946
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310057N15 gene transcript_id : NM_027170.1

name	EG546672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400721 GeneID:546672 MGI:3645197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 7 Proteins product : predicted gene, EG546672, transcript variant 3 transcript_id : XM_885642.2

name	4930553J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400723 GeneID:75351 MGI:1922601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 5 Proteins product : RIKEN cDNA 4930553J12 gene transcript_id : XM_484569.3

name	Krtap14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350453 GeneID:23927 MGI:1346079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 14 transcript_id : NM_013707.2

name	Krtap15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305212 GeneID:26560 MGI:1347350
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 15 transcript_id : NM_013713.1

name	Krtap16-9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865952 GeneID:170657 MGI:2157769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-9 transcript_id : NM_130876.3

name	Krtap16-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21357426 GeneID:170651 MGI:2157572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-1 transcript_id : NM_130870.1

name	Krtap16-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158705 GeneID:77918 MGI:1925168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-5 transcript_id : NM_130857.2

name	Krtap16-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426872 GeneID:170654 MGI:2157757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-4 transcript_id : NM_130873.1

name	Krtap8-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722126 GeneID:16704 MGI:1330295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 8-2 transcript_id : NM_010676.2

name	LOC100040191 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268138 GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cDNA sequence AY026312 transcript_id : XM_001474241.1

name	AY026312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801851 GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY026312 transcript_id : NM_133359.2

name	Krtap16-10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50080210 GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-10 transcript_id : NM_183296.1

name	EG621595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973040 GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG621595, transcript variant 3 transcript_id : XM_896462.1

name	1110032D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400724 GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : RIKEN cDNA 1110032D16 gene transcript_id : XM_897249.2

name	LOC100040201 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268140 GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins product : similar to glycine tyrosine-rich hair keratin protein transcript_id : XM_001474256.1

name	Krtap6-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374194 GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-1 transcript_id : NM_010672.3

name	LOC100040214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268142 GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins product : similar to keratin associated protein 6-1 transcript_id : XM_001474297.1

name	Krtap16-8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504469 GeneID:68484 MGI:1915734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-8 transcript_id : NM_130856.2

name	1110025L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268144 GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins product : RIKEN cDNA 1110025L11 gene transcript_id : XM_001474332.1

name	LOC100040249 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268146 GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474351.1

name	LOC100040267 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268148 GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MGC58416 protein transcript_id : XM_001474379.1

name	EG622794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268152 GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG622794 transcript_id : XM_897326.2

name	LOC100040281 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268154 GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474426.1

name	ENSMUSG00000044227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268150 GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, ENSMUSG00000044227 transcript_id : XM_001474147.1

name	EG665661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400725 GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG665661 transcript_id : XM_978513.1

name	LOC100040288 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268156 GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to MGC58416 protein transcript_id : XM_001474181.1

name	EG622935 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268158 GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG622935 transcript_id : XM_897414.2

name	EG622981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268160 GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG622981 transcript_id : XM_897445.2

name	EG622998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973291 GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG622998 transcript_id : XM_897455.1

name	EG623011 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973294 GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623011 transcript_id : XM_897466.1

name	EG623026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973298 GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623026 transcript_id : XM_897479.1

name	LOC100040346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268164 GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474233.1

name	EG623049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973304 GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623049 transcript_id : XM_897498.1

name	LOC100040415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268174 GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474343.1

name	EG640636 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268170 GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640636 transcript_id : XM_978919.2

name	LOC640652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268168 GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474284.1

name	LOC640654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268172 GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474324.1

name	N6amt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39540506 CCDS:CCDS28289.1 GeneID:67768 MGI:1915018
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : M-N6DNA MTase A; HemK methyltransferase family member 2 product : N6-DNA methyltransferase A protein_id : NP_080642.1

name	Zfp294 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486727 GeneID:78913 MGI:1926163
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 294 protein_id : NP_001074537.1

name	ORF5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360352 GeneID:53858 MGI:1858215
definition	codon_start : 1 product : hypothetical protein LOC53858 protein_id : NP_058620.2

name	LOC100040088 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268135 GeneID:100040088
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474111.1

name	Usp16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195676 CCDS:CCDS28291.1 GeneID:74112 MGI:1921362
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 16 protein_id : NP_077220.1

name	Cct8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723461 GeneID:12469 MGI:107183
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : chaperonin subunit 8 (theta) protein_id : NP_033970.3

name	B130034C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268118 GeneID:414095 MGI:3041186
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473357.1

name	ORF63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450069 CCDS:CCDS28292.1 GeneID:224419 MGI:2446584
definition	codon_start : 1 product : hypothetical protein LOC224419 protein_id : NP_659103.1

name	Bach1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680764 CCDS:CCDS28293.1 GeneID:12013 MGI:894680
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : BTB and CNC homology 1 protein_id : NP_031546.1

name	LOC100039901 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268121 GeneID:100039901
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473425.1

name	Grik1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83999995 GeneID:14805 MGI:95814
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005261 - cation channel activity [Evidence IMP]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0015277 - kainate selective glutamate receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IMP]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence TAS]; GO:0048172 - regulation of short-term neuronal synaptic plasticity [Evidence TAS]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 2 product : glutamate receptor, ionotropic, kainate 1 isoform b protein_id : NP_034478.1

name	Grik1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000015 GeneID:14805 MGI:95814
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005261 - cation channel activity [Evidence IMP]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0015277 - kainate selective glutamate receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IMP]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence TAS]; GO:0048172 - regulation of short-term neuronal synaptic plasticity [Evidence TAS]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1 product : glutamate receptor, ionotropic, kainate 1 isoform a protein_id : NP_666184.2

name	Cldn17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31377830 CCDS:CCDS28295.1 GeneID:239931 MGI:2652030
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 17 protein_id : NP_852467.1

name	Cldn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055192 CCDS:CCDS28296.1 GeneID:54420 MGI:1859286
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 8 protein_id : NP_061248.1

name	Gm312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400719 GeneID:239932 MGI:2685158
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982376.1

name	2310079G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769382 GeneID:69699 MGI:1916949
definition	codon_start : 1 product : hypothetical protein LOC69699 protein_id : XP_484566.1

name	2310002B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312310 CCDS:CCDS28298.1 GeneID:69533 MGI:1916783
definition	codon_start : 1 product : hypothetical protein LOC69533 protein_id : NP_081381.1

name	2310061N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268130 GeneID:69661 MGI:1916911
definition	codon_start : 1 product : hypothetical protein LOC69661 protein_id : XP_001473694.1

name	Krtap13-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147242 CCDS:CCDS28299.1 GeneID:268905 MGI:2146359
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 13-1 protein_id : NP_899012.1

name	Krtap13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754492 CCDS:CCDS28300.1 GeneID:16699 MGI:1330835
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 13 product : keratin associated protein 13 protein_id : NP_034801.1

name	2310034C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905137 GeneID:117172 MGI:2152338
definition	codon_start : 1 product : RIKEN cDNA 2310034C09 protein_id : NP_473441.1

name	2310057N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386208 CCDS:CCDS28302.1 GeneID:69696 MGI:1916946
definition	codon_start : 1 product : hypothetical protein LOC69696 protein_id : NP_081446.1

name	EG546672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973004 GeneID:546672 MGI:3645197
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_890735.1

name	4930553J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769388 GeneID:75351 MGI:1922601
definition	codon_start : 1 product : hypothetical protein LOC75351 protein_id : XP_484569.1

name	Krtap14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142350454 GeneID:23927 MGI:1346079
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 14 product : keratin associated protein 14 protein_id : NP_038735.2

name	Krtap15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305213 GeneID:26560 MGI:1347350
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 15 product : keratin associated protein 15 protein_id : NP_038741.1

name	Krtap16-9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865953 GeneID:170657 MGI:2157769
definition	codon_start : 1 product : keratin associated protein 16-9 protein_id : NP_570946.2

name	Krtap16-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21357427 CCDS:CCDS28304.1 GeneID:170651 MGI:2157572
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-1 protein_id : NP_570940.1

name	Krtap16-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426859 GeneID:77918 MGI:1925168
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-5 protein_id : NP_570927.1

name	Krtap16-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426873 GeneID:170654 MGI:2157757
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-4 protein_id : NP_570943.1

name	Krtap8-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722127 GeneID:16704 MGI:1330295
definition	codon_start : 1 note : keratin-associated protein 8.2; HGTpI alpha; keratin-associated protein 8-2 product : keratin associated protein 8-2 protein_id : NP_034806.2

name	LOC100040191 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268139 GeneID:100040191
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474291.1

name	AY026312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111168 GeneID:170939 MGI:2181750
definition	codon_start : 1 note : high-glycine/tyrosine protein type I E5 product : cDNA sequence AY026312 protein_id : NP_579937.1

name	Krtap16-10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080211 GeneID:71369 MGI:1918619
definition	codon_start : 1 product : keratin associated protein 16-10 protein_id : NP_899119.1

name	EG621595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973041 GeneID:621595 MGI:3644653
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_901555.1

name	1110032D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973182 GeneID:68740 MGI:1915990
definition	codon_start : 1 product : hypothetical protein LOC68740 protein_id : XP_902342.1

name	LOC100040201 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268141 GeneID:100040201
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474306.1

name	Krtap6-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754494 GeneID:16700 MGI:1330228
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.1 product : keratin associated protein 6-1 protein_id : NP_034802.1

name	LOC100040214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268143 GeneID:100040214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474347.1

name	Krtap16-8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536240 GeneID:68484 MGI:1915734
definition	codon_start : 1 product : keratin associated protein 16-8 protein_id : NP_570926.1

name	1110025L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268145 GeneID:68637 MGI:1915887
definition	codon_start : 1 product : RIKEN cDNA 1110025L11 protein_id : XP_001474382.1

name	LOC100040249 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268147 GeneID:100040249
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474401.1

name	LOC100040267 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268149 GeneID:100040267
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474429.1

name	EG622794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268153 GeneID:622794 MGI:3643237
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902419.2

name	LOC100040281 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268155 GeneID:100040281
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474476.1

name	ENSMUSG00000044227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268151 GeneID:640627 MGI:3642043
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474197.1

name	EG665661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400726 GeneID:665661 MGI:3649168
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983607.1

name	LOC100040288 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268157 GeneID:100040288
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474231.1

name	EG622935 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268159 GeneID:622935 MGI:3647747
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902507.2

name	EG622981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268161 GeneID:622981 MGI:3645349
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902538.2

name	EG622998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973292 GeneID:622998 MGI:3648365
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902548.1

name	EG623011 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973295 GeneID:623011 MGI:3643299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902559.1

name	EG623026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973299 GeneID:623026 MGI:3646232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902572.1

name	LOC100040346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268165 GeneID:100040346
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474283.1

name	EG623049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973305 GeneID:623049 MGI:3646961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902591.1

name	LOC100040415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268175 GeneID:100040415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474393.1

name	EG640636 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268171 GeneID:640636 MGI:3646423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984013.2

name	LOC640652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268169 GeneID:640652
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474334.1

name	LOC640654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268173 GeneID:640654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474374.1

name	LOC435486 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435486
definition	number : 1 pseudo : _no_value

name	EG622373 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622373
definition	number : 1 pseudo : _no_value

name	EG433047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433047
definition	number : 1

name	EG665513 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268126 GeneID:665513 MGI:3648908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins product : predicted gene, EG665513 pseudo : _no_value transcript_id : XR_002291.2

name	LOC100040167 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268137 GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_031579.1

clone name	MSMg01-350B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-477G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-349K04.b	B6Ng01-349K04.g
ACC	GA130567	GA130568
length	596	1,164
definition	B6Ng01-349K04.b	B6Ng01-349K04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(88,144,115 - 88,144,710)	(88,270,262 - 88,271,433)
sequence	gaattcccaaagcaggattggaagggtggatggataaaaagaaaacagac aatcaaaaaaacactcagggcacagggcttagcatccaaagatacccaga ggaagaaagaacacttgtaaaatggaaagttcctgatttgtgtttggtcc aatgttaggagttttcagatgtatcgttgaagtggtaaagagacaacaga tccttatgatagtataaacaatattaaggagtttgatgttatcctgcagt caatggtaggggaccatgaggggagagagaacatctcatgagtctcattt tggaatactgaagcagatgggacctgcatttagagtacccgatacatctg gtggtagtgtgaagtagaaccgctgatttaaaatcaagccacagaagttt gtgatggaatgatggtgggtaggtgagggaggaatgaaagatgactcctg tgcttggatggctggatagagtgtaggtgatccacaatggagaaattggg ccagtgatgcacaagtcgattgaactatcagacaatgatccaatgacctt gaaattcatattcctcatcaataaaaaagcaacatgtgccataagt	gaattccatgtgaacgaatttaactcgcacaacggatgagtcctttgtaa agtgagtagtattatgaatgagaggctttctgaaattttgtcagtctttg ccaaggatacccctcttgtatcaaaatgactacatgggatctatcaggga agcacatacgtactaggagagaatagagcagggtcagtaaagacaggtgg ccactgaagagtggacaggcctgagccttcatcgatgatttagacctttg accaaacatcttttgtttgatggtgtgtatgccatcagtgtccactatat atgtctagtagaaagaaatgaagctagttctttgattaaaattgccattc tatttaaccaccggctatattcccaagggattaaaatttaatccttctct ttgaagacatgggggaatgaaatagaatgttcttattgccctctgagtaa ctatgaacaaagagagcaaggtagtgaattcctggaggagaaaaatcaaa gacaaagatttctctttgcttaaatctctgttgattctgtgtctgttgta cctctggtcttgtctttcttcttgacccctcctacgatcaaaggacacat gaaggaaaggttcaagaagtttttcacagctttgttgatctttaccaact aagaaaatggaggcgctgggaagtccttattcatatgccctgtgaaaatc agtgccatccagtactgctacccttgctgaagggcagcttggctctgtca aggacagtataggtctagacaacctcatagtttataggaacaatagacat tttaggaatatggtcttacagaggagtcaaaaaacagtatctagcagtga gtgtaccccatgctggtaagcagataacaagatcttgagaacccactagt gacttatagaatgttgcctttgctcagttaaaaattatcacaaagaagga tcagaacatggttttagttttctcaattcagatgtaaagctctcatccag gcattctaatattaacacatacgtatggacatcattgagaattcatctat ctgttttcacatcactgaagcattcttattattataaggagcctggactg ttctgttcatggtgcagaggctaactttgacatcacttgtgcatattaca taagaaaaaccttt
quality values	Open. Hide. 58 38 31 38 62 62 62 41 33 62 62 62 62 47 62 62 37 31 62 62 62 62 62 62 62 47 44 62 62 59 43 59 38 24 43 36 32 28 45 40 40 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 62 62 59 62 62 54 49 43 54 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 47 46 56 56 59 62 62 62 56 62 62 59 43 46 43 46 45 40 45 59 59 30 51 34 30 22 10 21 24 30 18 13 20 11 16 17 25 18 17 17 12 13 13 11 25 19 24 31 62 38 56 32 56 56 38 56 51 44 31 29 23 27 11 22 20 27 22 32 62 33 32 35 28 21 16 15 20 21 24 27 39 56 51 51 42 33 12 17 10 5 13 23 30 21 31 39 38 24 39 30 27 20 20 37 51 51 51 14 17 13 21 14 10 9 9 4 10 10 14 15 24 30 23 20 23 14 14 9 10 10 9 9 13 21 22 20 24 14 14 15 14 11 13 10 13 10 19 27 13 17 9 20 23 16 9 12	Open. Hide. 56 59 43 47 62 59 59 39 62 62 59 56 46 43 38 23 34 36 50 48 54 50 56 56 62 59 49 51 51 59 56 59 59 54 54 59 59 62 62 50 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 56 59 59 59 62 62 59 54 54 62 62 54 54 54 62 62 62 54 54 62 62 62 54 62 62 62 56 62 62 62 49 42 62 62 59 59 62 62 62 62 62 62 62 59 62 62 56 62 59 62 56 62 62 62 59 59 59 56 59 62 59 59 62 59 59 59 62 48 56 62 54 59 59 62 62 56 62 62 62 56 54 62 62 62 62 62 62 59 59 62 54 54 62 59 62 59 62 59 62 59 62 51 62 59 54 54 62 51 62 59 59 54 56 62 62 62 59 56 62 59 56 56 56 62 62 54 62 59 59 59 59 56 62 59 62 62 59 62 62 59 62 62 59 62 62 59 62 59 59 62 59 62 59 56 62 59 59 62 59 62 62 62 62 54 62 62 59 62 62 62 62 62 56 62 62 51 59 56 56 54 62 62 62 59 48 62 62 62 62 62 62 62 59 62 62 59 59 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 47 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 49 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 47 42 62 62 62 62 62 62 62 62 62 62 58 45 58 58 58 58 58 58 58 58 58 58 58 58 54 41 58 58 58 58 54 58 58 58 58 58 51 58 58 52 54 54 58 58 58 58 58 49 52 58 53 58 54 58 54 58 58 58 54 58 54 58 58 58 58 54 54 58 58 58 58 58 58 54 52 58 52 48 52 54 54 58 58 58 58 58 46 53 58 54 58 58 58 58 50 58 58 58 58 44 45 39 51 54 48 49 58 58 48 50 58 58 58 58 49 54 37 50 50 42 58 58 49 49 54 58 58 44 49 50 50 58 58 38 46 50 49 37 54 50 53 46 58 32 58 58 43 49 51 58 54 58 48 49 41 50 58 46 51 58 58 43 44 50 52 53 58 52 51 47 35 50 41 29 50 53 47 49 50 58 50 50 58 40 44 32 51 51 36 38 52 42 40 44 50 39 49 29 52 51 51 36 37 34 40 42 39 43 43 50 33 28 33 38 39 52 41 38 52 37 52 39 18 49 39 37 53 32 39 54 32 51 52 39 53 42 52 47 37 49 29 33 35 51 35 29 42 40 29 21 33 34 17 20 21 51 37 40 34 37 31 41 33 41 46 42 45 33 45 37 29 43 54 32 19 19 35 25 28 36 40 42 24 49 37 37 31 52 32 29 18 49 49 27 35 34 31 25 45 32 30 32 30 32 27 41 32 25 25 36 22 18 36 10 46 31 14 32 39 40 51 49 52 49 21 29 32 28 31 33 26 31 36 36 31 30 30 26 31 38 37 28 23 40 21 26 24 51 46 46 28 27 31 34 36 31 33 29 45 30 19 30 33 27 30 29 16 26 27 13 33 28 26 24 36 31 43 38 36 22 31 27 36 48 29 25 32 32 32 31 30 36 31 31 34 37 31 32 37 15 33 31 23 42 18 23 25 19 28 16 46 31 32 32 32 31 20 7 27 22 36 48 48 46 37 32 31 27 31 32 11 7 10 46 37 17 30 25 24 19 31 21 32 24 29 33 28 19 26 33 21 24 8 37 48 31 29 22 31 48 44 34 23 20 38 27 32 10 22 31 44 14 21 18 23 36 11 43 27 27 25 27 31 31 31 18 19 17 23 21 16 18 29 14 25 17 17 23 7 6 8 11 27 26 24 22 9 5 4 6 21 32 34 22 21 23 24 23 23 21 27 21 16 30 7 6 33 27 27 7 10 17 10 25 28 18 22 14 8 7 8 12 4 7 5 5 7 15 16 12 24 20 29 20 20 27 19 10 13 11 6 7 13 28 22 19 11 11 15 24 14 6 13 27 10 6 5 8 3 4 9 5 12 11 11 19 10 3 5 5 2 4 11 10 4 7 9 14 8 13 12 8 4 10 6 17 4 1 2 5 14 16 23 7 13 11 3 9 6 6 6 4 7 7 5 8 23 6 7 2 1 2 2 1 1 3 5 25 8 21 4 3 3 7 5 22 28 28 25 12 2 2 5 13 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_88144115_88144710
seq2: B6Ng01-349K04.b_52_647

seq1  GAATTCCCAAAGCAGGATTGGAAGGGTGGATGGATAAAAAGAAAACAGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAAAGCAGGATTGGAAGGGTGGATGGATAAAAAGAAAACAGAC  50

seq1  AATCAAAAAAACACTCAGGGCACAGGGCTTAGCATCCAAAGATACCCAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAAAAAAACACTCAGGGCACAGGGCTTAGCATCCAAAGATACCCAGA  100

seq1  GGAAGAAAGAACACTTGTAAAATGGAAAGTTCCTGATTTGTGTTTGGTCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAAAGAACACTTGTAAAATGGAAAGTTCCTGATTTGTGTTTGGTCC  150

seq1  AATGTTAGGAGTTTTCAGATGTATCGTTGAAGTGGTAAAGAGACAACAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTTAGGAGTTTTCAGATGTATCGTTGAAGTGGTAAAGAGACAACAGA  200

seq1  TCCTTATGATAGTATAAACAATATTAAGGAGTTTGATGTTATCCTGCAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTATGATAGTATAAACAATATTAAGGAGTTTGATGTTATCCTGCAGT  250

seq1  CAATGGTAGGGGACCATGAGGGGAGAGAGAACATCTCATGAGTCTCATTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGGTAGGGGACCATGAGGGGAGAGAGAACATCTCATGAGTCTCATTT  300

seq1  TGGAATACTGAAGCAGATGGGACCTGCATTTAGAGTACCCGATACATCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATACTGAAGCAGATGGGACCTGCATTTAGAGTACCCGATACATCTG  350

seq1  GTGGTAGTGTGAAGTAGAACCGCTGATTTAAAATCAAGCCACAGAAGTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTAGTGTGAAGTAGAACCGCTGATTTAAAATCAAGCCACAGAAGTTT  400

seq1  GTGATGGAATGATGGTGGGTAGGTGAGGGAGGAATGAAAGATGACTCCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATGGAATGATGGTGGGTAGGTGAGGGAGGAATGAAAGATGACTCCTG  450

seq1  TGCTTGGATGGCTGGATAGAGTGTAGGTGATCCACAATGGAGAAATTGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTGGATGGCTGGATAGAGTGTAGGTGATCCACAATGGAGAAATTGGG  500

seq1  CCAGTGATGCACAAGTCGATTGAACTATCAGACAATGATCCAATGACCTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGATGCACAAGTCGATTGAACTATCAGACAATGATCCAATGACCTT  550

seq1  GAAATTCATATTCCTCATCAATAAAAAAGCAACAAGTGCCATAAGT  596
      |||||||||||||||||||||||||||||||||| |||||||||||
seq2  GAAATTCATATTCCTCATCAATAAAAAAGCAACATGTGCCATAAGT  596

seq1: chr16_88270262_88271433
seq2: B6Ng01-349K04.g_68_1231 (reverse)

seq1  AAAGGTTTTTTTCTTAATGGTAATATGGCACCAGTGATGTCAAGGTTAGC  50
      |||||  |||||||||   ||||||| |||| ||||||||||| ||||||
seq2  AAAGG--TTTTTCTTA--TGTAATAT-GCACAAGTGATGTCAAAGTTAGC  45

seq1  CTCTGCA-CATGAACAGAACACGTCCAGGCTCCTTATAATAATAAGAATG  99
      ||||||| ||||||||||||| ||||||||||||||||||||||||||||
seq2  CTCTGCACCATGAACAGAACA-GTCCAGGCTCCTTATAATAATAAGAATG  94

seq1  CCTTCAGTGATGTGAATACAGATAGATGAA-TCTCAATGATGTCCATACG  148
       ||||||||||||||| ||||||||||||| |||||||||||||||||||
seq2  -CTTCAGTGATGTGAAAACAGATAGATGAATTCTCAATGATGTCCATACG  143

seq1  TATGTGTTAATATAAGAATGCCTGGATGAGAGCTTTAACATCTTGAATTT  198
      ||||||||||||| |||||||||||||||||||||| ||||| |||| ||
seq2  TATGTGTTAATATTAGAATGCCTGGATGAGAGCTTT-ACATC-TGAA-TT  190

seq1  GAGAAAACTAAAACCATGTTCTGATCCTTCTTTGTGATAATTTTTAACTG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAACTAAAACCATGTTCTGATCCTTCTTTGTGATAATTTTTAACTG  240

seq1  AGCAAAGGCAACATTCTATAAGTCACTAGTGGGTTCTCAAGATCTTGTTA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAAGGCAACATTCTATAAGTCACTAGTGGGTTCTCAAGATCTTGTTA  290

seq1  TCTGCTTACCAGCATGGGGTACACTCACTGCTAGATACTGTTTTTTGACT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCTTACCAGCATGGGGTACACTCACTGCTAGATACTGTTTTTTGACT  340

seq1  CCTCTGTAAGACCATATTCCTAAAATGTCTATTGTTCCTATAAACTATGA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGTAAGACCATATTCCTAAAATGTCTATTGTTCCTATAAACTATGA  390

seq1  GGTTGTCTAGACCTATACTGTCCTTGACAGAGCCAAGCTGCCCTTCAGCA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGTCTAGACCTATACTGTCCTTGACAGAGCCAAGCTGCCCTTCAGCA  440

seq1  AGGGTAGCAGTACTGGATGGCACTGATTTTCACAGGGCATATGAATAAGG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTAGCAGTACTGGATGGCACTGATTTTCACAGGGCATATGAATAAGG  490

seq1  ACTTCCCAGCGCCTCCATTTTCTTAGTTGGTAAAGATCAACAAAGCTGTG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCCCAGCGCCTCCATTTTCTTAGTTGGTAAAGATCAACAAAGCTGTG  540

seq1  AAAAACTTCTTGAACCTTTCCTTCATGTGTCCTTTGATCGTAGGAGGGGT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACTTCTTGAACCTTTCCTTCATGTGTCCTTTGATCGTAGGAGGGGT  590

seq1  CAAGAAGAAAGACAAGACCAGAGGTACAACAGACACAGAATCAACAGAGA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAAGAAAGACAAGACCAGAGGTACAACAGACACAGAATCAACAGAGA  640

seq1  TTTAAGCAAAGAGAAATCTTTGTCTTTGATTTTTCTCCTCCAGGAATTCA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGCAAAGAGAAATCTTTGTCTTTGATTTTTCTCCTCCAGGAATTCA  690

seq1  CTACCTTGCTCTCTTTGTTCATAGTTACTCAGAGGGCAATAAGAACATTC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCTTGCTCTCTTTGTTCATAGTTACTCAGAGGGCAATAAGAACATTC  740

seq1  TATTTCATTCCCCCATGTCTTCAAAGAGAAGGATTAAATTTTAATCCCTT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTCATTCCCCCATGTCTTCAAAGAGAAGGATTAAATTTTAATCCCTT  790

seq1  GGGAATATAGCCGGTGGTTAAATAGAATGGCAATTTTAATCAAAGAACTA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAATATAGCCGGTGGTTAAATAGAATGGCAATTTTAATCAAAGAACTA  840

seq1  GCTTCATTTCTTTCTACTAGACATATATAGTGGACACTGATGGCATACAC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCATTTCTTTCTACTAGACATATATAGTGGACACTGATGGCATACAC  890

seq1  ACCATCAAACAAAAGATGTTTGGTCAAAGGTCTAAATCATCGATGAAGGC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATCAAACAAAAGATGTTTGGTCAAAGGTCTAAATCATCGATGAAGGC  940

seq1  TCAGGCCTGTCCACTCTTCAGTGGCCACCTGTCTTTACTGACCCTGCTCT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGCCTGTCCACTCTTCAGTGGCCACCTGTCTTTACTGACCCTGCTCT  990

seq1  ATTCTCTCCTAGTACGTATGTGCTTCCCTGATAGATCCCATGTAGTCATT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTCTCCTAGTACGTATGTGCTTCCCTGATAGATCCCATGTAGTCATT  1040

seq1  TTGATACAAGAGGGGTATCCTTGGCAAAGACTGACAAAATTTCAGAAAGC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATACAAGAGGGGTATCCTTGGCAAAGACTGACAAAATTTCAGAAAGC  1090

seq1  CTCTCATTCATAATACTACTCACTTTACAAAGGACTCATCCGTTGTGCGA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCATTCATAATACTACTCACTTTACAAAGGACTCATCCGTTGTGCGA  1140

seq1  GTTAAATTCGTTCACATGGAATTC  1172
      ||||||||||||||||||||||||
seq2  GTTAAATTCGTTCACATGGAATTC  1164

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information