MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-078F22
Chromosome	16 (Build37)
Map Location	20,401,191 - 20,401,485
singlet/doublet	singlet
Overlap gene	Abcc5
Upstream gene	Olfr165, Olfr166, Olfr167, Olfr168, Olfr169, Olfr170, Olfr171, LOC100043444, Lamp3, B3gnt5, LOC100042935, A930003A15Rik, Klhl6, LOC100042938, Klhl24, Yeats2, LOC100043459, Map6d1, Parl, EG224044
Downstream gene	Eif2b5, Dvl3, Ap2m1, LOC100042948, Abcf3, BC052055, EG328644, Alg3, 1810009K13Rik, Camk2n2, Ece2, Psmd2, LOC100043475, Eif4g1, 2900046G09Rik, Clcn2, Polr2h, Thpo, Chrd, LOC666255, LOC671504, EG666274, EG625060, LOC625123, LOC676915, 2310042E22Rik, Ephb3, 6430590I03Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258458 MGI:3029999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259071 MGI:3030000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258937 MGI:3030001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258354 MGI:3030002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258158 MGI:3030003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258959 MGI:3030004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr171 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258960 MGI:3030005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 11 Proteins pseudo : _no_value

name	Lamp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239739 MGI:2441659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108105 MGI:2137302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042935 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	A930003A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68162 MGI:1915412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 29 ESTs

name	Klhl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239743 MGI:2686922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs

name	Klhl24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75785 MGI:1923035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yeats2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208146 MGI:2447762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 731 ESTs, 7 Proteins

name	Map6d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208158 MGI:3607784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381038 MGI:1277152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG224044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224044 MGI:3644957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27416 MGI:1351644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eif2b5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224045 MGI:2446176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dvl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13544 MGI:108100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap2m1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11773 MGI:1298405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Abcf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27406 MGI:1351656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328643 MGI:2681859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG328644 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328644 MGI:3646631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208624 MGI:1098592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810009K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66275 MGI:1913525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk2n2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73047 MGI:1920297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 4 Proteins

name	Ece2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107522 MGI:1101356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21762 MGI:1096584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043475 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 11 Proteins pseudo : _no_value

name	Eif4g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208643 MGI:2384784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2900046G09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78408 MGI:1925658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12724 MGI:105061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245841 MGI:2384309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21832 MGI:101875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12667 MGI:1313268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666255 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	LOC671504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG666274 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666274 MGI:3645627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1279 ESTs, 8 Proteins

name	EG625060 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625060 MGI:3644103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 8 ESTs, 8 Proteins

name	LOC625123 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC676915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	2310042E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66561 MGI:1913811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ephb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13845 MGI:104770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430590I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76222 MGI:1923472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins

name	Olfr165 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238891 GeneID:258458 MGI:3029999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 165 transcript_id : NM_146466.1

name	Olfr166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128824 GeneID:259071 MGI:3030000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 166 transcript_id : NM_147068.1

name	Olfr167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129036 GeneID:258937 MGI:3030001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 167 transcript_id : NM_146935.1

name	Olfr168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129588 GeneID:258354 MGI:3030002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 168 transcript_id : NM_146357.1

name	Olfr169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801467 GeneID:258158 MGI:3030003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 169 transcript_id : NM_001011855.1

name	Olfr170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129010 GeneID:258959 MGI:3030004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 170 transcript_id : NM_146957.1

name	Olfr171 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129004 GeneID:258960 MGI:3030005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 171 transcript_id : NM_146958.1

name	Lamp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601014 GeneID:239739 MGI:2441659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 3 transcript_id : NM_177356.3

name	B3gnt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542176 GeneID:108105 MGI:2137302
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 transcript_id : NM_054052.2

name	LOC100042935 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267290 GeneID:100042935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : similar to hCG2028724 transcript_id : XM_001479103.1

name	Klhl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34419627 GeneID:239743 MGI:2686922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 6 (Drosophila) transcript_id : NM_183390.1

name	LOC100042938 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267293 GeneID:100042938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : hypothetical protein LOC100042938 transcript_id : XM_001479111.1

name	Klhl24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46447824 GeneID:75785 MGI:1923035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 24 (Drosophila) transcript_id : NM_029436.3

name	Yeats2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794612 GeneID:208146 MGI:2447762
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YEATS domain containing 2 transcript_id : NM_001033237.1

name	LOC100043459 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267451 GeneID:100043459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 731 ESTs, 6 Proteins product : similar to SMT3B protein, transcript variant 1 transcript_id : XM_001480731.1

name	LOC100043459 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267454 GeneID:100043459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 357 ESTs, 2 Proteins product : similar to SMT3B protein, transcript variant 2 transcript_id : XM_001480733.1

name	Map6d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948799 GeneID:208158 MGI:3607784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP6 domain containing 1 transcript_id : NM_198599.2

name	Parl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379687 GeneID:381038 MGI:1277152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : presenilin associated, rhomboid-like transcript_id : NM_001005767.2

name	EG224044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353947 GeneID:224044 MGI:3644957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG224044 transcript_id : NM_183158.2

name	Abcc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932953 GeneID:27416 MGI:1351644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 5 transcript_id : NM_013790.2

name	Abcc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932955 GeneID:27416 MGI:1351644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 5 transcript_id : NM_176839.1

name	Eif2b5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986556 GeneID:224045 MGI:2446176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2B, subunit 5 epsilon transcript_id : NM_172265.1

name	Dvl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168286 GeneID:13544 MGI:108100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dishevelled 3, dsh homolog (Drosophila) transcript_id : NM_007889.2

name	Ap2m1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892644 GeneID:11773 MGI:1298405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, mu1 transcript_id : NM_009679.2

name	Abcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490362 GeneID:27406 MGI:1351656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family F (GCN20), member 3 transcript_id : NM_013852.2

name	BC052055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351230 GeneID:328643 MGI:2681859
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052055 transcript_id : NM_182636.3

name	EG328644 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348499 GeneID:328644 MGI:3646631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG328644 transcript_id : NM_198629.1

name	Alg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122364 GeneID:208624 MGI:1098592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase) transcript_id : NM_145939.1

name	1810009K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953155 GeneID:66275 MGI:1913525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009K13 gene transcript_id : NM_025462.2

name	Camk2n2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400097 GeneID:73047 MGI:1920297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 4 Proteins product : calcium/calmodulin-dependent protein kinase II inhibitor 2 transcript_id : XM_990809.1

name	Ece2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314839 GeneID:107522 MGI:1101356
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelin converting enzyme 2 transcript_id : NM_139293.1

name	Psmd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19882200 GeneID:21762 MGI:1096584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 transcript_id : NM_134101.1

name	Eif4g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699431 GeneID:208643 MGI:2384784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4, gamma 1 transcript_id : NM_145941.2

name	Eif4g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699433 GeneID:208643 MGI:2384784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4, gamma 1 transcript_id : NM_001005331.1

name	2900046G09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345536 GeneID:78408 MGI:1925658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900046G09 gene transcript_id : NM_133778.2

name	Clcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753431 GeneID:12724 MGI:105061
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 2 transcript_id : NM_009900.1

name	Polr2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892587 GeneID:245841 MGI:2384309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide H transcript_id : NM_145632.2

name	Thpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364337 GeneID:21832 MGI:101875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thrombopoietin transcript_id : NM_009379.3

name	Chrd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753417 GeneID:12667 MGI:1313268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chordin transcript_id : NM_009893.1

name	EG666274 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267468 GeneID:666274 MGI:3645627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1279 ESTs, 8 Proteins product : predicted gene, EG666274 transcript_id : XM_982692.2

name	EG625060 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400114 GeneID:625060 MGI:3644103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 8 ESTs, 8 Proteins product : predicted gene, EG625060 transcript_id : XM_889601.2

name	LOC625123 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267470 GeneID:625123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : hypothetical LOC625123 transcript_id : XM_889664.2

name	2310042E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803385 GeneID:66561 MGI:1913811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310042E22 gene transcript_id : NM_025634.2

name	Ephb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859547 GeneID:13845 MGI:104770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B3 transcript_id : NM_010143.1

name	Olfr165 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238892 CCDS:CCDS28033.1 GeneID:258458 MGI:3029999
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15855164-15854223; olfactory receptor MOR279-1 product : olfactory receptor 165 protein_id : NP_666677.1

name	Olfr166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128825 CCDS:CCDS28034.1 GeneID:259071 MGI:3030000
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15934912-15935850; olfactory receptor MOR270-1 product : olfactory receptor 166 protein_id : NP_667279.1

name	Olfr167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129037 CCDS:CCDS28035.1 GeneID:258937 MGI:3030001
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15963726-15962788; olfactory receptor MOR272-1 product : olfactory receptor 167 protein_id : NP_667146.1

name	Olfr168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129589 CCDS:CCDS28036.1 GeneID:258354 MGI:3030002
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15979009-15978071; olfactory receptor MOR271-1 product : olfactory receptor 168 protein_id : NP_666469.1

name	Olfr169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801468 CCDS:CCDS28037.1 GeneID:258158 MGI:3030003
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-16014972-16014031; olfactory receptor MOR273-3P product : olfactory receptor 169 protein_id : NP_001011855.1

name	Olfr170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129011 CCDS:CCDS28038.1 GeneID:258959 MGI:3030004
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-16052703-16051765; olfactory receptor MOR273-2 product : olfactory receptor 170 protein_id : NP_667168.1

name	Olfr171 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129005 CCDS:CCDS28039.1 GeneID:258960 MGI:3030005
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x54KRFPKG5P-16071018-16070077; olfactory receptor MOR273-1 product : olfactory receptor 171 protein_id : NP_667169.1

name	Lamp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601015 GeneID:239739 MGI:2441659
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005765 - lysosomal membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : dendritic cells-lysosome associated membrane glycoprotein product : lysosomal-associated membrane protein 3 protein_id : NP_796330.2

name	B3gnt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542177 CCDS:CCDS28040.1 GeneID:108105 MGI:2137302
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0008457 - beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl- ceramide beta-1,3-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008917 - lipopolysaccharide N-acetylglucosaminyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0007417 - central nervous system development [Evidence ISS]; GO:0009247 - glycolipid biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence ISS]; GO:0030148 - sphingolipid biosynthesis [Evidence TAS] codon_start : 1 product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 protein_id : NP_473393.2

name	LOC100042935 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267291 GeneID:100042935
definition	codon_start : 1 product : similar to hCG2028724 protein_id : XP_001479153.1

name	Klhl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34419628 CCDS:CCDS28041.1 GeneID:239743 MGI:2686922
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : kelch-like 6 protein_id : NP_899246.1

name	LOC100042938 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267294 GeneID:100042938
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479161.1

name	Klhl24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46447825 CCDS:CCDS28042.1 GeneID:75785 MGI:1923035
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 24 protein_id : NP_083712.4

name	Yeats2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794613 CCDS:CCDS28043.1 GeneID:208146 MGI:2447762
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : YEATS domain containing 2 protein_id : NP_001028409.1

name	LOC100043459 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267455 GeneID:100043459
definition	codon_start : 1 product : similar to SMT3B protein isoform 2 protein_id : XP_001480783.1

name	LOC100043459 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267452 GeneID:100043459
definition	codon_start : 1 product : similar to SMT3B protein isoform 1 protein_id : XP_001480781.1

name	Map6d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948800 GeneID:208158 MGI:3607784
definition	codon_start : 1 product : MAP6 domain containing 1 protein_id : NP_941001.2

name	Parl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261813 CCDS:CCDS28044.1 GeneID:381038 MGI:1277152
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : presenilin associated, rhomboid-like protein_id : NP_001005767.1

name	EG224044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147185 GeneID:224044 MGI:3644957
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC224044 protein_id : NP_898981.1

name	Abcc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66932954 CCDS:CCDS28045.1 GeneID:27416 MGI:1351644
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ATP-binding cassette, sub-family C (CFTR/MRP), member 5a; ATP-binding cassette, sub-family C (CFTR/MRP), member 5b product : ATP-binding cassette, sub-family C, member 5 isoform 1 protein_id : NP_038818.2

name	Abcc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66932956 CCDS:CCDS28046.1 GeneID:27416 MGI:1351644
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ATP-binding cassette, sub-family C (CFTR/MRP), member 5a; ATP-binding cassette, sub-family C (CFTR/MRP), member 5b product : ATP-binding cassette, sub-family C, member 5 isoform 2 protein_id : NP_789809.1

name	Eif2b5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986557 CCDS:CCDS28047.1 GeneID:224045 MGI:2446176
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005851 - eukaryotic translation initiation factor 2B complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045948 - positive regulation of translational initiation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 2B, subunit 5 epsilon protein_id : NP_758469.1

name	Dvl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168287 GeneID:13544 MGI:108100
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : dishevelled 3 protein_id : NP_031915.2

name	Ap2m1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753074 CCDS:CCDS28048.1 GeneID:11773 MGI:1298405
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : adaptor-related protein complex AP-2, mu1; clathrin-associated AP-2 product : adaptor protein complex AP-2, mu1 protein_id : NP_033809.1

name	Abcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789050 CCDS:CCDS28049.1 GeneID:27406 MGI:1351656
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family F (GCN20), member 3 protein_id : NP_038880.1

name	BC052055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922584 GeneID:328643 MGI:2681859
definition	codon_start : 1 product : hypothetical protein LOC328643 protein_id : NP_872574.2

name	EG328644 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348500 CCDS:CCDS28050.1 GeneID:328644 MGI:3646631
definition	codon_start : 1 product : hypothetical protein LOC328644 protein_id : NP_941031.1

name	Alg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122365 GeneID:208624 MGI:1098592
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000030 - mannosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation product : alpha-1,3-mannosyltransferase ALG3 protein_id : NP_666051.1

name	1810009K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953156 GeneID:66275 MGI:1913525
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66275 protein_id : NP_079738.2

name	Camk2n2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400098 GeneID:73047 MGI:1920297
definition	codon_start : 1 product : calcium/calmodulin-dependent protein kinase II inhibitor 2 protein_id : XP_995903.1

name	Ece2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314840 CCDS:CCDS28052.1 GeneID:107522 MGI:1101356
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence ISS]; GO:0005802 - Golgi trans face [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016511 - endothelin-converting enzyme activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence ISS] [Evidence IMP]; GO:0010002 - cardioblast differentiation [Evidence ISS] [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence ISS]; GO:0009790 - embryonic development [Evidence ISS]; GO:0007507 - heart development [Evidence ISS] [Evidence IMP]; GO:0016486 - peptide hormone processing [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0042310 - vasoconstriction [Evidence ISS] codon_start : 1 exception : mismatches in translation product : endothelin converting enzyme 2 protein_id : NP_647454.1

name	Psmd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882201 CCDS:CCDS28053.1 GeneID:21762 MGI:1096584
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : testis expressed gene 190 product : proteasome 26S non-ATPase subunit 2 protein_id : NP_598862.1

name	Eif4g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699432 CCDS:CCDS28055.1 GeneID:208643 MGI:2384784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : eukaryotic translation initiation factor 4, gamma 1 isoform a protein_id : NP_666053.2

name	Eif4g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699434 CCDS:CCDS28054.1 GeneID:208643 MGI:2384784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : eukaryotic translation initiation factor 4, gamma 1 isoform b protein_id : NP_001005331.1

name	2900046G09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789331 CCDS:CCDS28056.1 GeneID:78408 MGI:1925658
definition	codon_start : 1 product : hypothetical protein LOC78408 protein_id : NP_598539.1

name	Clcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753432 CCDS:CCDS28057.1 GeneID:12724 MGI:105061
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : chloride channel 2 protein_id : NP_034030.1

name	Polr2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704118 CCDS:CCDS28058.1 GeneID:245841 MGI:2384309
definition	GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide H protein_id : NP_663607.1

name	Thpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678341 GeneID:21832 MGI:101875
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0030099 - myeloid cell differentiation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : myeloproliferative leukemia virus oncogene ligand product : thrombopoietin protein_id : NP_033405.1

name	Chrd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753418 CCDS:CCDS28059.1 GeneID:12667 MGI:1313268
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0045545 - syndecan binding [Evidence IDA] GO_process : GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence IDA]; GO:0001649 - osteoblast differentiation [Evidence IDA]; GO:0007389 - pattern specification [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : chordin protein_id : NP_034023.1

name	EG666274 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400113 GeneID:666274 MGI:3645627
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987786.1

name	EG625060 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959136 GeneID:625060 MGI:3644103
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894694.1

name	LOC625123 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82959144 GeneID:625123
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894757.1

name	2310042E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385096 GeneID:66561 MGI:1913811
definition	codon_start : 1 product : hypothetical protein LOC66561 protein_id : NP_079910.1

name	Ephb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859548 CCDS:CCDS28060.1 GeneID:13845 MGI:104770
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008046 - axon guidance receptor activity [Evidence IDA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005005 - transmembrane-ephrin receptor activity [Evidence TAS] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : Eph receptor B3 protein_id : NP_034273.1

name	LOC100042948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042948
definition	number : 2 pseudo : _no_value

name	LOC100042948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042948
definition	number : 1 pseudo : _no_value

name	LOC671504 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671504
definition	number : 1 pseudo : _no_value

name	LOC671504 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671504
definition	number : 2 pseudo : _no_value

name	LOC100043444 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267446 GeneID:100043444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 11 Proteins product : similar to peptidylprolyl isomerase D pseudo : _no_value transcript_id : XR_034814.1

name	A930003A15Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267459 GeneID:68162 MGI:1915412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 29 ESTs product : RIKEN cDNA A930003A15 gene transcript_id : XR_035452.1

name	LOC100043475 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267461 GeneID:100043475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 11 Proteins product : similar to eukaryotic translation elongation factor 1 gamma pseudo : _no_value transcript_id : XR_034831.1

name	LOC666255 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267467 GeneID:666255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : similar to hCG1641837 pseudo : _no_value transcript_id : XR_034839.1

name	LOC676915 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267298 GeneID:676915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to nuclear domain 10 protein 52 like 1 pseudo : _no_value transcript_id : XR_034101.1

name	6430590I03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94400115 GeneID:76222 MGI:1923472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 2 Proteins product : RIKEN cDNA 6430590I03 gene transcript_id : XR_002321.1

clone name	MSMg01-129D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-146H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-436C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-400A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-078F22.T7 (MSMg01no078_f22.b1)	MSMg01-078F22.TJ (MSMg01no078_f22.g1)
ACC	AG299722	AG299723
length	720	683
length of high quality (start - end)	---	305 (73 - 377)
definition	CHROMAT_FILE: MSMg01no078_f22.b1 PHD_FILE: MSMg01no078_f22.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:26:40 2005	CHROMAT_FILE: MSMg01no078_f22.g1 PHD_FILE: MSMg01no078_f22.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:26:40 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	ATTTGGGGCNNCCCCNNNNNNNNNCNNCCCNNCCCCCCNNNNCCCNNCNN NCCCCNCCCCCNCNCCCCCCCCCCNCCCNNNCACCNNNNAACAACNCNCA CCCNNCNNCNCCCCCCCCNNNNNCCNNNNNNNNNCNNNNCCNNNNNTAAC NNNANAANNCCCCCCCCCNNCCCCNCNCNNCCNCNNNNNCCCNNCCCNNN NNNNGGGGGGGGGGGCCCNCACCCCCACANCNACCCCCCCCTNNNCANCA ATCCCCCCCCCCCCCAACAANNNNNCCCCTCCCCCCCTNAAAAAAATAAA AAAAATTTTTTGGGGTCCCGGGNGGGGNCCCCCCGGGGCCCCCCCTTTTA AAAAAAAAATTAAACCCGGGAAAAAAAACCCTTTTTCCCCCAAACCCCNN NNAAAAAATTCTCCCCTTCCGGCCCCGAAAAAAAAAAGAAGAAGAGGGGG GAAAATTGCCCCCCCGGCCGGGCCCGGGGGGGGCCCACCAAAAATTTTCC CCCCGTGGGGGCCCCTTTTCCCCTTTTAAACCCCCCCACCAGGGGGGTTT AGTNGGGGGCCCCAATTCCCCCGGGTTGAAGGGGCCGGANACCCCCGTGG GTGGGGCANAAAAAAGGGTTTTTTTAGAAAAGGAGGGAGGGAGCGCCCTA CAGCGGGTGCCGGAGCACAAATCTCTCTCCCCCAGGAGTAGGAGAACACA NCCCCGCGTGCGCCGCGGTG	NCCATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXCTTACTGAAGGAACCAGGGTAGATGGGT GCGTGAGTTTAATTTCTTTTTTCCTTTAAGGTGGGCACTGGTTTAGCTTT CTTTTGTTATGGTTTGCTTTGATTTTTGCCAACCTCAATTTTAGCTACCA GGACTCGAAAAGACTCCGAAGGATGCCAGCATCCTGCCCAGCAGGCCTAG AATCTCGCAGTCTGTCGGGAGCAGAGTGTTTCCTCGCAGCTTAGCGTGCC AACAGCACTTGCAGTTTTAAGCAGGGTACCTCTTTAGGGAAATTTTAGTT GTTGTTTTTTTTTTTCCTCCCCCCCCTTAATCTTCTTTCTTCATCAGTAA GGTTTCTATTGCTCCCCCCCCTACTTCGTTGCCGCTCTGACATCCCCTCC CTGGTGATAGCTGCCTTCCCTGATGCCTTGTACCCCACACTCCTGTAAGC CTACATGGCTCTGCCTAGGCATTTTCTCTAATGCGCACACGCTACAGTGT CTTATCTCCTCATCTGTGTCTCTGTTTTCACCTACCGCTTCTCTCCATTC CTTATCTTTCTTGTCCTCTCGTCCCTGCTTTCGCTACTACCTTAGTCAAC TGCTACCGTTCTCTCCCTCTTTCTTCTATATCA
quality values	Open. Hide. 6 6 7 6 8 6 8 8 3 0 0 3 8 8 3 0 0 0 0 0 0 0 0 0 3 0 0 3 6 3 0 0 3 17 8 7 7 3 0 0 0 0 3 8 3 0 0 3 0 0 0 3 17 11 3 0 3 8 10 10 3 0 3 0 3 7 7 9 9 9 9 7 7 3 0 3 7 3 0 0 0 3 6 6 3 0 0 0 0 3 6 6 6 6 3 0 3 0 3 8 10 11 3 0 0 3 0 0 3 0 3 8 13 19 18 10 10 3 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 3 0 0 0 0 3 3 0 0 0 0 0 3 8 8 3 0 0 0 3 0 3 3 0 0 3 11 11 24 24 25 21 29 3 0 0 3 7 7 3 0 3 0 3 0 0 3 3 0 3 0 0 0 0 0 3 27 3 0 0 3 17 3 0 0 0 0 0 0 0 3 6 6 6 9 19 12 12 9 9 9 7 14 3 0 3 6 6 8 8 12 12 11 12 3 0 3 0 3 8 8 10 19 20 22 19 17 3 0 0 0 3 3 0 3 8 6 6 8 8 9 19 21 30 21 21 9 22 19 19 10 7 6 6 7 3 0 0 0 0 0 3 8 8 7 7 7 12 14 17 14 12 10 3 0 3 12 12 21 17 9 7 7 6 17 19 25 22 22 21 13 14 14 20 19 19 9 9 10 10 9 9 9 12 10 10 10 3 0 3 17 11 3 0 3 8 9 8 8 8 8 9 9 10 15 19 29 19 21 21 24 24 21 21 12 12 10 15 23 23 22 22 13 8 10 10 10 10 10 12 11 11 13 11 11 11 9 9 11 16 21 10 10 8 8 7 11 9 12 11 11 10 9 11 10 9 9 9 11 10 10 8 8 3 0 0 0 0 3 18 18 23 18 11 8 7 7 7 8 12 12 6 6 6 6 7 7 9 9 14 10 9 9 9 10 13 21 16 11 24 8 8 6 7 7 7 6 6 6 6 8 12 18 19 14 8 8 8 8 8 8 8 8 11 13 18 32 37 21 15 8 8 6 8 8 10 15 10 10 9 9 8 8 9 9 11 10 15 9 11 12 12 6 6 6 6 7 7 9 11 11 10 14 10 17 18 24 16 8 8 7 7 7 9 11 19 15 15 11 19 16 16 16 12 12 14 12 14 14 12 15 8 10 8 8 8 8 8 8 9 8 8 7 7 7 8 8 8 12 13 17 16 11 16 9 6 6 6 3 0 3 12 12 12 11 11 10 10 6 6 6 7 8 8 11 13 23 22 22 14 9 8 8 6 6 6 8 10 10 10 8 8 8 8 3 0 3 11 17 17 8 6 6 6 6 7 6 6 6 7 14 8 8 3 0 3 8 23 15 9 6 6 6 8 8 8 10 17 22 12 10 7 7 7 15 10 9 7 9 6 6 6 8 9 9 17 13 9 9 9 9 11 12 8 6 6 6 6 6 8 8 8 8 10 6 6 6 6 7 7 6 6 6 6 6 8 6 6 6 6 6 6 6 6 6 8 8 8 8 6 6 6 6 6 6 6 8 8 8 8 6 6 6 6 6 3 0 3 8 8 8 8 8 8 8 8 8 8 6 8 6 8 8 8 8 8	Open. Hide. 0 3 7 6 13 8 8 8 8 21 21 11 11 10 10 12 14 23 23 28 22 10 10 10 26 22 27 25 18 12 11 9 9 12 13 16 16 17 20 19 30 30 30 35 36 36 36 36 50 38 42 50 50 43 36 33 23 21 14 15 11 12 26 26 42 48 40 41 41 41 41 47 59 59 57 54 54 54 54 54 54 57 57 57 57 50 50 50 50 51 57 57 48 50 50 50 51 51 68 68 68 68 57 57 57 57 57 57 57 68 68 68 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 50 50 50 51 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 51 51 50 51 57 57 57 57 57 57 57 57 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 54 52 57 57 57 50 51 68 68 57 57 57 59 57 57 57 57 57 68 68 68 68 68 57 57 50 50 48 57 57 68 68 68 68 68 68 59 59 59 59 59 57 57 57 48 48 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 59 59 57 54 54 54 44 44 37 37 35 37 47 47 57 59 57 48 48 59 59 59 59 57 57 57 54 54 54 59 57 57 57 57 57 57 57 57 48 48 48 48 59 59 59 59 59 59 59 59 34 34 23 23 23 16 16 11 11 11 23 25 39 39 37 31 25 16 14 12 13 13 15 16 30 17 19 10 10 10 10 10 9 8 8 8 10 10 10 14 18 19 15 15 15 9 12 9 11 11 19 27 16 11 10 8 9 10 19 10 18 13 11 11 13 15 12 9 9 9 9 10 8 8 10 10 8 8 8 8 8 8 10 13 13 10 17 16 15 13 10 10 10 8 10 10 9 9 10 11 12 15 12 17 17 15 18 21 16 18 12 12 12 10 15 16 19 14 13 13 11 11 11 12 12 11 8 8 8 8 8 8 8 8 8 10 10 10 8 10 9 10 9 9 9 9 13 11 11 11 11 12 11 11 9 9 9 8 8 8 6 6 10 13 10 11 8 12 8 9 11 8 8 8 8 8 8 8 12 12 7 6 8 8 8 8 8 8 8 6 6 8 8 8 8 8 9 11 8 8 6 6 8 10 9 8 8 8 8 8 8 8 8 6 6 8 8 8 9 8 8 8 11 10 8 8 8 8 8 8 8 10 10 10 11 9 8 8 8 8 8 8 8 8 10 10 11 17 15 15 8 10 6 6 8 8 9 8 8 8 8 8 10 12 10 10 10 9 9 10 8 11 8 8 8 8 11 8 8 6 6 8 10 8 8 6 6 8 8 8 8 10 6 6 8 8 8 6 6 8 8 13 10 10 11 10 6 7 6 6 8 8 8 13 13 12 12 7 6 8 8 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no078_f22.g1 MSMg01no078_f22.g1 CHROMAT_FILE:
MSMg01no078_f22.g1 PHD_FILE: MSMg01no078_f22.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:26:40 2005
         (305 letters)



>mm_chr16_20400991_20401697
          Length = 707

 Score =  516 bits (267), Expect = e-151
 Identities = 288/295 (97%), Gaps = 2/295 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   cttactgaaggaaccagggtagatgggtgcgtgagtttaatttcttttttcctttaaggt 60
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 495 cttactgaaggaaccagggtagatgggtgcatgagtttaatttcttttttcctttaaggt 436

                                                                       
Query: 61  gggcactggtttagctttcttttgttatggtttgctttgatttttgccaacctcaatttt 120
           ||| |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 435 gggtactggtttggctttcttttgttatggtttggtttgatttttgccaacctcaatttt 376

                                                                       
Query: 121 agctaccaggactcgaaaagactccgaaggatgccagcatcc-tgcccagcaggcctaga 179
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 375 agctaccaggactcgaaaagactccgaaggatgccagcatccttgcccagcaggcctaga 316

                                                                       
Query: 180 atctcgcagtctgtcgggagcagagtgtttcctcgcagcttagcgtgccaacagcacttg 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 atctcgcagtctgtcgggagcagagtgtttcctcgcagcttagcgtgccaacagcacttg 256

                                                                  
Query: 240 cagttttaagcagggtacctctttagggaaattttagttgttgtt-ttttttttt 293
           ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||
Sbjct: 255 cagttttaagcagagtacctctttagggaaattttagttgttgttgttttttttt 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 305
Length of database: 707
Length adjustment: 9
Effective length of query: 296
Effective length of database: 698
Effective search space:   206608
Effective search space used:   206608
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information