MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-422M11
Chromosome	16 (Build37)
Map Location	88,845,276 - 88,845,517
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Grik1, EG622373, Cldn17, Cldn8, Gm312, 2310079G19Rik, 2310002B14Rik, EG665513, 2310061N02Rik, Krtap13-1, Krtap13, 2310034C09Rik, 2310057N15Rik, EG546672, EG433047, 4930553J12Rik, Krtap14, Krtap15
Downstream gene	Krtap16-9, Krtap16-1, Krtap16-5, Krtap16-4, Krtap8-2, LOC100040191, AY026312, Krtap16-10, EG621595, LOC100040167, 1110032D16Rik, LOC100040201, Krtap6-1, LOC100040214, Krtap16-8, 1110025L11Rik, LOC100040249, LOC100040267, EG622794, LOC100040281, ENSMUSG00000044227, EG665661, LOC100040288, EG622935, EG622981, EG622998, EG623011, EG623026, LOC100040346, EG623049, LOC100040415, EG640636, LOC640652, LOC640654, LOC100040425, LOC100040374, LOC640656, LOC100040445, LOC100040456, Krtap21-1, Krtap6-2, 5430433J05Rik, Tiam1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Grik1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14805 MGI:95814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG622373 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622373 MGI:3645674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cldn17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239931 MGI:2652030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54420 MGI:1859286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239932 MGI:2685158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	2310079G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69699 MGI:1916949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	2310002B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69533 MGI:1916783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665513 MGI:3648908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins pseudo : _no_value

name	2310061N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69661 MGI:1916911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 6 Proteins

name	Krtap13-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268905 MGI:2146359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16699 MGI:1330835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310034C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117172 MGI:2152338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310057N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69696 MGI:1916946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546672 MGI:3645197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 7 Proteins

name	EG433047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433047 MGI:3647686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	4930553J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75351 MGI:1922601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 5 Proteins

name	Krtap14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23927 MGI:1346079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26560 MGI:1347350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170657 MGI:2157769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170651 MGI:2157572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77918 MGI:1925168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170654 MGI:2157757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap8-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16704 MGI:1330295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	AY026312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap16-10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	1110032D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins

name	LOC100040201 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins

name	Krtap6-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins

name	Krtap16-8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68484 MGI:1915734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110025L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins

name	LOC100040249 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC100040267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG622794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	ENSMUSG00000044227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG665661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040288 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG622935 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG622981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG622998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG623011 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG623026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG623049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040415 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG640636 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC640652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC640654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040425 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC640656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100040445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Krtap21-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73716 MGI:1920966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap6-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16701 MGI:1330280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430433J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71363 MGI:1918613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tiam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21844 MGI:103306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grik1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348035 GeneID:14805 MGI:95814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 1 transcript_id : NM_010348.2

name	Grik1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381111 GeneID:14805 MGI:95814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 1 transcript_id : NM_146072.3

name	Cldn17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801892 GeneID:239931 MGI:2652030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 17 transcript_id : NM_181490.3

name	Cldn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542405 GeneID:54420 MGI:1859286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 8 transcript_id : NM_018778.2

name	Gm312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400718 GeneID:239932 MGI:2685158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : gene model 312, (NCBI) transcript_id : XM_977282.1

name	2310079G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268136 GeneID:69699 MGI:1916949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : RIKEN cDNA 2310079G19 gene transcript_id : XM_484566.3

name	2310002B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351733 GeneID:69533 MGI:1916783
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310002B14 gene transcript_id : NM_027105.2

name	2310061N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268129 GeneID:69661 MGI:1916911
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 6 Proteins product : RIKEN cDNA 2310061N02 gene transcript_id : XM_001473644.1

name	Krtap13-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147241 GeneID:268905 MGI:2146359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 13-1 transcript_id : NM_183189.1

name	Krtap13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754491 GeneID:16699 MGI:1330835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 13 transcript_id : NM_010671.1

name	2310034C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368102 GeneID:117172 MGI:2152338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310034C09 gene transcript_id : NM_054100.2

name	2310057N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386207 GeneID:69696 MGI:1916946
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310057N15 gene transcript_id : NM_027170.1

name	EG546672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400721 GeneID:546672 MGI:3645197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 7 Proteins product : predicted gene, EG546672, transcript variant 3 transcript_id : XM_885642.2

name	4930553J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400723 GeneID:75351 MGI:1922601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 5 Proteins product : RIKEN cDNA 4930553J12 gene transcript_id : XM_484569.3

name	Krtap14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350453 GeneID:23927 MGI:1346079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 14 transcript_id : NM_013707.2

name	Krtap15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305212 GeneID:26560 MGI:1347350
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 15 transcript_id : NM_013713.1

name	Krtap16-9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865952 GeneID:170657 MGI:2157769
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-9 transcript_id : NM_130876.3

name	Krtap16-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21357426 GeneID:170651 MGI:2157572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-1 transcript_id : NM_130870.1

name	Krtap16-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158705 GeneID:77918 MGI:1925168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-5 transcript_id : NM_130857.2

name	Krtap16-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426872 GeneID:170654 MGI:2157757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-4 transcript_id : NM_130873.1

name	Krtap8-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113722126 GeneID:16704 MGI:1330295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 8-2 transcript_id : NM_010676.2

name	LOC100040191 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268138 GeneID:100040191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cDNA sequence AY026312 transcript_id : XM_001474241.1

name	AY026312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801851 GeneID:170939 MGI:2181750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY026312 transcript_id : NM_133359.2

name	Krtap16-10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50080210 GeneID:71369 MGI:1918619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-10 transcript_id : NM_183296.1

name	EG621595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973040 GeneID:621595 MGI:3644653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG621595, transcript variant 3 transcript_id : XM_896462.1

name	1110032D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400724 GeneID:68740 MGI:1915990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 4 Proteins product : RIKEN cDNA 1110032D16 gene transcript_id : XM_897249.2

name	LOC100040201 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268140 GeneID:100040201
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 12 Proteins product : similar to glycine tyrosine-rich hair keratin protein transcript_id : XM_001474256.1

name	Krtap6-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374194 GeneID:16700 MGI:1330228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-1 transcript_id : NM_010672.3

name	LOC100040214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268142 GeneID:100040214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 11 Proteins product : similar to keratin associated protein 6-1 transcript_id : XM_001474297.1

name	Krtap16-8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504469 GeneID:68484 MGI:1915734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 16-8 transcript_id : NM_130856.2

name	1110025L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268144 GeneID:68637 MGI:1915887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 13 Proteins product : RIKEN cDNA 1110025L11 gene transcript_id : XM_001474332.1

name	LOC100040249 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268146 GeneID:100040249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474351.1

name	LOC100040267 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268148 GeneID:100040267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MGC58416 protein transcript_id : XM_001474379.1

name	EG622794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268152 GeneID:622794 MGI:3643237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG622794 transcript_id : XM_897326.2

name	LOC100040281 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268154 GeneID:100040281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474426.1

name	ENSMUSG00000044227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268150 GeneID:640627 MGI:3642043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, ENSMUSG00000044227 transcript_id : XM_001474147.1

name	EG665661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400725 GeneID:665661 MGI:3649168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG665661 transcript_id : XM_978513.1

name	LOC100040288 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268156 GeneID:100040288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to MGC58416 protein transcript_id : XM_001474181.1

name	EG622935 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268158 GeneID:622935 MGI:3647747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG622935 transcript_id : XM_897414.2

name	EG622981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268160 GeneID:622981 MGI:3645349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG622981 transcript_id : XM_897445.2

name	EG622998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973291 GeneID:622998 MGI:3648365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG622998 transcript_id : XM_897455.1

name	EG623011 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973294 GeneID:623011 MGI:3643299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623011 transcript_id : XM_897466.1

name	EG623026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973298 GeneID:623026 MGI:3646232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623026 transcript_id : XM_897479.1

name	LOC100040346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268164 GeneID:100040346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to keratin associated protein 20-2 transcript_id : XM_001474233.1

name	EG623049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82973304 GeneID:623049 MGI:3646961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623049 transcript_id : XM_897498.1

name	LOC100040415 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268174 GeneID:100040415
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474343.1

name	EG640636 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268170 GeneID:640636 MGI:3646423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640636 transcript_id : XM_978919.2

name	LOC640652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268168 GeneID:640652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474284.1

name	LOC640654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268172 GeneID:640654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474324.1

name	LOC100040425 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268176 GeneID:100040425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474371.1

name	LOC100040374 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268166 GeneID:100040374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to MGC58416 protein transcript_id : XM_001474267.1

name	LOC640656 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268162 GeneID:640656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to keratin associated protein 6-2 transcript_id : XM_001474501.1

name	LOC100040445 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268179 GeneID:100040445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to MGC58416 protein transcript_id : XM_001474391.1

name	LOC100040456 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268181 GeneID:100040456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to keratin associated protein 21-1 transcript_id : XM_001474418.1

name	Krtap21-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802943 GeneID:73716 MGI:1920966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 21-1 transcript_id : NM_028621.2

name	Krtap6-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195693 GeneID:16701 MGI:1330280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 6-2 transcript_id : NM_010673.2

name	5430433J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268183 GeneID:71363 MGI:1918613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 5430433J05 gene transcript_id : XM_001474473.1

name	Tiam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372435 GeneID:21844 MGI:103306
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell lymphoma invasion and metastasis 1 transcript_id : NM_009384.2

name	Grik1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83999995 GeneID:14805 MGI:95814
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005261 - cation channel activity [Evidence IMP]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0015277 - kainate selective glutamate receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IMP]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence TAS]; GO:0048172 - regulation of short-term neuronal synaptic plasticity [Evidence TAS]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 2 product : glutamate receptor, ionotropic, kainate 1 isoform b protein_id : NP_034478.1

name	Grik1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000015 GeneID:14805 MGI:95814
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005261 - cation channel activity [Evidence IMP]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0015277 - kainate selective glutamate receptor activity [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IMP]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence TAS]; GO:0048172 - regulation of short-term neuronal synaptic plasticity [Evidence TAS]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1 product : glutamate receptor, ionotropic, kainate 1 isoform a protein_id : NP_666184.2

name	Cldn17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31377830 CCDS:CCDS28295.1 GeneID:239931 MGI:2652030
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 17 protein_id : NP_852467.1

name	Cldn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055192 CCDS:CCDS28296.1 GeneID:54420 MGI:1859286
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 8 protein_id : NP_061248.1

name	Gm312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400719 GeneID:239932 MGI:2685158
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982376.1

name	2310079G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769382 GeneID:69699 MGI:1916949
definition	codon_start : 1 product : hypothetical protein LOC69699 protein_id : XP_484566.1

name	2310002B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312310 CCDS:CCDS28298.1 GeneID:69533 MGI:1916783
definition	codon_start : 1 product : hypothetical protein LOC69533 protein_id : NP_081381.1

name	2310061N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268130 GeneID:69661 MGI:1916911
definition	codon_start : 1 product : hypothetical protein LOC69661 protein_id : XP_001473694.1

name	Krtap13-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147242 CCDS:CCDS28299.1 GeneID:268905 MGI:2146359
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 13-1 protein_id : NP_899012.1

name	Krtap13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754492 CCDS:CCDS28300.1 GeneID:16699 MGI:1330835
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 13 product : keratin associated protein 13 protein_id : NP_034801.1

name	2310034C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905137 GeneID:117172 MGI:2152338
definition	codon_start : 1 product : RIKEN cDNA 2310034C09 protein_id : NP_473441.1

name	2310057N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386208 CCDS:CCDS28302.1 GeneID:69696 MGI:1916946
definition	codon_start : 1 product : hypothetical protein LOC69696 protein_id : NP_081446.1

name	EG546672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973004 GeneID:546672 MGI:3645197
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_890735.1

name	4930553J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769388 GeneID:75351 MGI:1922601
definition	codon_start : 1 product : hypothetical protein LOC75351 protein_id : XP_484569.1

name	Krtap14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142350454 GeneID:23927 MGI:1346079
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 14 product : keratin associated protein 14 protein_id : NP_038735.2

name	Krtap15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305213 GeneID:26560 MGI:1347350
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 15 product : keratin associated protein 15 protein_id : NP_038741.1

name	Krtap16-9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865953 GeneID:170657 MGI:2157769
definition	codon_start : 1 product : keratin associated protein 16-9 protein_id : NP_570946.2

name	Krtap16-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21357427 CCDS:CCDS28304.1 GeneID:170651 MGI:2157572
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-1 protein_id : NP_570940.1

name	Krtap16-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426859 GeneID:77918 MGI:1925168
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-5 protein_id : NP_570927.1

name	Krtap16-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426873 GeneID:170654 MGI:2157757
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 product : keratin associated protein 16-4 protein_id : NP_570943.1

name	Krtap8-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113722127 GeneID:16704 MGI:1330295
definition	codon_start : 1 note : keratin-associated protein 8.2; HGTpI alpha; keratin-associated protein 8-2 product : keratin associated protein 8-2 protein_id : NP_034806.2

name	LOC100040191 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268139 GeneID:100040191
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474291.1

name	AY026312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111168 GeneID:170939 MGI:2181750
definition	codon_start : 1 note : high-glycine/tyrosine protein type I E5 product : cDNA sequence AY026312 protein_id : NP_579937.1

name	Krtap16-10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080211 GeneID:71369 MGI:1918619
definition	codon_start : 1 product : keratin associated protein 16-10 protein_id : NP_899119.1

name	EG621595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973041 GeneID:621595 MGI:3644653
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_901555.1

name	1110032D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973182 GeneID:68740 MGI:1915990
definition	codon_start : 1 product : hypothetical protein LOC68740 protein_id : XP_902342.1

name	LOC100040201 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268141 GeneID:100040201
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474306.1

name	Krtap6-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754494 GeneID:16700 MGI:1330228
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.1 product : keratin associated protein 6-1 protein_id : NP_034802.1

name	LOC100040214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268143 GeneID:100040214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474347.1

name	Krtap16-8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536240 GeneID:68484 MGI:1915734
definition	codon_start : 1 product : keratin associated protein 16-8 protein_id : NP_570926.1

name	1110025L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268145 GeneID:68637 MGI:1915887
definition	codon_start : 1 product : RIKEN cDNA 1110025L11 protein_id : XP_001474382.1

name	LOC100040249 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268147 GeneID:100040249
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474401.1

name	LOC100040267 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268149 GeneID:100040267
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474429.1

name	EG622794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268153 GeneID:622794 MGI:3643237
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902419.2

name	LOC100040281 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268155 GeneID:100040281
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474476.1

name	ENSMUSG00000044227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268151 GeneID:640627 MGI:3642043
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474197.1

name	EG665661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400726 GeneID:665661 MGI:3649168
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983607.1

name	LOC100040288 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268157 GeneID:100040288
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474231.1

name	EG622935 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268159 GeneID:622935 MGI:3647747
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902507.2

name	EG622981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268161 GeneID:622981 MGI:3645349
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902538.2

name	EG622998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973292 GeneID:622998 MGI:3648365
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902548.1

name	EG623011 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973295 GeneID:623011 MGI:3643299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902559.1

name	EG623026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973299 GeneID:623026 MGI:3646232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902572.1

name	LOC100040346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268165 GeneID:100040346
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474283.1

name	EG623049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82973305 GeneID:623049 MGI:3646961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902591.1

name	LOC100040415 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268175 GeneID:100040415
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474393.1

name	EG640636 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268171 GeneID:640636 MGI:3646423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984013.2

name	LOC640652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268169 GeneID:640652
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474334.1

name	LOC640654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268173 GeneID:640654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474374.1

name	LOC100040425 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268177 GeneID:100040425
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474421.1

name	LOC100040374 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268167 GeneID:100040374
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474317.1

name	LOC640656 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268163 GeneID:640656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474551.1

name	LOC100040445 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268180 GeneID:100040445
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474441.1

name	LOC100040456 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268182 GeneID:100040456
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474468.1

name	Krtap21-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229158 CCDS:CCDS28311.1 GeneID:73716 MGI:1920966
definition	codon_start : 1 exception : mismatches in translation product : keratin associated protein 21-1 protein_id : NP_082897.1

name	Krtap6-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195694 GeneID:16701 MGI:1330280
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] codon_start : 1 note : keratin-associated protein 6.2; keratin-associated protein 6-2 product : keratin associated protein 6-2 protein_id : NP_034803.2

name	5430433J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268184 GeneID:71363 MGI:1918613
definition	codon_start : 1 product : hypothetical protein LOC71363 protein_id : XP_001474523.1

name	Tiam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678351 CCDS:CCDS28314.1 GeneID:21844 MGI:103306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046875 - ephrin receptor binding [Evidence IPI]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0048013 - ephrin receptor signaling pathway [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IMP]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation product : T-cell lymphoma invasion and metastasis 1 protein_id : NP_033410.1

name	EG622373 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622373
definition	number : 1 pseudo : _no_value

name	EG433047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433047
definition	number : 1

name	EG665513 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268126 GeneID:665513 MGI:3648908
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 8 Proteins product : predicted gene, EG665513 pseudo : _no_value transcript_id : XR_002291.2

name	LOC100040167 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268137 GeneID:100040167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to Rpl7a protein pseudo : _no_value transcript_id : XR_031579.1

clone name	MSMg01-548B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-477G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-441G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-364J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-422M11.T7 (MSMg01no422_m11.b1)	MSMg01-422M11.TJ (MSMg01no422_m11.g1)
ACC	AG517088	AG517089
length	822	726
length of high quality (start - end)	137 (63 - 199)	242 (66 - 307)
definition	CHROMAT_FILE: MSMg01no422_m11.b1 PHD_FILE: MSMg01no422_m11.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:43:18 2005	CHROMAT_FILE: MSMg01no422_m11.g1 PHD_FILE: MSMg01no422_m11.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:43:18 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	XXXXXXXXXXXXXXXXXXXXXXATGCGTGAGCATCCGCGGAATTCTCAAC CCTTACTTTATAAAATTCTCCCCAAGGCTGACATATCTTTACTTTGGATG CATACTAGTAGGCTTCAATTTGTATATAATATTATATTAATTGATGAAAT GTATATATATATATATATATAGAGAGAGAGAGAGATTTTATTTATGTTAT ACACAATATACCACCACCCGCACCTTCAACTTCTTCATTTTTTTTTTTTC AGCCCCCTTTTCCCATATTTCTCTGTCCTAACGATGACCCCCCCCCACAC CGGCAAATTTCCCCTCACTTTCCAAGACAAACCCCCGACCCCCCGCTGCA TTTTTTTTCTCCCCCCCTCCCCCCCCTGGGTGTGTTTCTTCTCTTTACTC TCCCAATACTTCTTCCTTCCTTCTTCTCTTACGTCTCTCCCGCTTCCCTT TCTCCTCCCACTCCTTCGTTCTCTTCCCCACATCCCTCTTTCCCTCCGTT TGTTTCTCTTCTTCTCCGTCATTCCTTCTATTCTTCTCTCTCTTCCCTCC TTTCCACCGCCCATCTCCACCCCGCTTTGGCCTTTCCCTCTTCCTTCCAT CTGTTCTCTTCATCCTTCCCCCTCCCATCTCCTCTCCCTCCTCCTCTGTT TTTTCTTCCTCTTTCTTCACCCCGCTCTTTCTTCCTTCTCTCCTTTTAAT CCCTTCCCTTTCTTTTTTTCTCCACTATTTCACTACTCATACCGATATTT TTTTCTTTTTTTTTTCTCACCATCGACCACACCCTTTCCCTCCCCCCCAT CTTGTCCTCCCTCTTTTCTTCC	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXAATGCTGAACCAATTTTATTTGTTATAAACTAATTG CTGTTATTCTGAGTTTTTTTTTTCACCTTTATGGCTTCTCCTTACACATT GTTTTATGAACGAGGGGTAAGATATCCTGGGTTCATCTATGCTACATCTA ATTATGAAGAGATCTGATAAGGTCAGGAATGCTGCAGAGTTTTTTTTCTT AAAGAATAGAAGGTGGGTTTGGTGGCAGAGAACTTGGTCTCCCAACTTAC TAGGTTAATANATGCTTTTTCCCCTGGAGACTGAGTTTTAGAAATAGCTT TAGTAGATCTGAAATATAGAGAGAAATGTGATATGATTGTCTTTCAACAG CCTGATTCACAAGATAGGTTGTGTCACTTATTGATGATAGTCTTCAGTAT TTCCAATCAAGTGCATTTCTATTGATAATCCAGACATGCGTCAGTCATGA GCTTATTTGCTTTTATGAAAACAACTACAGGCGTGATTGCAGATTTCTAA CAAACAGTTGTATTTTTAATTTTCCTTTTTCCTTGGCACGTATTTGGAGC GATTCCACCCGCATTGTTTTTGTTTCTCCAATCACATGACTTTGATTTTT TTTTTTTCCAACTCTTATCTCTTCATGCTTTTATTAGTCGTGCATATATG TTGCGCGTTATCTGCGTGGTCATGTT
quality values	Open. Hide. 12 12 23 23 32 29 34 19 20 20 24 24 30 39 46 27 23 18 15 13 8 6 6 6 6 6 6 6 6 6 8 8 8 9 10 12 18 27 27 28 23 22 28 32 33 33 33 19 15 6 6 6 6 6 6 7 10 9 9 9 9 10 11 22 32 32 36 37 39 46 33 33 36 36 36 36 57 57 57 53 53 50 50 50 53 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 32 32 20 20 18 21 15 19 19 12 25 25 30 37 37 44 44 57 57 57 57 57 57 57 57 68 68 57 57 57 57 57 57 47 47 42 42 47 42 42 41 41 41 41 41 41 50 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 57 54 54 54 54 54 54 68 68 54 54 47 47 48 57 57 48 48 28 30 15 15 15 8 8 8 8 8 8 8 12 10 15 10 10 10 11 10 9 9 9 9 10 10 11 11 13 13 9 8 8 8 8 8 8 11 11 11 11 11 12 9 9 9 10 9 8 11 16 16 19 16 16 12 11 11 11 11 11 11 16 22 28 32 37 32 22 19 12 12 12 12 8 8 6 6 12 12 17 11 10 10 13 17 10 10 10 13 10 8 8 10 13 15 15 32 30 14 19 13 11 9 10 9 10 12 8 8 6 6 8 8 10 15 9 9 9 8 6 6 6 6 6 6 9 6 8 6 6 8 8 8 8 8 11 12 11 13 13 8 8 6 6 8 8 8 8 8 6 6 6 6 6 8 8 8 11 14 30 30 19 19 13 10 10 11 26 24 32 16 8 6 6 6 11 13 13 12 9 9 9 11 8 8 8 8 11 12 12 13 22 22 21 15 10 10 8 8 8 8 8 8 8 11 15 11 9 13 10 11 11 9 9 9 12 12 15 18 18 12 11 11 18 14 10 10 9 10 8 8 8 8 8 8 9 9 8 8 8 8 8 6 8 8 8 6 6 8 8 9 9 9 9 10 17 9 8 8 8 8 6 7 6 8 9 10 13 10 9 9 9 9 8 8 9 10 9 9 9 9 9 13 10 9 11 8 8 6 6 8 8 9 16 15 13 13 8 10 8 12 10 8 11 10 10 10 10 10 10 16 20 17 16 10 10 11 8 8 6 6 8 8 8 8 6 6 8 8 8 9 8 8 8 10 8 8 8 8 8 8 8 10 9 9 10 10 26 15 18 16 15 15 9 9 9 10 10 8 8 8 8 8 8 12 15 17 8 8 8 12 12 12 6 6 8 8 10 8 8 8 8 9 6 6 6 6 8 8 9 9 11 9 8 8 6 6 8 8 8 9 8 8 8 8 8 7 8 8 6 7 12 7 7 8 6 8 8 8 10 6 8 8 8 12 13 12 11 10 10 8 9 9 8 10 10 12 16 15 13 8 8 8 9 6 6 6 6 8 6 7 8 8 9 9 11 14 19 26 26 8 8 8 12 8 8 10 8 8 8 10 10 10 8 8 9 19 12 8 8 8 12 17 18 24 20 16 16 18 18 19 13 12 8 8 6 6 8 6 6 8 8 8 8 6 6 8 8 9 9 11 12 9 9 10 9 12 9 9 12 15 27 13 8 6 6 8 8 9 10 11 10 10 10 9 11 9 9 10 9 9 9 9 8 8 8 8 10 8 8 8 8 8 6 8 8 21 17 16 15 12 8 9 10 10 10 16 12 16 10 10 8 8 8 8 8 8 8 8 6 6 6 6 8 8 8 6 6 8 6 7 10 12 12 14 9 9 7 12 9 10 9 8 8 8 8 11 8 6 6 6 7 10 9 8 12 8 9 9 8 8 8 9 6 11 7 7 7	Open. Hide. 6 6 6 6 6 9 16 28 25 30 26 17 17 3 0 3 23 21 19 27 9 7 7 8 7 7 6 6 6 7 6 6 10 11 11 3 0 3 15 16 27 25 28 50 42 41 25 25 8 6 6 6 7 6 7 7 7 9 9 10 11 10 16 10 10 10 16 30 37 39 37 32 23 30 30 30 30 33 42 50 50 50 53 53 53 53 53 53 57 59 59 57 57 53 53 53 53 57 57 57 57 50 50 50 50 41 41 31 36 31 30 18 14 14 14 28 30 59 59 59 59 41 41 47 47 47 53 57 53 53 50 48 48 48 57 59 59 59 59 59 59 59 48 48 48 48 43 48 57 57 59 59 59 54 51 50 50 50 47 57 57 48 47 47 59 59 68 59 57 57 57 57 57 57 57 57 57 59 57 59 59 57 57 57 57 68 57 59 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 59 59 57 50 50 50 50 50 57 57 57 57 47 47 47 57 57 57 57 48 47 47 47 47 47 57 44 44 32 32 32 37 42 59 59 59 68 59 59 59 57 44 44 44 57 57 57 57 57 57 47 47 48 48 48 54 43 43 46 47 48 57 59 59 59 48 48 48 48 59 59 54 48 48 57 48 48 48 48 46 46 43 47 43 47 47 50 50 50 59 59 50 50 50 50 47 32 27 15 11 11 9 3 0 3 6 6 6 9 13 19 21 47 47 47 47 59 59 43 41 41 43 59 59 59 59 59 59 48 42 40 43 39 42 42 43 42 42 39 39 43 31 32 27 17 15 26 24 30 23 30 30 30 30 22 22 30 30 37 37 39 39 41 41 39 59 44 35 25 25 27 32 44 44 42 43 47 57 57 68 68 68 68 68 68 48 48 41 41 41 57 34 32 17 17 30 34 27 27 9 9 9 24 24 42 28 28 32 28 30 33 33 43 34 32 23 23 28 32 21 27 21 20 20 30 30 30 30 30 37 31 28 23 26 23 37 34 31 24 22 10 10 12 16 21 25 14 14 14 19 15 15 12 14 12 10 8 6 6 15 15 30 36 33 28 22 13 13 18 26 31 28 26 19 12 11 11 11 12 12 19 19 12 10 13 21 26 37 32 32 23 30 23 23 28 25 25 23 19 18 23 14 15 15 23 21 28 24 25 21 14 14 17 19 17 17 17 18 19 18 12 12 12 11 8 8 13 17 15 10 8 10 8 10 8 8 9 9 9 9 9 8 10 8 8 10 8 12 12 12 12 11 10 10 12 12 12 23 25 24 18 14 13 19 11 10 10 8 8 10 8 8 9 9 16 16 10 10 10 10 8 8 8 8 8 8 13 12 12 10 10 10 9 9 8 8 12 13 8 8 8 10 9 10 10 10 10 10 15 10 10 10 17 15 13 10 15 9 9 8 12 8 8 8 8 8 10 10 11 10 10 8 8 8 8 8 8 8 14 15 16 22 25 21 28 22 18 21 21 15 13 8 8 6 6 8 8 10 10 8 8 8 8 8 10 10 7 7 8 8 10 16 22 17 10 10 10 16 13 15 8 10 8 8 6 6 8 8 8 8 8 8 8 8 8 8 10 10 10 11 11 8 8 8 8 8 6 6 8 8 12 12 12 8 8 8 10 10 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no422_m11.g1 MSMg01no422_m11.g1 CHROMAT_FILE:
MSMg01no422_m11.g1 PHD_FILE: MSMg01no422_m11.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:43:18 2005
         (242 letters)



>mm_chr16_88845076_88845717
          Length = 642

 Score =  424 bits (219), Expect = e-123
 Identities = 237/243 (97%), Gaps = 2/243 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgctgaaccaattttatttgttataaactaattgctgttattctgagttttttttttca 60
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 442 atgctgaaccaattttatttgttataaactaattgctgttattctgag-tttttttttca 384

                                                                       
Query: 61  cctttatggcttctccttacacattgttttatgaacgaggggtaagatatcctgggttca 120
           |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||
Sbjct: 383 cctttatggcttctccttacacattgttttttgaatgaggggtaagatatcctgggttca 324

                                                                       
Query: 121 tctatgctacatctaattatgaagagatctgataaggtcaggaatgctgcagagtttttt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 323 tctatgctacatctaattatgaagagatctgataaggtcaggaatgctgcagattttttt 264

                                                                       
Query: 181 tt-cttaaagaatagaaggtgggtttggtggcagagaacttggtctcccaacttactagg 239
           || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 263 tttcttaaagaatagaaggagggtttggtggcagagaacttggtctcccaacttactagg 204

              
Query: 240 tta 242
           |||
Sbjct: 203 tta 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 12
Number of extensions: 4
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 242
Length of database: 642
Length adjustment: 9
Effective length of query: 233
Effective length of database: 633
Effective search space:   147489
Effective search space used:   147489
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information