MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-062N06
Chromosome	17 (Build37)
Map Location	7,171,621 - 7,348,445
singlet/doublet	doublet
Overlap gene	Rnaset2b, Gm1604
Upstream gene	Tulp4, EG433058, Tmem181, LOC100040453, LOC100040471, Dynlt1, LOC547127, LOC100040488, LOC100040500, LOC100040531, LOC100040525, LOC100040563, LOC100040546, LOC100040536, LOC100040556, LOC100040603, LOC100040596, LOC100040631, LOC100040616, Sytl3, Vil2, LOC100040654, Rshl2b, 1700122H20Rik, Tagap1
Downstream gene	Rps6ka2, LOC625031, Tcp10b, LOC100038857, LOC667055, 5830477G23Rik, LOC625102, Fndc1, EG634588, LOC100040748, LOC100040760, LOC667102, Tagap, Rshl2a, LOC100040822, Rnaset2a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tulp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68842 MGI:1916092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433058 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433058 MGI:3644697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 107 ESTs, 6 Proteins

name	Tmem181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77106 MGI:1924356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040453 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 105 ESTs, 6 Proteins

name	LOC100040471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 7 Proteins

name	Dynlt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21648 MGI:98643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 118 ESTs, 6 Proteins

name	LOC100040500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 240 ESTs, 6 Proteins

name	LOC100040531 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 480 ESTs, 10 Proteins

name	LOC100040525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 257 ESTs, 1 Protein pseudo : _no_value

name	LOC100040563 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 585 ESTs, 10 Proteins

name	LOC100040546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100040536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100040603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 585 ESTs, 10 Proteins

name	LOC100040596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 250 ESTs, 1 Protein pseudo : _no_value

name	LOC100040631 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 478 ESTs, 10 Proteins

name	LOC100040616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Sytl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83672 MGI:1933367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Vil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22350 MGI:98931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rshl2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037282 MGI:3630308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 74 ESTs, 3 Proteins

name	1700122H20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73617 MGI:1920867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tagap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380608 MGI:1919786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaset2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68195 MGI:3702087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gm1604 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381059 MGI:2686450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6ka2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20112 MGI:1342290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625031 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins pseudo : _no_value

name	Tcp10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21461 MGI:98542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 4 Proteins

name	5830477G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76116 MGI:1923366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC625102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins pseudo : _no_value

name	Fndc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68655 MGI:1915905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG634588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634588 MGI:3645817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040748 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC667102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Tagap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72536 MGI:3615484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rshl2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66832 MGI:1914082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs, 1 Protein

name	Rnaset2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037283 MGI:1915445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 127 ESTs, 2 Proteins

name	Tulp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383137 GeneID:68842 MGI:1916092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby like protein 4 transcript_id : NM_054040.2

name	EG433058 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401557 GeneID:433058 MGI:3644697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 107 ESTs, 6 Proteins product : predicted gene, EG433058 transcript_id : XM_484582.4

name	Tmem181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677513 GeneID:77106 MGI:1924356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 181 transcript_id : NM_001033178.1

name	LOC100040453 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268295 GeneID:100040453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 105 ESTs, 6 Proteins product : similar to protein phosphatase 1, regulatory (inhibitor) subunit 2 transcript_id : XM_001474700.1

name	LOC100040471 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268297 GeneID:100040471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 7 Proteins product : similar to tubby like protein 4 transcript_id : XM_001474739.1

name	Dynlt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476289 GeneID:21648 MGI:98643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain Tctex-type 1 transcript_id : NM_009342.2

name	LOC547127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:113865914 GeneID:547127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to KIAA1423 protein transcript_id : NM_001045538.1

name	LOC100040488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268299 GeneID:100040488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 118 ESTs, 6 Proteins product : similar to protein phosphatase 1, regulatory (inhibitor) subunit 2 transcript_id : XM_001475435.1

name	LOC100040500 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268301 GeneID:100040500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 240 ESTs, 6 Proteins product : similar to tubby like protein 4 transcript_id : XM_001474822.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268306 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 477 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475467.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268304 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 477 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475451.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268308 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 91 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475513.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268310 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 208 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475492.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268322 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475556.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268320 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475539.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268318 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 190 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475585.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268324 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 309 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475567.1

name	LOC100040546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268314 GeneID:100040546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : similar to synaptotagmin-like protein 3-a transcript_id : XM_001474890.1

name	LOC100040536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268312 GeneID:100040536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100040536 transcript_id : XM_001474877.1

name	LOC100040556 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268316 GeneID:100040556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : similar to synaptotagmin-like protein 3-a transcript_id : XM_001474901.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268327 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475602.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268329 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475617.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268331 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 190 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475648.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268333 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 309 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475631.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268339 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 475 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475746.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268341 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 475 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475764.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268337 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 91 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475802.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268343 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 208 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475782.1

name	LOC100040616 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268335 GeneID:100040616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100040616 transcript_id : XM_001474985.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368577 GeneID:83672 MGI:1933367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183367.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878232 GeneID:83672 MGI:1933367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_031395.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368585 GeneID:83672 MGI:1933367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183369.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368587 GeneID:83672 MGI:1933367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183370.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368589 GeneID:83672 MGI:1933367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183368.1

name	Vil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921617 GeneID:22350 MGI:98931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : villin 2 transcript_id : NM_009510.2

name	LOC100040654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268345 GeneID:100040654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040654 transcript_id : XM_001475030.1

name	Rshl2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268347 GeneID:100037282 MGI:3630308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 74 ESTs, 3 Proteins product : radial spokehead-like 2B transcript_id : XM_001475820.1

name	1700122H20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268349 GeneID:73617 MGI:1920867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700122H20 gene transcript_id : XM_001475863.1

name	Tagap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165395 GeneID:380608 MGI:1919786
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell activation GTPase activating protein 1 transcript_id : NM_147155.1

name	Rnaset2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439982 GeneID:68195 MGI:3702087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease T2B transcript_id : NM_026611.2

name	Gm1604 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384683 GeneID:381059 MGI:2686450
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1604, (NCBI) transcript_id : NM_001033442.2

name	Rps6ka2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299760 GeneID:20112 MGI:1342290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase, polypeptide 2 transcript_id : NM_011299.4

name	Tcp10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130122 GeneID:21461 MGI:98542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex protein 10b transcript_id : NM_011553.3

name	LOC100038857 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268266 GeneID:100038857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038857 transcript_id : XM_001471626.1

name	LOC667055 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94401558 GeneID:667055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 4 Proteins product : similar to UNC-93A protein transcript_id : XM_987981.1

name	5830477G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268352 GeneID:76116 MGI:1923366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 5830477G23 gene transcript_id : XM_001476159.1

name	Fndc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487224 GeneID:68655 MGI:1915905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 1 transcript_id : NM_001081416.1

name	LOC100040748 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268391 GeneID:100040748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001475177.1

name	LOC100040760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268393 GeneID:100040760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001475200.1

name	Tagap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165373 GeneID:72536 MGI:3615484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell activation Rho GTPase-activating protein transcript_id : NM_145968.1

name	Rshl2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803214 GeneID:66832 MGI:1914082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : radial spokehead-like 2A transcript_id : NM_025789.4

name	LOC100040822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268396 GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100040822, transcript variant 1 transcript_id : XM_001476254.1

name	LOC100040822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268398 GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical protein LOC100040822, transcript variant 2 transcript_id : XM_001476269.1

name	LOC100040822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268400 GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein product : hypothetical protein LOC100040822, transcript variant 3 transcript_id : XM_001476289.1

name	Rnaset2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268402 GeneID:100037283 MGI:1915445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 126 ESTs, 2 Proteins product : ribonuclease T2A, transcript variant 1 transcript_id : XM_001476345.1

name	Rnaset2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268404 GeneID:100037283 MGI:1915445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 113 ESTs, 1 Protein product : ribonuclease T2A, transcript variant 2 transcript_id : XM_001476365.1

name	Tulp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905077 CCDS:CCDS28370.1 GeneID:68842 MGI:1916092
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : tubby super-family protein product : tubby like protein 4 protein_id : NP_473381.1

name	EG433058 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63701773 GeneID:433058 MGI:3644697
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484582.2

name	Tmem181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677514 GeneID:77106 MGI:1924356
definition	codon_start : 1 product : G protein-coupled receptor 178 protein_id : NP_001028350.1

name	LOC100040453 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268296 GeneID:100040453
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474750.1

name	LOC100040471 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268298 GeneID:100040471
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474789.1

name	Dynlt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678265 CCDS:CCDS28371.1 GeneID:21648 MGI:98643
definition	GO_component : GO:0005858 - axonemal dynein complex [Evidence TAS]; GO:0005868 - cytoplasmic dynein complex [Evidence TAS] [Evidence ISS]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007017 - microtubule-based process [Evidence IDA] codon_start : 1 product : t-complex testis expressed 1 protein_id : NP_033368.1

name	LOC547127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:113865915 GeneID:547127
definition	codon_start : 1 product : hypothetical protein LOC547127 protein_id : NP_001039003.1

name	LOC100040488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268300 GeneID:100040488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475485.1

name	LOC100040500 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268302 GeneID:100040500
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474872.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268309 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475563.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268305 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475501.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268307 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475517.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268311 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475542.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268319 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475635.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268321 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475589.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268323 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475606.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268325 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475617.1

name	LOC100040536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268313 GeneID:100040536
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474927.1

name	LOC100040546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268315 GeneID:100040546
definition	codon_start : 1 product : similar to synaptotagmin-like protein 3-a protein_id : XP_001474940.1

name	LOC100040556 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268317 GeneID:100040556
definition	codon_start : 1 product : similar to synaptotagmin-like protein 3-a protein_id : XP_001474951.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268332 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475698.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268328 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475652.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268330 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475667.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268334 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475681.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268338 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475852.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268340 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475796.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268342 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475814.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268344 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475832.1

name	LOC100040616 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268336 GeneID:100040616
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475035.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878233 CCDS:CCDS28372.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : synaptotagmin-like 3 isoform a protein_id : NP_113572.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368578 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform 3SI is encoded by transcript variant 2 product : synaptotagmin-like 3 isoform 3SI protein_id : NP_899223.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368586 CCDS:CCDS28373.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform 3SII is encoded by transcript variant 4 product : synaptotagmin-like 3 isoform 3SII protein_id : NP_899225.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368590 CCDS:CCDS28373.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 3 product : synaptotagmin-like 3 isoform b protein_id : NP_899224.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368588 CCDS:CCDS28374.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform 3SIII is encoded by transcript variant 5 product : synaptotagmin-like 3 isoform 3SIII protein_id : NP_899226.1

name	Vil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921618 GeneID:22350 MGI:98931
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0045177 - apical part of cell [Evidence IDA]; GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005932 - basal body [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0001931 - uropod [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0051017 - actin filament bundle formation [Evidence ISS]; GO:0035088 - establishment and/or maintenance of apical/basal cell polarity [Evidence IMP]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : ezrin; cytovillin product : villin 2 protein_id : NP_033536.2

name	LOC100040654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268346 GeneID:100040654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475080.1

name	Rshl2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268348 GeneID:100037282 MGI:3630308
definition	codon_start : 1 product : radial spokehead-like 2B protein_id : XP_001475870.1

name	1700122H20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268350 GeneID:73617 MGI:1920867
definition	codon_start : 1 product : hypothetical protein LOC73617 protein_id : XP_001475913.1

name	Tagap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165396 GeneID:380608 MGI:1919786
definition	codon_start : 1 exception : mismatches in translation product : T-cell activation GTPase activating protein 1 protein_id : NP_671511.1

name	Rnaset2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311883 GeneID:68195 MGI:3702087
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004521 - endoribonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : ribonuclease T2 product : ribonuclease T2B protein_id : NP_080887.1

name	Gm1604 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701955 CCDS:CCDS28375.1 GeneID:381059 MGI:2686450
definition	codon_start : 1 product : hypothetical protein LOC381059 protein_id : NP_001028614.1

name	Rps6ka2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755374 CCDS:CCDS28376.1 GeneID:20112 MGI:1342290
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000089 - mitotic metaphase [Evidence IDA]; GO:0001556 - oocyte maturation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : S6K-alpha 2; ribosomal protein S6 kinase alpha 2; p90-RSK 2; ribosomal protein S6 kinase, 90kD, polypeptide 2 product : ribosomal protein S6 kinase, polypeptide 2 protein_id : NP_035429.1

name	Tcp10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098085 CCDS:CCDS28377.1 GeneID:21461 MGI:98542
definition	codon_start : 1 product : t-complex protein 10b protein_id : NP_035683.2

name	LOC100038857 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268267 GeneID:100038857
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471676.1

name	LOC667055 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94401559 GeneID:667055
definition	codon_start : 1 product : similar to UNC-93A protein protein_id : XP_993075.1

name	5830477G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268353 GeneID:76116 MGI:1923366
definition	codon_start : 1 product : hypothetical protein LOC76116 protein_id : XP_001476209.1

name	Fndc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487225 GeneID:68655 MGI:1915905
definition	codon_start : 1 product : fibronectin type III domain containing 1 protein_id : NP_001074885.1

name	LOC100040748 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268392 GeneID:100040748
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475227.1

name	LOC100040760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268394 GeneID:100040760
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475250.1

name	Tagap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165374 CCDS:CCDS28379.1 GeneID:72536 MGI:3615484
definition	codon_start : 1 product : T-cell activation Rho GTPase-activating protein protein_id : NP_666080.1

name	Rshl2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741725 GeneID:66832 MGI:1914082
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : radial spokehead-like 2 product : radial spokehead-like 2A protein_id : NP_080065.3

name	LOC100040822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268397 GeneID:100040822
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476304.1

name	LOC100040822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268399 GeneID:100040822
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476319.1

name	LOC100040822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268401 GeneID:100040822
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001476339.1

name	Rnaset2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268405 GeneID:100037283 MGI:1915445
definition	codon_start : 1 product : ribonuclease T2A isoform 2 protein_id : XP_001476415.1

name	Rnaset2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268403 GeneID:100037283 MGI:1915445
definition	codon_start : 1 product : ribonuclease T2A isoform 1 protein_id : XP_001476395.1

name	EG634588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634588
definition	number : 1 pseudo : _no_value

name	EG634588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634588
definition	number : 2 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 6 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 5 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 4 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 3 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 2 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 1 pseudo : _no_value

name	LOC100040525 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268303 GeneID:100040525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 257 ESTs, 1 Protein product : similar to G protein-coupled receptor 178 pseudo : _no_value transcript_id : XR_031953.1

name	LOC100040596 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268326 GeneID:100040596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 250 ESTs, 1 Protein product : similar to G protein-coupled receptor 178 pseudo : _no_value transcript_id : XR_032013.1

name	LOC625031 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268351 GeneID:625031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins product : similar to G protein-coupled receptor 31, D17Leh66c region pseudo : _no_value transcript_id : XR_032539.1

name	LOC625102 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268354 GeneID:625102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins product : similar to G protein-coupled receptor 31, D17Leh66c region pseudo : _no_value transcript_id : XR_032598.1

clone name	MSMg01-268D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462D07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-119O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-487K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-201G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-176I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137O11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-375N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421H18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421P16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542L20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435G18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080C19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098J02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-379K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359O14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-520D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517O12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-085I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-442G01
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-221B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-062N06.b	B6Ng01-062N06.g
ACC	DH883100	DH883101
length	1,131	1,108
definition	DH883100\|Mus musculus domesticus DNA, BAC clone: B6Ng01-062N06, 5' end.	DH883101\|Mus musculus domesticus DNA, BAC clone: B6Ng01-062N06, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(7,171,621 - 7,172,773)	(7,347,330 - 7,348,445)
sequence	gaattcactctctattttaaaaatgagaataaagagaactgattttggat ccagaggcacaggtctgagatctagcaccaccctgacaagtttctctctg tctggctataaatgtgtacaaaatgcaaaagagtaacattcggatcttcc ccatcttctctgggaatgcaaggaaggaagccttaactgtagaaacctct gtaggaagtctcaggcgaggagaagtataggaagctacaatttaaaacag acttaaaagacatctttaaaacgtgaaattattgtgcttgaagatgccaa cttggataataaaattataaaaaaataaaagaccgccacagaagccagga tagtttcttacaggtaatagctgtagagggctgggaggcttgcacaggga gcctatctataaaggctgtctgggggagctggcaagagtctagttcctca cattaaaggtgaggacagaaagaatcacaacaaaacagcccaaagcacag aaagctttcaccacactgtggtaacctagagagaatgacattttttaaat agagctacagggaagtgtaaccaaaaaccaggaagtgctcccacagtgga ggaaataaacttgggctgctaaggtcacaggacagggcttgagagaggac cacagctgtgtttgtctgcttggtgacacctctgcagttagtctctggga taggttggggctaggagactggccttcagtactttttttttttttttttt ggtttttcgagacagggtttctttgtgtagccctggctgtcctggaactc actttgtagaccaggctggccttgaactcagaaatccactttgcctctgc ctcccaagtgctgggattaaaagtgtgcaccagcactgcccagcccttca gtactcttaaagttaaccaattctcttcacaatgtgccattaactgaaaa gataggtaagaataaaacaagtagaagaatggggctggagatggctgcct gggtaaagtacatactgcttctctggagcaccctcccctctgggagcctg actctactgtcaaggtcaatacactaggtgctgaaaccttcctttctctt gtttaatcataagtccctagatatctttcag	gaattccctatgaccacattcctcatggcttggcttacaggatcagcaac aagtatacaacgcctagtccttgagctggaataatgctggtgtgcgttcc tgtgtcctgctaaccttgagtcacttgatgctaagattttatctgccacg tagcatgaagcagccctggcaggctcaggaatccagcttcttcatgatgc actcactggtggggtctgccccgagcctgtgccctcaccagagctaccca ttatgcacacttcagagaaggctccccaggcatctcaggcagaaggagat accacgtgacaaaggcttgatttcgggctgaggtagttcaggatgagaac cagggcccacagaatcacagtgttccttggtgggagagagatttggggaa aaaggagactgagtcaggactggaagaagaaaggagagactggaaggaga cggcaaaccgctagggcttcagagtgggatgtgagtaggaggccaagtga ggagagttaggtagtgcccggtacagaatgaggtccatgggacacagagc caccagctagtaaggaattcatctacggaactttagctcggcaaaggccc tggatttcagcctgaattcatcacttcccagaggtgcagagagctcgttg gagtttaccattattagagtcagccagttacaacaagttcttaatggagg ctcactgtacatacctactgtgggattggaaccgaaaaggtgagaggaaa ggaaccagaatgaacagagagaatcctggagtcagagaatcccatgagga gtcttccaggatgtatgtgtgcacacatgctcatgtgtgtatgcatactt atccaccacacttgcttacgcatctatacctcatgaatgcttgagcccat gtatagacactcctaagcctctaggaggtcacagccaggaagggattctg ggttgccgtctaatgaagtaagtacagactcagattcagagcacatcttg cagaacgagtttgaagataagcaaagaacgtaggactcgttgtggaacga gtactgaaatcacaaagacacgaacctagcatctggggacaaccctaaat ctcaatac
quality values	Open. Hide. 61 61 23 27 61 38 32 61 61 61 61 61 61 61 61 61 61 47 52 61 61 61 61 40 47 27 13 27 18 24 18 16 20 14 31 43 61 61 61 61 61 59 61 61 59 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 43 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 59 61 61 59 61 61 59 61 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 55 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 53 50 53 50 50 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 50 61 61 61 61 61 61 52 61 53 61 61 52 61 53 53 61 61 53 61 47 61 61 53 61 53 61 61 61 61 61 61 61 53 57 57 57 57 53 53 52 53 40 42 38 52 50 53 53 53 57 47 52 53 47 57 57 46 57 57 53 57 45 57 43 57 28 57 52 21 47 45 53 50 45 57 53 53 53 53 57 57 57 57 38 50 53 53 45 53 53 57 53 52 53 53 50 38 47 53 53 53 53 53 53 45 42 53 50 53 50 50 45 50 47 52 53 47 47 35 27 45 28 47 33 57 57 47 47 57 33 53 50 30 57 52 23 37 34 53 57 53 37 57 43 46 53 42 36 45 42 34 47 52 57 57 57 41 57 57 57 43 57 57 57 57 57 57 41 39 33 40 21 46 53 53 38 32 9 17 14 32 20 16 30 52 50 28 35 37 30 19 57 46 24 22 37 28 25 25 36 40 25 14 25 18 33 37 34 32 23 46 24 39 33 40 39 24 38 28 28 21 33 57 29 39 24 30 20 43 23 29 11 9 12 14 20 17 44 21 22 20 31 20 48 17 14 19 17 21 21 43 51 37 29 24 31 22 22 12 36 32 29 20 30 16 16 29 39 24 23 21 17 32 32 9 31 20 19 32 27 27 31 29 30 27 12 13 24 31 45 10 19 22 29 21 39 26 21 18 23 15 13 25 16 20 24 20 11 17 29 21 22 25 36 29 25 35 17 24 25 20 27 25 14 24 22 36 26 46 28 28 29 20 19 16 5 29 18 31 29 21 9 16 6 5 8 7 26 6 8 15 11 29 17 29 20 30 16 13 38 20 29 29 25 20 20 46 51 26 7 8 10 30 13 16 29 16 23 11 30 23 18 9 38 38 7 11 14 7 11 5 9 9 30 17 5 20 28 16 32 51 51 35 23 31 18 25 19 19 28 19 26 21 9 9 23 14 8 16 12 38 7 21 25 14 30 10 25 7 11 6 5 9 16 16 31 9 13 7 8 5 7 7 16 6 24 6 25 14 4 4 4 8 22 24 27 9 13 4 12 15 14 24 16 17 6 14 14 19 33 15 17 5 10 6 14 9 9 29 6 7 5 9 13 7 33 5 4 4 5 5 4 7 7 11 12 26 6 9 7 6 1 4 26 7 4 4 5 7 6 4 5 27 8 5 10 3 4 5 6 5 13 16 8 9 9 4 4 6 9 5 8 7 5 1 1 2 4 5 4 4 6 3 7 8 26 14 7 5 24	Open. Hide. 61 47 52 47 61 28 36 37 25 25 25 28 20 35 38 49 61 49 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 61 61 59 59 59 59 59 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 55 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 45 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 61 61 61 61 61 61 61 55 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 47 53 61 52 43 61 61 61 61 61 53 61 43 50 28 50 61 61 61 61 61 61 61 61 61 50 61 50 53 61 43 43 47 39 42 50 53 52 61 50 61 50 61 33 61 53 37 61 50 50 61 53 52 45 53 33 37 61 61 61 61 61 47 47 33 47 53 52 61 42 53 61 61 61 43 42 32 52 47 47 53 53 47 33 61 61 50 43 34 47 53 47 57 57 47 47 53 45 30 52 47 42 47 47 47 42 47 47 50 33 53 45 57 50 53 47 45 38 53 40 57 50 53 53 43 43 53 47 47 57 53 42 57 47 53 45 47 39 22 53 53 45 53 57 53 15 57 45 50 45 45 40 38 37 19 50 45 45 31 35 20 38 37 30 36 50 52 52 37 52 33 34 21 26 57 47 52 39 47 37 57 37 33 32 53 52 39 38 43 34 50 30 47 45 45 33 50 50 53 30 57 57 53 28 19 46 57 30 46 35 45 41 26 53 53 53 52 19 47 24 38 32 23 43 23 53 50 53 53 27 52 30 23 23 25 11 10 28 16 17 20 20 31 37 38 44 53 30 42 34 34 38 42 29 32 33 26 31 53 27 29 25 27 27 41 13 34 12 24 23 29 29 27 34 19 30 13 11 26 17 30 29 37 11 14 16 24 29 37 40 29 52 18 21 26 21 29 35 28 35 29 26 40 22 27 11 24 35 27 30 24 8 18 31 33 40 28 37 24 29 44 35 28 16 37 29 30 33 29 29 17 11 30 10 17 31 32 29 15 24 30 30 14 14 12 5 4 7 5 28 15 21 20 25 27 29 28 23 21 10 21 25 33 30 26 32 28 35 17 33 28 27 17 16 31 36 30 14 23 37 16 11 23 24 18 21 19 11 28 29 29 27 17 10 33 13 21 15 6 27 25 13 29 12 29 8 29 6 19 13 20 21 21 19 30 13 11 8 29 12 17 39 10 11 8 28 22 21 29 12 5 5 6 14 5 13 19 28 28 33 18 12 13 17 8 7 6 5 5 6 7 20 29 21 16 15 27 16 6 20 6 7 21 28 21 15 7 8 32 5 30 30 11 9 15 19 16 12 20 24 29 5 9 20 9 7 4 5 5 5 7 9 6 25 9 23 9 6 38 12 17 14 51 11 6 6 10 5 10 5 9 13 11 17 20 25 7 5 6 6 6 15 28 25 23 18 12 13 15 13 8 33 23 8 5 8 14 10 20 10 15 12 6 10 9 6 8 14 5 4 4 6 8 9 11 8 9 10 8 15 29 11 6 23 29 29 29 9 10 9 8 16 9 12 5 4 7 14 22 8 11 13 12 12 17 7 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_7171621_7172773
seq2: B6Ng01-062N06.b_47_1177

seq1  GAATTCACTCTCTATTTTAAAAATGAGAATAAAGAGAACTGATTTTGGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCTCTATTTTAAAAATGAGAATAAAGAGAACTGATTTTGGAT  50

seq1  CCAGAGGCACAGGTCTGAGATCTAGCACCACCCTGACAAGTTTCTCTCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAGGCACAGGTCTGAGATCTAGCACCACCCTGACAAGTTTCTCTCTG  100

seq1  TCTGGCTATAAATGTGTACAAAATGCAAAAGAGTAACATTCGGATCTTCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGCTATAAATGTGTACAAAATGCAAAAGAGTAACATTCGGATCTTCC  150

seq1  CCATCTTCTCTGGGAATGCAAGGAAGGAAGCCTTAACTGTAGAAACCTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTTCTCTGGGAATGCAAGGAAGGAAGCCTTAACTGTAGAAACCTCT  200

seq1  GTAGGAAGTCTCAGGCGAGGAGAAGTATAGGAAGCTACAATTTAAAACAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGAAGTCTCAGGCGAGGAGAAGTATAGGAAGCTACAATTTAAAACAG  250

seq1  ACTTAAAAGACATCTTTAAAACGTGAAATTATTGTGCTTGAAGATGCCAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAAAGACATCTTTAAAACGTGAAATTATTGTGCTTGAAGATGCCAA  300

seq1  CTTGGATAATAAAATTATAAAAAAATAAAAGACCGCCACAGAAGCCAGGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGATAATAAAATTATAAAAAAATAAAAGACCGCCACAGAAGCCAGGA  350

seq1  TAGTTTCTTACAGGTAATAGCTGTAGAGGGCTGGGAGGCTTGCACAGGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTTCTTACAGGTAATAGCTGTAGAGGGCTGGGAGGCTTGCACAGGGA  400

seq1  GCCTATCTATAAAGGCTGTCTGGGGGAGCTGGCAAGAGTCTAGTTCCTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTATCTATAAAGGCTGTCTGGGGGAGCTGGCAAGAGTCTAGTTCCTCA  450

seq1  CATTAAAGGTGAGGACAGAAAGAATCACAACAAAACAGCCCAAAGCACAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAAAGGTGAGGACAGAAAGAATCACAACAAAACAGCCCAAAGCACAG  500

seq1  AAAGCTTTCACCACACTGTGGTAACCTAGAGAGAATGACATTTTTTAAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCTTTCACCACACTGTGGTAACCTAGAGAGAATGACATTTTTTAAAT  550

seq1  AGAGCTACAGGGAAGTGTAACCAAAAACCAGGAAGTGCTCCCACAGTGGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTACAGGGAAGTGTAACCAAAAACCAGGAAGTGCTCCCACAGTGGA  600

seq1  GGAAATAAACTTGGGCTGCTAAGGTCACAGGACAGGGCTTGAGAGAGGAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATAAACTTGGGCTGCTAAGGTCACAGGACAGGGCTTGAGAGAGGAC  650

seq1  CACAGCTGTGTTTGTCTGCTTGGTGACACCTCTGCAGTTAGTCTCTGGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCTGTGTTTGTCTGCTTGGTGACACCTCTGCAGTTAGTCTCTGGGA  700

seq1  TAGGTTGGGGCTAGGAGACTGGCCTTCAGTACTTTTTTTTTTTTTTTTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTTGGGGCTAGGAGACTGGCCTTCAGTACTTTTTTTTTTTTTTTTTT  750

seq1  GGTTTTTCGAGACAGGGTTTCTTTGTGTAGCCCTGGCTGTCCTGGAACTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTTTCGAGACAGGGTTTCTTTGTGTAGCCCTGGCTGTCCTGGAACTC  800

seq1  ACTTTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCAC-TTGCCTCTGC  849
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ACTTTGTAGACCAGGCTGGCCTTGAACTCAGAAATCCACTTTGCCTCTGC  850

seq1  CTCCCAAGTGCTGGGATTAAAAGTGTGCACCAGCACTGCCCAGCCCTTCA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCAAGTGCTGGGATTAAAAGTGTGCACCAGCACTGCCCAGCCCTTCA  900

seq1  GTACTCTTAAAGTTAACCAATTCTCTCAACAATGTGCCATTAACTGAAAA  949
      ||||||||||||||||||||||||||  ||||||||||||||||||||||
seq2  GTACTCTTAAAGTTAACCAATTCTCTTCACAATGTGCCATTAACTGAAAA  950

seq1  GATAGTTAAGAATAAACAAGGTAGAAGAATGGGGCTGGAGATGGCTGCCT  999
      ||||| ||||||||||  | ||||||||||||||||||||||||||||||
seq2  GATAGGTAAGAATAAAACAAGTAGAAGAATGGGGCTGGAGATGGCTGCCT  1000

seq1  GGTTAAAAGTACATACTGC-TCTCTGGAGCCAACACTCCCCCTTCTGTGG  1048
      || | |||||||||||||| ||||||||||  || ||||||  |||| ||
seq2  GGGT-AAAGTACATACTGCTTCTCTGGAGC--ACCCTCCCC--TCTG-GG  1044

seq1  AGGCCTGACTCTTACTGTTCACAGGTCCATATACACTAGGTGCTTAAAAA  1098
      | ||||||||| ||||| ||| |||||   |||||||||||||| |||  
seq2  A-GCCTGACTC-TACTG-TCA-AGGTC--AATACACTAGGTGCTGAAACC  1088

seq1  CTCTCCACTTTCTTCTTGTTTATATCATAAGTACATCTAAGGAAATATCT  1148
       ||    ||||| ||||||||| ||||||||| | |      | ||||||
seq2  TTC----CTTTC-TCTTGTTTA-ATCATAAGTCCCT------AGATATCT  1126

seq1  TTCAG  1153
      |||||
seq2  TTCAG  1131

seq1: chr17_7347330_7348445
seq2: B6Ng01-062N06.g_68_1175 (reverse)

seq1  GTATTGAGATCTGGGGTTGGTCCCCCAGATGCTGTGGTTCGTGGTCTCTG  50
      |||||||||| | ||||||   |||||||||||  ||||||| |||| ||
seq2  GTATTGAGATTTAGGGTTG--TCCCCAGATGCT-AGGTTCGT-GTCTTTG  46

seq1  TGA-CTCAGTCCTCGTTTCCCACAGCGAGTCCTACCGTCTTTGCTTATCT  99
      |||  ||||| ||||||  ||||| ||||||||||  |||||||||||||
seq2  TGATTTCAGTACTCGTT--CCACAACGAGTCCTACGTTCTTTGCTTATCT  94

seq1  TCAAGCTCTGTCTTGCAGATGTTGCTTCTGAATCTGGTGTCTGTACTACC  149
      |||| |||  |||   ||||| ||| ||||||||| | |||||||||  |
seq2  TCAAACTCGTTCTGCAAGATG-TGC-TCTGAATCT-GAGTCTGTACTTAC  141

seq1  TTCATTAGACGGCATCCCAGATTCCCTTCCTGGCTGTGACCTCCTAGGGG  199
      |||||||||||||| |||||| ||||||||||||||||||||||||| ||
seq2  TTCATTAGACGGCAACCCAGAATCCCTTCCTGGCTGTGACCTCCTAGAGG  191

seq1  CTTAGGAGTGTCTATACATGGGCTCAAGCATTCATGAGGTATAGATGCGT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGGAGTGTCTATACATGGGCTCAAGCATTCATGAGGTATAGATGCGT  241

seq1  GAGCAAGTGTGGTGGATAAGTATGCATACACACATGAGCATGTGTGCACA  299
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAAGTGTGGTGGATAAGTATGCATACACACATGAGCATGTGTGCACA  291

seq1  CATACATCCTGGAAGACTCCTCATGGGATTCTCTGACTCCAGGATTCTCT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATACATCCTGGAAGACTCCTCATGGGATTCTCTGACTCCAGGATTCTCT  341

seq1  CTGTTCATTCTGGTTCCTTTCCTCTCACCTTTTCGGTTCCAATCCCACAG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTCATTCTGGTTCCTTTCCTCTCACCTTTTCGGTTCCAATCCCACAG  391

seq1  TAGGTATGTACAGTGAGCCTCCATTAAGAACTTGTTGTAACTGGCTGACT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTATGTACAGTGAGCCTCCATTAAGAACTTGTTGTAACTGGCTGACT  441

seq1  CTAATAATGGTAAACTCCAACGAGCTCTCTGCACCTCTGGGAAGTGATGA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATAATGGTAAACTCCAACGAGCTCTCTGCACCTCTGGGAAGTGATGA  491

seq1  ATTCAGGCTGAAATCCAGGGCCTTTGCCGAGCTAAAGTTCCGTAGATGAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCAGGCTGAAATCCAGGGCCTTTGCCGAGCTAAAGTTCCGTAGATGAA  541

seq1  TTCCTTACTAGCTGGTGGCTCTGTGTCCCATGGACCTCATTCTGTACCGG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTACTAGCTGGTGGCTCTGTGTCCCATGGACCTCATTCTGTACCGG  591

seq1  GCACTACCTAACTCTCCTCACTTGGCCTCCTACTCACATCCCACTCTGAA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTACCTAACTCTCCTCACTTGGCCTCCTACTCACATCCCACTCTGAA  641

seq1  GCCCTAGCGGTTTGCCGTCTCCTTCCAGTCTCTCCTTTCTTCTTCCAGTC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTAGCGGTTTGCCGTCTCCTTCCAGTCTCTCCTTTCTTCTTCCAGTC  691

seq1  CTGACTCAGTCTCCTTTTTCCCCAAATCTCTCTCCCACCAAGGAACACTG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACTCAGTCTCCTTTTTCCCCAAATCTCTCTCCCACCAAGGAACACTG  741

seq1  TGATTCTGTGGGCCCTGGTTCTCATCCTGAACTACCTCAGCCCGAAATCA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTCTGTGGGCCCTGGTTCTCATCCTGAACTACCTCAGCCCGAAATCA  791

seq1  AGCCTTTGTCACGTGGTATCTCCTTCTGCCTGAGATGCCTGGGGAGCCTT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTTTGTCACGTGGTATCTCCTTCTGCCTGAGATGCCTGGGGAGCCTT  841

seq1  CTCTGAAGTGTGCATAATGGGTAGCTCTGGTGAGGGCACAGGCTCGGGGC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGAAGTGTGCATAATGGGTAGCTCTGGTGAGGGCACAGGCTCGGGGC  891

seq1  AGACCCCACCAGTGAGTGCATCATGAAGAAGCTGGATTCCTGAGCCTGCC  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCCACCAGTGAGTGCATCATGAAGAAGCTGGATTCCTGAGCCTGCC  941

seq1  AGGGCTGCTTCATGCTACGTGGCAGATAAAATCTTAGCATCAAGTGACTC  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCTGCTTCATGCTACGTGGCAGATAAAATCTTAGCATCAAGTGACTC  991

seq1  AAGGTTAGCAGGACACAGGAACGCACACCAGCATTATTCCAGCTCAAGGA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTTAGCAGGACACAGGAACGCACACCAGCATTATTCCAGCTCAAGGA  1041

seq1  CTAGGCGTTGTATACTTGTTGCTGATCCTGTAAGCCAAGCCATGAGGAAT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGCGTTGTATACTTGTTGCTGATCCTGTAAGCCAAGCCATGAGGAAT  1091

seq1  GTGGTCATAGGGAATTC  1116
      |||||||||||||||||
seq2  GTGGTCATAGGGAATTC  1108

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information