MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-187F22
Chromosome	17 (Build37)
Map Location	65,133,382 - 65,296,834
singlet/doublet	doublet
Overlap gene	4930583I09Rik, LOC100043871
Upstream gene	LOC668677, A930002H24Rik, Fert2, LOC669778, Pja2, LOC100043582, Man2a1
Downstream gene	E130009J12Rik, LOC668655, LOC674701, Vapa, Txndc2, Rab31, Ppp4r1, Ralbp1, LOC100043873, LOC100043592, Twsg1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668677 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	A930002H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320004 MGI:2443151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Fert2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14158 MGI:105917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC669778 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Pja2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224938 MGI:2159342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043582 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Man2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17158 MGI:104669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930583I09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78057 MGI:1925307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100043871 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	E130009J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381107 MGI:2685786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC674701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Vapa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30960 MGI:1353561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213272 MGI:2389312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106572 MGI:1914603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp4r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70351 MGI:1917601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ralbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19765 MGI:108466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043873 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043592 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Twsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65960 MGI:2137520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930002H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402105 GeneID:320004 MGI:2443151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA A930002H24 gene transcript_id : XM_484656.4

name	Fert2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921583 GeneID:14158 MGI:105917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fer (fms/fps related) protein kinase, testis specific 2 transcript_id : NM_001037997.1

name	Fert2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679772 GeneID:14158 MGI:105917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fer (fms/fps related) protein kinase, testis specific 2 transcript_id : NM_008000.1

name	Pja2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778928 GeneID:224938 MGI:2159342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : praja 2, RING-H2 motif containing transcript_id : NM_144859.2

name	Pja2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794800 GeneID:224938 MGI:2159342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : praja 2, RING-H2 motif containing transcript_id : NM_001025309.1

name	LOC100043582 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268780 GeneID:100043582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043582 transcript_id : XM_001480456.1

name	Man2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678789 GeneID:17158 MGI:104669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha 1 transcript_id : NM_008549.1

name	4930583I09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402107 GeneID:78057 MGI:1925307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930583I09 gene transcript_id : XM_128729.3

name	E130009J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374161 GeneID:381107 MGI:2685786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130009J12 gene transcript_id : NM_001008973.2

name	LOC674701 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268782 GeneID:674701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) transcript_id : XM_001480470.1

name	Vapa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980695 GeneID:30960 MGI:1353561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein, associated protein A transcript_id : NM_013933.2

name	Txndc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943823 GeneID:213272 MGI:2389312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 2 (spermatozoa) transcript_id : NM_153519.1

name	Rab31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526849 GeneID:106572 MGI:1914603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB31, member RAS oncogene family transcript_id : NM_133685.1

name	Ppp4r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164781 GeneID:70351 MGI:1917601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 4, regulatory subunit 1 transcript_id : NM_146081.1

name	Ralbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375674 GeneID:19765 MGI:108466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ralA binding protein 1 transcript_id : NM_009067.2

name	LOC100043873 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268890 GeneID:100043873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043873 transcript_id : XM_001481169.1

name	LOC100043592 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268784 GeneID:100043592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Ubtf protein transcript_id : XM_001480486.1

name	Twsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802034 GeneID:65960 MGI:2137520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : twisted gastrulation homolog 1 (Drosophila) transcript_id : NM_023053.2

name	A930002H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94402106 GeneID:320004 MGI:2443151
definition	codon_start : 1 product : hypothetical protein LOC320004 protein_id : XP_484656.4

name	Fert2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921584 CCDS:CCDS28936.1 GeneID:14158 MGI:105917
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0051301 - cell division [Evidence IEA]; GO:0006935 - chemotaxis [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1 product : fer (fms/fps related) protein kinase, testis specific 2 isoform a protein_id : NP_001033086.1

name	Fert2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679773 CCDS:CCDS28937.1 GeneID:14158 MGI:105917
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0051301 - cell division [Evidence IEA]; GO:0006935 - chemotaxis [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 2 product : fer (fms/fps related) protein kinase, testis specific 2 isoform b protein_id : NP_032026.1

name	Pja2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450079 CCDS:CCDS29028.1 GeneID:224938 MGI:2159342
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; neurodegeneration associated protein 1; praja2; protein carrying the RING-H2 sequence motif product : ring finger protein 131 isoform b protein_id : NP_659108.1

name	Pja2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794801 CCDS:CCDS29027.1 GeneID:224938 MGI:2159342
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; neurodegeneration associated protein 1; praja2; protein carrying the RING-H2 sequence motif product : ring finger protein 131 isoform a protein_id : NP_001020480.1

name	LOC100043582 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268781 GeneID:100043582
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480506.1

name	Man2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678790 CCDS:CCDS28938.1 GeneID:17158 MGI:104669
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA]; GO:0004572 - mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mannosidase 2, alpha 1 protein_id : NP_032575.1

name	4930583I09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20900722 GeneID:78057 MGI:1925307
definition	codon_start : 1 product : hypothetical protein LOC78057 protein_id : XP_128729.1

name	E130009J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374162 CCDS:CCDS28940.1 GeneID:381107 MGI:2685786
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC381107 protein_id : NP_001008973.2

name	LOC674701 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268783 GeneID:674701
definition	codon_start : 1 product : similar to protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) protein_id : XP_001480520.1

name	Vapa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94721328 GeneID:30960 MGI:1353561
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : vesicle-associated membrane protein, associated protein A (33 kDa); synaptobrevin-associated protein of 33kDa product : vesicle-associated membrane protein, associated protein A protein_id : NP_038961.2

name	Txndc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943824 GeneID:213272 MGI:2389312
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0030508 - thiol-disulfide exchange intermediate activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006467 - protein thiol-disulfide exchange [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : spermatid-specific thioredoxin 1 product : thioredoxin domain containing 2 (spermatozoa) protein_id : NP_705739.1

name	Rab31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526850 GeneID:106572 MGI:1914603
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Rab31-like protein_id : NP_598446.1

name	Ppp4r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164782 CCDS:CCDS28941.1 GeneID:70351 MGI:1917601
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : protein phosphatase 4, regulatory subunit 1 protein_id : NP_666193.1

name	Ralbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677751 GeneID:19765 MGI:108466
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0017160 - Ral GTPase binding [Evidence IPI] GO_process : GO:0043089 - positive regulation of Cdc42 GTPase activity [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Ral-interacting protein 1 product : ralA binding protein 1 protein_id : NP_033093.1

name	LOC100043873 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268891 GeneID:100043873
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481219.1

name	LOC100043592 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268785 GeneID:100043592
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480536.1

name	Twsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746428 CCDS:CCDS28942.1 GeneID:65960 MGI:2137520
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030509 - BMP signaling pathway [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0009790 - embryonic development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0030900 - forebrain development [Evidence IMP] [Evidence IGI]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0001707 - mesoderm formation [Evidence IGI]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence IMP] [Evidence IDA]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence IDA]; GO:0001503 - ossification [Evidence IMP]; GO:0030513 - positive regulation of BMP signaling pathway [Evidence IMP]; GO:0009888 - tissue development [Evidence IGI] codon_start : 1 function : putative modifier of BMP-signalling product : twisted gastrulation homolog 1 protein_id : NP_075540.1

name	LOC668677 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668677
definition	number : 1 pseudo : _no_value

name	LOC669778 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669778
definition	number : 1 pseudo : _no_value

name	LOC669778 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669778
definition	number : 2 pseudo : _no_value

name	LOC669778 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669778
definition	number : 3 pseudo : _no_value

name	LOC668655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668655
definition	number : 1 pseudo : _no_value

name	LOC668655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668655
definition	number : 2 pseudo : _no_value

name	LOC100043871 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268889 GeneID:100043871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical protein LOC100043871 pseudo : _no_value transcript_id : XR_035029.1

clone name	MSMg01-125B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-361G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-304B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-467E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207I17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-474I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162C08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-187F22.b	B6Ng01-187F22.g
ACC	GA011967	GA011968
length	1,179	1,155
definition	B6Ng01-187F22.b	B6Ng01-187F22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(65,133,382 - 65,134,565)	(65,295,663 - 65,296,834)
sequence	gaattcctccatctgtgcttctttcacagtccttgcattacttgggggtt cttcatattctctcagttcctcaacctcgttgagtagtaactcttgtgtt tagcagctgtggttggcatattagaggcacccagtaattctcattggttt gatttgaacaggtgaaagctttcaagagaatgggcgactaaaagtggtca aagaggctcttttctttcttttttttaaaataaaaccagtgtctggagat atggcccagcagtcagaatcactgggtgctcttcaagaggacctgggttt ggttctctgcaaccacatggcagctcataactccttctagttaccgtcct ttcttctggcctccattggtaccaggaaagccagtggtgctcagacatat atgcagacaaaatactcacacacacacaaaaccaaagatagactaaaata aaataaagccacaagaagatctgagctccttgcccaaggtgggcacattt cccagtcactcagcaatcttggaggacagcctaagcactggtcttctctg atccagatcagcttcattaaacacttcctgggcctgtgagatggatggtg tgggagcacagccttgacagcaaggagatcttctccaggtgctcccgtat ggctcctggtcccgccaagctgaaaacttccaaggagaaactgctgcaga cccaaggactgaccaggaccccaccccatttctagaccttctacaggttc cctccattagagaaggaagcttgaatggatgcagccagtgcacataggta ggatggtggtgatactttttgtgatgagaacgttcaaacgcaaatgacca ttgcggccctcagctcactttgtctcacccaccagagcaacaacagtgca ccctgcagggtctgccacgagacttgacaattttgatctgctgacagaac aacatgaaatgatgcgcagatgtgcacttagcatctgtcatgctcgaaac cctggagaaatgtgactggcaatgacttcagcgtgaaacgggagcaccct tgtgagttctggtgagtctgaggaagaacagcagtacagacttacagtca agacagccagaagcctctcctggtcaacaggccagagggtactcttgagt cacgtaaactaaacttgagaaatgtccac	gaattccttaagtatgtcattcagaatggcttttctaagagttacatatt ctaaaatcaggtcttacacataagaattgtccaaggaagtttgaaagctc tgcttagcaaaacagtgggagtctctataaatcacaggctttctagatct tcccaaaccaactttgtaataatagacatgatttttcttttgccatatag gcctcagttccagtgggaaggtggttggttatccccatgacagacatgcc agtattgcatctgtggatgcatttgccagtccagttggttgagttgtatg ttggattcacataagctagctgatgaccgtgctgctccagcagagcacat agcatgttcccgaatatgagagacattcagcatgcaggaagctccagcac aggtctagcttcatctacctatgctcttttactcaagtacatggtatagt caggaataaactcaggtgctgctggttaaccagccacaatatcctgtact gtttggaacctttggtggcctccctggctaccttgttaggtagtattcta cctgaatttgataacgtctaccctaatcccttagctaaattgatgatatg taattttctgtctctagcctctggtccatgaaccccattcccataatatt catcctcaaactcaagtgcccccccctttcccatcaagcctgtcacattc aaataaatgcacagattattggtaaggaagaatctgtacagggccactgg atggtatcagatgtacatgaaggcaaattttgcataaaacactacttgaa gtatatttgccctttctttgtaatttgtagaatatgacaccgaaaacagt cacaaattgcagtgcattgcttaagcaagtggtttggctgtacgtgggtt gagtatggggacaggttttccaattttgttgttaaagtagttcacatttc taagctgcagatcacaagagaatatactcttctctctcaagcaccaagct aatccataagtgcagattagatctttcatttcactagaaagagtaattta attttttttgaccttaaaccaccactgccataaaactcccaattgaattc tctttggggtaaaaataatgaggcaatgagtgattcactggacagaatgg tgaaa
quality values	Open. Hide. 58 34 33 25 58 58 62 62 62 41 25 62 62 62 62 62 62 62 62 62 62 62 62 62 44 30 56 44 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 48 62 62 62 62 62 62 62 62 62 38 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 58 54 43 58 58 54 52 58 58 54 58 58 58 58 58 58 54 42 58 54 37 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 54 58 58 58 54 54 58 58 54 51 52 43 40 54 58 54 58 58 54 58 58 58 54 53 58 58 52 58 58 58 54 58 58 58 54 58 58 58 54 58 48 58 58 58 51 51 51 39 45 41 58 58 54 51 58 58 51 58 58 58 58 58 58 46 54 38 42 53 53 49 58 51 51 51 41 49 52 51 51 49 41 41 58 44 47 53 52 53 53 58 50 53 50 41 35 51 58 52 58 51 51 50 44 41 48 53 41 49 58 46 36 58 41 58 50 54 50 36 50 41 44 52 51 43 30 58 52 49 51 40 50 54 51 50 40 49 58 37 28 29 53 41 58 39 28 54 58 42 35 51 51 50 58 50 50 50 39 49 22 39 44 32 53 42 58 32 33 51 58 42 36 44 40 35 40 33 24 34 33 44 33 23 33 33 25 31 51 54 51 31 49 40 33 41 35 33 39 46 40 42 39 37 37 41 51 39 38 27 42 42 46 36 44 27 41 53 42 24 54 33 49 31 9 40 33 42 21 38 42 40 41 45 52 36 54 39 40 31 39 37 31 35 42 44 31 39 31 46 38 30 41 29 52 33 21 47 33 34 31 52 34 22 29 46 28 37 22 25 42 31 29 31 31 22 49 53 53 47 41 29 34 33 31 31 37 22 53 16 22 25 31 42 31 28 40 28 31 13 45 31 40 31 30 33 42 17 31 24 19 30 31 31 33 31 19 36 45 43 29 31 32 31 42 26 21 28 30 46 35 32 30 31 41 38 32 31 37 31 22 31 24 31 31 46 9 26 19 9 17 31 14 28 26 32 32 31 24 31 25 33 22 31 31 24 17 7 32 22 27 31 31 31 31 27 16 30 25 38 25 31 15 31 31 32 32 30 9 31 25 44 41 29 31 31 27 29 31 37 16 30 31 27 17 11 8 8 5 15 6 20 28 15 5 14 31 47 15 27 37 23 23 34 32 24 26 29 10 28 16 27 14 33 32 22 24 21 21 36 24 22 19 27 29 23 34 32 26 26 27 33 22 34 32 21 21 39 9 27 29 17 9 13 12 13 10 31 47 26 11 15 21 28 17 14 23 22 23 17 11 14 12 14 21 15 30 18 11 10 20 15 13 6 18 14 40 23 28 19 47 22 28 20 18 22 5 28 7 15 6 28 15 8 11 5 16 28 20 24 30 32 24 18 27 10 15 19 28 28 29 7 13 19 13 8 13 21 9 20 6 5 9 7 14 7 6 5 6 21 7 10 22 8 17 6 11 5 4 13 6 10 3 5 5 8 7 5 2 3 3 3 2 5 5 8 7 8 8 4 4 6 4 6 6 8 6 9 2 5 6 14 7 16 5 5 3 12 5 5 3 1 2 4 5 6 13 8 1 3 7 18 7 3 1 3 18 3 1 2 13 16 8 3 1 1 2 5 5 15 28 17 4 4 5 8 11 4 15	Open. Hide. 62 47 51 42 62 62 62 62 62 62 62 62 54 56 47 49 62 59 59 62 62 59 59 62 62 62 62 62 59 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 33 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 49 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 47 52 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 42 33 58 54 54 47 41 54 58 58 54 58 52 43 47 58 54 58 58 52 54 58 58 52 58 58 54 58 54 58 58 54 54 58 58 58 58 58 48 41 58 58 58 58 52 58 50 54 58 58 58 51 49 44 41 41 54 54 58 58 51 41 47 58 50 58 50 58 49 49 58 49 46 58 58 51 40 58 54 50 53 41 58 52 52 58 49 58 58 58 52 58 58 50 50 54 51 52 51 46 58 58 49 50 52 58 54 46 48 27 30 52 58 58 38 47 54 48 48 50 58 58 44 41 41 50 53 41 53 53 53 39 58 51 39 51 43 58 52 52 50 58 44 43 58 52 31 51 51 52 54 38 49 44 43 42 37 42 43 50 54 37 32 34 34 40 50 41 32 33 47 39 42 37 54 52 40 34 50 45 54 54 42 37 49 37 53 29 54 40 50 54 35 30 52 49 47 39 32 50 41 41 46 51 39 33 44 46 30 51 37 41 31 30 26 39 45 53 54 32 45 46 25 40 54 51 38 54 31 37 28 28 46 38 37 47 54 32 53 40 36 45 29 41 25 53 31 26 36 32 42 45 41 28 36 51 31 36 53 31 30 49 51 53 42 31 30 34 29 51 51 45 31 31 40 34 36 31 30 40 45 45 30 31 31 31 35 39 30 46 46 31 31 40 40 34 45 32 30 27 51 34 41 25 19 31 30 51 33 22 23 32 24 46 31 31 34 33 31 22 21 31 31 46 25 44 46 46 26 31 25 31 20 33 28 35 32 46 29 31 33 29 26 32 26 33 42 28 31 25 30 31 27 29 26 30 37 22 32 28 41 31 29 31 30 31 48 33 31 32 23 31 31 23 23 37 20 32 23 46 29 20 19 28 32 24 30 10 11 31 44 44 29 12 12 20 31 32 8 41 41 18 34 23 6 28 23 44 44 25 38 14 25 35 19 11 22 48 21 18 25 31 18 30 22 21 21 32 16 19 43 29 30 32 30 24 27 21 22 28 9 43 18 20 24 20 19 21 12 17 7 18 11 23 22 19 30 10 23 34 21 15 9 34 18 18 22 32 31 32 32 16 26 27 22 27 11 26 6 13 13 27 28 15 7 6 11 16 5 5 3 5 13 26 28 26 24 13 22 16 16 5 3 6 16 28 16 21 9 13 24 21 14 25 6 8 14 11 10 9 18 21 25 10 27 8 19 16 20 10 26 17 3 3 8 26 30 26 17 17 28 14 10 15 8 6 15 8 16 29 7 3 4 11 12 18 10 15 7 9 7 15 13 20 18 26 27 19 18 14 7 23 13 3 9 4 8 9 11 9 5 2 4 4 5 10 26 21 16 26 28 5 1 4 17 16 17 5 6 5 3 2 2 5 1 5 18 15 17 6 11 6 3 4 6 10 13 8 7 8 15 7 7 6 20 3 4 12 11 8 4 7 7 9 11 17 17 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_65133382_65134565
seq2: B6Ng01-187F22.b_48_1226

seq1  GAATTCCTCCATCTGTGCTTCTTTCACAGTCCTTGCATTACTTGGGGGTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTCCATCTGTGCTTCTTTCACAGTCCTTGCATTACTTGGGGGTT  50

seq1  CTTCATATTCTCTCAGTTCCTCAACCTCGTTGAGTAGTAACTCTTGTGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCATATTCTCTCAGTTCCTCAACCTCGTTGAGTAGTAACTCTTGTGTT  100

seq1  TAGCAGCTGTGGTTGGCATATTAGAGGCACCCAGTAATTCTCATTGGTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAGCTGTGGTTGGCATATTAGAGGCACCCAGTAATTCTCATTGGTTT  150

seq1  GATTTGAACAGGTGAAAGCTTTCAAGAGAATGGGCGACTAAAAGTGGTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTGAACAGGTGAAAGCTTTCAAGAGAATGGGCGACTAAAAGTGGTCA  200

seq1  AAGAGGCTCTTTTCTTTCTTTTTTTTAAAATAAAACCAGTGTCTGGAGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGCTCTTTTCTTTCTTTTTTTTAAAATAAAACCAGTGTCTGGAGAT  250

seq1  ATGGCCCAGCAGTCAGAATCACTGGGTGCTCTTCAAGAGGACCTGGGTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCCAGCAGTCAGAATCACTGGGTGCTCTTCAAGAGGACCTGGGTTT  300

seq1  GGTTCTCTGCAACCACATGGCAGCTCATAACTCCTTCTAGTTACCGTCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCTCTGCAACCACATGGCAGCTCATAACTCCTTCTAGTTACCGTCCT  350

seq1  TTCTTCTGGCCTCCATTGGTACCAGGAAAGCCAGTGGTGCTCAGACATAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCTGGCCTCCATTGGTACCAGGAAAGCCAGTGGTGCTCAGACATAT  400

seq1  ATGCAGACAAAATACTCACACACACACAAAACCAAAGATAGACTAAAATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCAGACAAAATACTCACACACACACAAAACCAAAGATAGACTAAAATA  450

seq1  AAATAAAGCCACAAGAAGATCTGAGCTCCTTGCCCAAGGTGGGCACATTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAAGCCACAAGAAGATCTGAGCTCCTTGCCCAAGGTGGGCACATTT  500

seq1  CCCAGTCACTCAGCAATCTTGGAGGACAGCCTAAGCACTGGTCTTCTCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGTCACTCAGCAATCTTGGAGGACAGCCTAAGCACTGGTCTTCTCTG  550

seq1  ATCCAGATCAGCTTCATTAAACACTTCCTGGGCCTGTGAGATGGATGGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCAGATCAGCTTCATTAAACACTTCCTGGGCCTGTGAGATGGATGGTG  600

seq1  TGGGAGCACAGCCTTGACAGCAAGGAGATCTTCTCCAGGTGCTCCCGTAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGCACAGCCTTGACAGCAAGGAGATCTTCTCCAGGTGCTCCCGTAT  650

seq1  GGCTCCTGGTCCCGCCAAGCTGAAAACTTCCAAGGAGAAACTGCTGCAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCCTGGTCCCGCCAAGCTGAAAACTTCCAAGGAGAAACTGCTGCAGA  700

seq1  CCCAAGGACTGACCAGGACCCCACCCCATTTCTAGACCTTCTACAGGTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGGACTGACCAGGACCCCACCCCATTTCTAGACCTTCTACAGGTTC  750

seq1  CCTCCATTAGAGAAGGAAGCTTGAATGGATGCAGCCAGTGCACATAGGTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCATTAGAGAAGGAAGCTTGAATGGATGCAGCCAGTGCACATAGGTA  800

seq1  GGATGGTGGTGATACTTTTTGTGATGAGAACGTTCAAACGCAAATGACCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGTGGTGATACTTTTTGTGATGAGAACGTTCAAACGCAAATGACCA  850

seq1  TTGCGGCCCTCAGCTCACTTTGTCTCACCCACCAGAGCAACAACAGTGCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCGGCCCTCAGCTCACTTTGTCTCACCCACCAGAGCAACAACAGTGCA  900

seq1  CCCTGCAGGGTCTGCCACGAGACTTGACAA-TTTGATCTGCTGACAGAAC  949
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  CCCTGCAGGGTCTGCCACGAGACTTGACAATTTTGATCTGCTGACAGAAC  950

seq1  AACAATGAAATGATGCGCAGATGTGCACTTAGCATCTGTCATGCTCG-AA  998
      ||| ||||||||||||||||||||||||||||||||||||||||||| ||
seq2  AAC-ATGAAATGATGCGCAGATGTGCACTTAGCATCTGTCATGCTCGAAA  999

seq1  CCCTGGAGAAATGTGACTGGCAATGACTTCAGCGTGAAACGGGAGCAACC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  CCCTGGAGAAATGTGACTGGCAATGACTTCAGCGTGAAACGGGAGCACCC  1049

seq1  TTGTGAGTTCTGGTGAGTCTGAGGAAGAACAAGCAGTACAGACTTACAGG  1098
      |||||||||||||||||||||||||||||| |||||||||||||||||| 
seq2  TTGTGAGTTCTGGTGAGTCTGAGGAAGAAC-AGCAGTACAGACTTACAGT  1098

seq1  CAAGGACAGCAAGGA-CAGCTCTCTGTCAACCAAGCCAAGAGGGGTTTAA  1147
      ||| |||||| || | |  |||   ||||||  || | ||||||   || 
seq2  CAA-GACAGCCAGAAGCCTCTCCTGGTCAAC--AGGCCAGAGGG---TAC  1142

seq1  TC-TGAGTCAACGGGAAAATAACAGGAGAAATGTCCAC  1184
      || |||||| |||  ||   |||  |||||||||||||
seq2  TCTTGAGTC-ACGTAAACTAAACTTGAGAAATGTCCAC  1179

seq1: chr17_65295663_65296834
seq2: B6Ng01-187F22.g_66_1220 (reverse)

seq1  TTTCAC--ATCTGTTCAGTGAATCACTCATTTGCTTTCAATTTATTTTTT  48
      ||||||   ||||| ||||||||||||||||  |  |||  |||  ||||
seq2  TTTCACCATTCTGTCCAGTGAATCACTCATTGCC--TCA--TTA--TTTT  44

seq1  TCCCCCAAAGAGAAATTCATTTGGGAGTTTTATGGCAGTGGTGGTTTTAA  98
      | |||||||||| |||||| ||||||||||||||||||||||||||| | 
seq2  TACCCCAAAGAG-AATTCAATTGGGAGTTTTATGGCAGTGGTGGTTTAAG  93

seq1  GTCAAAAAAAATTTTAAATTTACTCTTTTCTAGTGAAAATGAAAGATCTT  148
      |||||||||||||   || |||||| ||||||||| ||||||||||||| 
seq2  GTCAAAAAAAATT---AAATTACTC-TTTCTAGTG-AAATGAAAGATCT-  137

seq1  AAATCTGCACTTAATTGGGATTTAGCTTGGTGCTTGAGAGAGAAGAGTAT  198
       ||||||||||||  |||   |||||||||||||||||||||||||||| 
seq2  -AATCTGCACTTA--TGG--ATTAGCTTGGTGCTTGAGAGAGAAGAGTA-  181

seq1  TATTCTCTTGTGATCTTGCAGCTTAGAAATGTGAACTACTTTAACAACAA  248
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  TATTCTCTTGTGATC-TGCAGCTTAGAAATGTGAACTACTTTAACAACAA  230

seq1  AATTGG-AAACCTGTCCCCATACTCAACCCACGTACAGCCAAACCACTTG  297
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGGAAAACCTGTCCCCATACTCAACCCACGTACAGCCAAACCACTTG  280

seq1  CTTAAGCAATGCACTGCAATTTGTGACTGTTTTCGGTGTCATATTCTACA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAGCAATGCACTGCAATTTGTGACTGTTTTCGGTGTCATATTCTACA  330

seq1  AATTACAAAGAAAGGGCAAATATACTTCAAGTAGTGTTTTATGCAAAATT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTACAAAGAAAGGGCAAATATACTTCAAGTAGTGTTTTATGCAAAATT  380

seq1  TGCCTTCATGTACATCTGATACCATCCAGTGGCCCTGTACAGATTCTTCC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTCATGTACATCTGATACCATCCAGTGGCCCTGTACAGATTCTTCC  430

seq1  TTACCAATAATCTGTGCATTTATTTGAATGTGACAGGCTTGATGGGAAAG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCAATAATCTGTGCATTTATTTGAATGTGACAGGCTTGATGGGAAAG  480

seq1  GGGGGGGCACTTGAGTTTGAGGATGAATATTATGGGAATGGGGTTCATGG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGGCACTTGAGTTTGAGGATGAATATTATGGGAATGGGGTTCATGG  530

seq1  ACCAGAGGCTAGAGACAGAAAATTACATATCATCAATTTAGCTAAGGGAT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGAGGCTAGAGACAGAAAATTACATATCATCAATTTAGCTAAGGGAT  580

seq1  TAGGGTAGACGTTATCAAATTCAGGTAGAATACTACCTAACAAGGTAGCC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGGTAGACGTTATCAAATTCAGGTAGAATACTACCTAACAAGGTAGCC  630

seq1  AGGGAGGCCACCAAAGGTTCCAAACAGTACAGGATATTGTGGCTGGTTAA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGGCCACCAAAGGTTCCAAACAGTACAGGATATTGTGGCTGGTTAA  680

seq1  CCAGCAGCACCTGAGTTTATTCCTGACTATACCATGTACTTGAGTAAAAG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCAGCACCTGAGTTTATTCCTGACTATACCATGTACTTGAGTAAAAG  730

seq1  AGCATAGGTAGATGAAGCTAGACCTGTGCTGGAGCTTCCTGCATGCTGAA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATAGGTAGATGAAGCTAGACCTGTGCTGGAGCTTCCTGCATGCTGAA  780

seq1  TGTCTCTCATATTCGGGAACATGCTATGTGCTCTGCTGGAGCAGCACGGT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTCATATTCGGGAACATGCTATGTGCTCTGCTGGAGCAGCACGGT  830

seq1  CATCAGCTAGCTTATGTGAATCCAACATACAACTCAACCAACTGGACTGG  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAGCTAGCTTATGTGAATCCAACATACAACTCAACCAACTGGACTGG  880

seq1  CAAATGCATCCACAGATGCAATACTGGCATGTCTGTCATGGGGATAACCA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATGCATCCACAGATGCAATACTGGCATGTCTGTCATGGGGATAACCA  930

seq1  ACCACCTTCCCACTGGAACTGAGGCCTATATGGCAAAAGAAAAATCATGT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACCTTCCCACTGGAACTGAGGCCTATATGGCAAAAGAAAAATCATGT  980

seq1  CTATTATTACAAAGTTGGTTTGGGAAGATCTAGAAAGCCTGTGATTTATA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTATTACAAAGTTGGTTTGGGAAGATCTAGAAAGCCTGTGATTTATA  1030

seq1  GAGACTCCCACTGTTTTGCTAAGCAGAGCTTTCAAACTTCCTTGGACAAT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTCCCACTGTTTTGCTAAGCAGAGCTTTCAAACTTCCTTGGACAAT  1080

seq1  TCTTATGTGTAAGACCTGATTTTAGAATATGTAACTCTTAGAAAAGCCAT  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATGTGTAAGACCTGATTTTAGAATATGTAACTCTTAGAAAAGCCAT  1130

seq1  TCTGAATGACATACTTAAGGAATTC  1172
      |||||||||||||||||||||||||
seq2  TCTGAATGACATACTTAAGGAATTC  1155

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information