MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233O09
Chromosome	17 (Build37)
Map Location	48,594,888 - 48,749,101
singlet/doublet	doublet
Overlap gene	Unc5cl
Upstream gene	AI661453, Tbn, Ccnd3, Bysl, Trfp, LOC668463, Usp49, 1110002E23Rik, Frs3, Pgc, LOC100043405, Tcfeb, Mdfi, Foxp4, LOC383250, 1700122O11Rik, 1700067P10Rik, 9830107B12Rik, A530064D06Rik, LOC100043419, Trem1, Trem3, Treml4, Treml2, B430306N03Rik, Trem2, Treml1, Nfya, AI314976, Apobec2, Bzrpl1
Downstream gene	Lrfn2, 1700008K24Rik, LOC672972, Mocs1, Daam2
Link	Open Mouse BAC browser

Click to get alignment info.

name	AI661453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224833 MGI:2146908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63856 MGI:1926879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12445 MGI:88315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Bysl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53414 MGI:1858419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trfp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56771 MGI:1929648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 15 Proteins pseudo : _no_value

name	Usp49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224836 MGI:2685391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110002E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66119 MGI:1913369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107971 MGI:2135965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109820 MGI:98909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Tcfeb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21425 MGI:103270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdfi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17240 MGI:107687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74123 MGI:1921373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1700122O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76651 MGI:1923901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1700067P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68224 MGI:1915474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830107B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328829 MGI:3608415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530064D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328830 MGI:2443476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Trem1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58217 MGI:1930005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trem3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58218 MGI:1930003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Treml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224840 MGI:1923239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Treml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328833 MGI:2147038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B430306N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320148 MGI:2443478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trem2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83433 MGI:1913150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Treml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71326 MGI:1918576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfya (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18044 MGI:97316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI314976 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106821 MGI:2146818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apobec2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11811 MGI:1343178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bzrpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70026 MGI:1917276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc5cl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76589 MGI:1923839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrfn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70530 MGI:1917780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700008K24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69311 MGI:1916561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs

name	LOC672972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Mocs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56738 MGI:1928904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Daam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76441 MGI:1923691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI661453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703963 GeneID:224833 MGI:2146908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI661453 transcript_id : NM_145489.1

name	Tbn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803261 GeneID:63856 MGI:1926879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taube nuss transcript_id : NM_022015.3

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012532 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_001081636.1

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012503 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_001081635.1

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012528 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_007632.2

name	Bysl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560590 GeneID:53414 MGI:1858419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bystin-like transcript_id : NM_016859.2

name	Trfp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802099 GeneID:56771 MGI:1929648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) transcript_id : NM_020048.3

name	Usp49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259219 GeneID:224836 MGI:2685391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 49 transcript_id : NM_198421.1

name	1110002E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982675 GeneID:66119 MGI:1913369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110002E23 gene transcript_id : NM_025365.2

name	Frs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130081 GeneID:107971 MGI:2135965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor substrate 3 transcript_id : NM_144939.2

name	Pgc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375746 GeneID:109820 MGI:98909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progastricsin (pepsinogen C) transcript_id : NM_025973.3

name	Tcfeb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538818 GeneID:21425 MGI:103270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor EB transcript_id : NM_011549.2

name	Mdfi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754665 GeneID:17240 MGI:107687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MyoD family inhibitor transcript_id : NM_010783.1

name	Foxp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21630274 GeneID:74123 MGI:1921373
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box P4 transcript_id : NM_028767.1

name	1700122O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268728 GeneID:76651 MGI:1923901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700122O11 gene transcript_id : XM_001480119.1

name	1700067P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722639 GeneID:68224 MGI:1915474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700067P10 gene transcript_id : NM_026625.2

name	9830107B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130515 GeneID:328829 MGI:3608415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830107B12 gene transcript_id : NM_177824.3

name	A530064D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802702 GeneID:328830 MGI:2443476
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530064D06 gene transcript_id : NM_178796.4

name	Trem1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362336 GeneID:58217 MGI:1930005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells 1 transcript_id : NM_021406.3

name	Trem3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378895 GeneID:58218 MGI:1930003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells 3 transcript_id : NM_021407.2

name	Treml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369889 GeneID:224840 MGI:1923239
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 4 transcript_id : NM_172623.1

name	Treml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677892 GeneID:224840 MGI:1923239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 4 transcript_id : NM_001033922.1

name	Treml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133908635 GeneID:328833 MGI:2147038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 2 transcript_id : NM_001033405.2

name	B430306N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802088 GeneID:320148 MGI:2443478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B430306N03 gene transcript_id : NM_177083.3

name	Trem2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981415 GeneID:83433 MGI:1913150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells 2 transcript_id : NM_031254.2

name	Treml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037246 GeneID:71326 MGI:1918576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 1 transcript_id : NM_027763.1

name	Nfya (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754847 GeneID:18044 MGI:97316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transcription factor-Y alpha transcript_id : NM_010913.1

name	AI314976 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382757 GeneID:106821 MGI:2146818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI314976 transcript_id : NM_207219.3

name	Apobec2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803136 GeneID:11811 MGI:1343178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B editing complex 2 transcript_id : NM_009694.2

name	Bzrpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368798 GeneID:70026 MGI:1917276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : benzodiazapine receptor, peripheral-like 1 transcript_id : NM_027292.2

name	Unc5cl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301485 GeneID:76589 MGI:1923839
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-5 homolog C (C. elegans)-like transcript_id : NM_152823.3

name	Lrfn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388558 GeneID:70530 MGI:1917780
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and fibronectin type III domain containing 2 transcript_id : NM_027452.2

name	1700008K24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268866 GeneID:69311 MGI:1916561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs product : RIKEN cDNA 1700008K24 gene transcript_id : XM_001481104.1

name	Mocs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30524915 GeneID:56738 MGI:1928904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : molybdenum cofactor synthesis 1 transcript_id : NM_020042.1

name	Daam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089317 GeneID:76441 MGI:1923691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dishevelled associated activator of morphogenesis 2 transcript_id : NM_001008231.2

name	AI661453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703964 GeneID:224833 MGI:2146908
definition	codon_start : 1 product : hypothetical protein LOC224833 protein_id : NP_663464.1

name	Tbn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528498 GeneID:63856 MGI:1926879
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045598 - regulation of fat cell differentiation [Evidence ISS] codon_start : 1 product : TBP-associated factor 8 protein_id : NP_071298.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126012504 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_001075104.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126012533 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_001075105.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6724313 CCDS:CCDS28850.1 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_031658.1

name	Bysl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560591 GeneID:53414 MGI:1858419
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA] codon_start : 1 product : bystin-like protein_id : NP_058555.2

name	Trfp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910590 CCDS:CCDS28851.1 GeneID:56771 MGI:1929648
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA]; GO:0016592 - Srb-mediator complex [Evidence ISS] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence ISS] [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 49 product : Trf-proximal protein homolog protein_id : NP_064432.1

name	Usp49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259220 CCDS:CCDS28852.1 GeneID:224836 MGI:2685391
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 49 product : ubiquitin specific protease 49 homolog protein_id : NP_940813.1

name	1110002E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384732 GeneID:66119 MGI:1913369
definition	codon_start : 1 product : hypothetical protein LOC66119 protein_id : NP_079641.1

name	Frs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450353 CCDS:CCDS28854.1 GeneID:107971 MGI:2135965
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : suc1-associated neurotrophic factor target 2 (FGFR signalling adaptor) product : fibroblast growth factor receptor substrate 3 protein_id : NP_659188.1

name	Pgc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244579 CCDS:CCDS28855.1 GeneID:109820 MGI:98909
definition	EC_number : 3.4.23.3 GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007586 - digestion [Evidence IEA] codon_start : 1 note : urinary pepsinogen 1 product : progastricsin (pepsinogen C) protein_id : NP_080249.2

name	Tcfeb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538819 CCDS:CCDS28856.1 GeneID:21425 MGI:103270
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transcription factor EB protein_id : NP_035679.2

name	Mdfi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754666 GeneID:17240 MGI:107687
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : MyoD family inhibitor protein_id : NP_034913.1

name	Foxp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630275 GeneID:74123 MGI:1921373
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0048617 - embryonic foregut morphogenesis [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : fork head-related protein like A product : winged-helix repressor FOXP4 protein_id : NP_083043.1

name	1700122O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268729 GeneID:76651 MGI:1923901
definition	codon_start : 1 product : hypothetical protein LOC76651 protein_id : XP_001480169.1

name	1700067P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722640 CCDS:CCDS28857.1 GeneID:68224 MGI:1915474
definition	codon_start : 1 product : hypothetical protein LOC68224 protein_id : NP_080901.2

name	9830107B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244382 GeneID:328829 MGI:3608415
definition	codon_start : 1 product : hypothetical protein LOC328829 protein_id : NP_808492.1

name	A530064D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559837 CCDS:CCDS28859.1 GeneID:328830 MGI:2443476
definition	codon_start : 1 product : hypothetical protein LOC328830 protein_id : NP_848911.2

name	Trem1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946760 CCDS:CCDS28860.1 GeneID:58217 MGI:1930005
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : triggering receptor expressed in monocytes 1 product : triggering receptor expressed on myeloid cells 1 protein_id : NP_067381.1

name	Trem3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946762 CCDS:CCDS28861.1 GeneID:58218 MGI:1930003
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : triggering receptor expressed on monocytes 3 product : triggering receptor expressed on myeloid cells 3 protein_id : NP_067382.1

name	Treml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369890 CCDS:CCDS28862.1 GeneID:224840 MGI:1923239
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; IG-like domain containing protein IDCP1c product : triggering receptor expressed on myeloid cells-like 4 isoform 2 protein_id : NP_766211.1

name	Treml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677893 GeneID:224840 MGI:1923239
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; IG-like domain containing protein IDCP1c product : triggering receptor expressed on myeloid cells-like 4 isoform 1 protein_id : NP_001029094.1

name	Treml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133908636 GeneID:328833 MGI:2147038
definition	codon_start : 1 note : trem-like transcript 2 product : triggering receptor expressed on myeloid cells-like 2 protein_id : NP_001028577.2

name	B430306N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893001 CCDS:CCDS28864.1 GeneID:320148 MGI:2443478
definition	codon_start : 1 product : hypothetical protein LOC320148 protein_id : NP_796057.1

name	Trem2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994125 CCDS:CCDS28865.1 GeneID:83433 MGI:1913150
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] codon_start : 1 note : triggering receptor expressed on myeloid cells 2c; triggering receptor expressed on myeloid cells 2a; triggering receptor expressed on myeloid cells 2b product : triggering receptor expressed on myeloid cells 2 protein_id : NP_112544.1

name	Treml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037247 CCDS:CCDS28866.1 GeneID:71326 MGI:1918576
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence TAS] GO_process : GO:0009968 - negative regulation of signal transduction [Evidence TAS] codon_start : 1 product : triggering receptor expressed on myeloid cells-like 1 protein_id : NP_082039.1

name	Nfya (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754848 CCDS:CCDS28867.1 GeneID:18044 MGI:97316
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear transcription factor-Y alpha protein_id : NP_035043.1

name	AI314976 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625732 GeneID:106821 MGI:2146818
definition	codon_start : 1 product : hypothetical protein LOC106821 protein_id : NP_997102.2

name	Apobec2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753098 CCDS:CCDS28868.1 GeneID:11811 MGI:1343178
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003969 - RNA editase activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006381 - mRNA editing [Evidence IMP]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 product : apolipoprotein B editing complex 2 protein_id : NP_033824.1

name	Bzrpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229096 CCDS:CCDS28869.1 GeneID:70026 MGI:1917276
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : benzodiazapine receptor, peripheral-like 1 protein_id : NP_081568.1

name	Unc5cl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301486 CCDS:CCDS28870.1 GeneID:76589 MGI:1923839
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ZU5 and death domain-containing inhibitor of NF-kB product : unc-5 homolog C (C. elegans)-like protein_id : NP_690036.3

name	Lrfn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037213 CCDS:CCDS28871.1 GeneID:70530 MGI:1917780
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine rich repeat and fibronectin type III domain containing 2 protein_id : NP_081728.1

name	1700008K24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268867 GeneID:69311 MGI:1916561
definition	codon_start : 1 product : hypothetical protein LOC69311 protein_id : XP_001481154.1

name	Mocs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524916 GeneID:56738 MGI:1928904
definition	codon_start : 1 note : protein B is encoded by transcript variant 1; molybdenum cofactor synthesis-step 1 proteins A and B product : molybdenum cofactor synthesis 1 protein B protein_id : NP_064426.1

name	Daam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089318 GeneID:76441 MGI:1923691
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0016043 - cell organization and biogenesis [Evidence IEA] codon_start : 1 product : dishevelled associated activator of morphogenesis 2 protein_id : NP_001008232.2

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 3 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 2 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 1 pseudo : _no_value

name	LOC383250 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383250
definition	number : 1 pseudo : _no_value

name	LOC100043419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043419
definition	number : 1 pseudo : _no_value

name	LOC100043419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043419
definition	number : 2 pseudo : _no_value

name	LOC672972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672972
definition	number : 4 pseudo : _no_value

name	LOC672972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672972
definition	number : 3 pseudo : _no_value

name	LOC672972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672972
definition	number : 2 pseudo : _no_value

name	LOC672972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672972
definition	number : 1 pseudo : _no_value

name	LOC668463 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268865 GeneID:668463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 15 Proteins product : similar to Chain C, Mouse Importin Alpha- Phosphorylated Sv40 Cn Peptide Complex pseudo : _no_value transcript_id : XR_034991.1

clone name	MSMg01-436B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-348B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233O09.b	B6Ng01-233O09.g
ACC	GA045822	GA045823
length	632	1,115
definition	B6Ng01-233O09.b	B6Ng01-233O09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(48,594,888 - 48,595,519)	(48,747,986 - 48,749,101)
sequence	gaattcccttgctatgttcaggcaggctttgaacttgtgatcctcctcct tcagcctcccaggtagggagcattactggcttgtgccaccaagcccagat caggcttctacttactactgtctttgaaaagcacttggaactccatcagg aggtgtggtgggaaacaggaaggtagggagggttgaatgtgcacaaatat aaacagatctttgcagcaagagtctgaatctttgttctgaaggcaggtga cggcagaattctaatgtcccttgtttaggggacatgctacccagaatgct ctggactctgcagacagacaagttggaagaactgggttctgaggagtcct gcatggatttggagaagccagggaatttgtagtgctgtggacttgtctcc tacctaaactttggctcctttcccttcatgggatcagagcgggggatggg gtgagagctaagaaagtctggaggagtgatcagttggaccccaggcttga gctggggaggagttaacctgctttaggacagagaaatgagcaggctccct tgagaggcccgggggactgtgggagtggtatacaccaactttccaggtga ggcagctgggcaaggggacatggcccaatggg	gaattcactattagcccaaactcacctggaactcatgatgcccctgcctc agcctctggattgcaggggtgcaccagcacggccagctgttgtttttcga ggtcagcgtgaatcatctagaaactgttacctgtaaaagcgtctgctcat cagtctcttgcacctaaccctccttcatcttttggaattccacactatcg ccgttgtcggtggagcaccaagtcccaagcctttgtgcagctggttctgt agccgagaacccaaggatgtgaggagcaaccatgtcgttgatgcctgggt gtgtccttcacagatcgcatgctctgttttacagcccccacagaaagcat cagtgacccagagggcaaaggcagttccccaaagcagtcagggacataga gtgacctgacagagatgggccacctgcctcatggatcatctgcctggggt atgatgaagggacaaggaaaacgatgaggaagggatccctcacctagttg aaacctctcaagctgagactcaagagtcacaagactgaaaagattactca gtggttaggagccctagttgctcttccagaggacacaaatttggtaccca tgacccacactagatggtttatttcctcctgtaactctagatctggtgta tctcatactctcttctggtctctactggcacccaagtagggagcacacat gcttacacatacacagaagtattttttaattccaacacaagtaataacat ttatttaaggcctctctcccttccctgctataagcctgctgttatctagg actctcaccagaaagaacacgtcctaaatccctagtggctccaagtttta ccctatcaggttacaattcatgcaaacccctccccccagaattaccctca tttcttattgaaaagcaaagaaagggaggcaacttcctagtagttctttg tgataagaacacagcgttactaaaatggccatctggtctactgctagacc ctttaatttgcacgtctcagatgtccattccccacactctggaatttggc cactatttcttcctgacatctttctatttttcaatgaattccagtgctgc atcatactggctgtc
quality values	Open. Hide. 58 33 12 22 58 58 58 58 58 58 58 58 45 35 54 62 62 62 34 20 62 49 62 62 62 62 62 62 62 62 62 39 34 42 26 26 26 36 38 20 44 56 62 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 62 62 62 59 62 62 59 62 62 43 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 47 43 62 62 62 62 62 62 47 47 47 38 47 41 43 47 33 62 52 52 52 62 62 62 62 62 54 32 62 62 46 54 62 42 49 49 52 42 46 62 54 52 54 39 43 40 52 37 27 34 47 52 52 49 42 23 42 40 29 41 33 46 53 35 52 45 15 42 22 19 17 25 25 27 42 25 34 33 37 37 20 41 39 35 42 30 42 22 46 52 49 42 42 58 30 41 14 6 44 39 52 27 34 46 37 34 37 35 10 29 17 16 9 38 47 28 47 27 33 33 38 24 32 45 40 50 33 35 50 18 22 46 26 32 25 32 28 29 26 25 22 24 16 23 19 19 18 16 12 14 9 10 15 28 42 19 48 37 29 7 33 37 35 42 17 31 17 43 9 26 14 16 34 16 16 23 35 22 17 26 17 19 19 15 33 23 10	Open. Hide. 62 47 43 47 62 47 56 47 47 54 62 47 42 14 33 27 16 10 15 20 19 21 28 50 56 62 62 59 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 33 37 59 62 48 56 56 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 56 62 62 62 62 62 62 62 62 54 47 62 62 62 54 62 62 49 49 47 48 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 54 54 62 62 62 41 62 62 47 52 62 62 62 62 62 62 62 43 62 54 62 54 58 58 46 58 58 54 41 58 58 54 54 54 58 58 58 54 54 54 58 58 58 54 58 58 58 58 58 58 54 47 47 58 58 54 54 54 58 58 58 58 54 30 45 54 58 54 49 54 54 58 42 54 52 52 54 54 58 54 54 46 58 58 58 58 58 58 52 51 27 51 50 51 58 58 46 52 54 58 58 58 50 53 46 58 58 39 53 58 43 45 51 53 58 51 54 50 58 53 58 46 51 51 46 41 51 25 58 46 29 41 49 52 58 58 53 58 58 51 49 50 50 50 54 46 39 54 58 46 39 58 49 46 51 52 51 48 51 39 36 50 49 58 25 58 43 50 52 58 54 43 44 38 47 49 37 58 40 32 51 40 53 53 58 50 52 52 37 52 53 58 58 27 58 42 53 40 38 51 52 41 53 53 53 54 50 51 54 42 53 41 34 54 54 39 53 52 42 52 37 35 30 54 44 36 42 42 49 47 42 39 40 53 52 26 54 46 28 27 39 42 41 40 42 21 38 40 40 33 33 37 47 37 38 23 41 35 41 29 51 40 39 33 33 24 24 27 31 54 54 54 54 32 20 20 39 39 34 37 19 33 47 32 47 31 33 32 45 33 26 33 25 36 40 29 37 49 34 40 40 53 26 24 35 24 46 20 45 42 45 29 32 53 34 53 31 34 29 26 45 18 31 42 35 43 32 35 33 28 24 43 45 30 51 39 38 33 32 31 31 32 31 30 30 18 46 31 24 31 32 43 35 31 29 29 30 30 51 47 31 25 33 31 30 28 31 18 16 26 25 31 42 46 25 32 38 46 30 31 26 31 22 36 38 16 27 27 30 13 33 31 37 48 48 38 25 26 37 25 12 23 31 22 9 25 29 15 24 27 31 37 18 31 34 33 27 33 42 19 9 41 27 30 31 38 32 38 26 31 31 29 32 28 18 13 33 12 7 24 14 12 28 17 30 32 22 18 28 29 25 33 8 8 19 7 13 38 47 37 5 16 12 29 28 19 16 31 44 12 9 29 14 18 19 31 9 5 10 10 19 12 19 17 31 23 14 32 34 13 34 10 15 32 43 26 23 18 27 34 21 10 10 7 22 26 14 14 7 22 17 17 7 18 11 32 25 34 29 48 39 26 15 17 37 8 9 17 32 21 15 20 18 33 24 32 27 34 24 24 14 13 16 4 9 10 16 15 11 29 11 16 18 10 17 7 7 9 13 4 10 14 18 25 12 22 8 20 13 14 11 10 15 20 6 18 6 27 28 10 17 10 11 7 6 9 13 10 18 9 15 7 27 7 23 17 19 8 13 26 26 17 16 29 9 8 15 18 17 22 12 5 2 3 10 9 6 15 20 7 13 16 15 7 24 28 28 23 12 6 16 5 7 8 17 17 9 5 16 6 4 4 6 8 8 8 22 16 8 6 11 7 6 21 9 7 3 3 2 9 4 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_48594888_48595519
seq2: B6Ng01-233O09.b_45_676

seq1  GAATTCCCTTGCTATGTTCAGGCAGGCTTTGAACTTGTGATCCTCCTCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTTGCTATGTTCAGGCAGGCTTTGAACTTGTGATCCTCCTCCT  50

seq1  TCAGCCTCCCAGGTAGGGAGCATTACTGGCTTGTGCCACCAAGCCCAGAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCCTCCCAGGTAGGGAGCATTACTGGCTTGTGCCACCAAGCCCAGAT  100

seq1  CAGGCTTCTACTTACTACTGTCTTTGAAAAGCACTTGGAACTCCATCAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTTCTACTTACTACTGTCTTTGAAAAGCACTTGGAACTCCATCAGG  150

seq1  AGGTGTGGTGGGAAACAGGAAGGTAGGGAGGGTTGAATGTGCACAAATAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTGGTGGGAAACAGGAAGGTAGGGAGGGTTGAATGTGCACAAATAT  200

seq1  AAACAGATCTTTGCAGCAAGAGTCTGAATCTTTGTTCTGAAGGCAGGTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAGATCTTTGCAGCAAGAGTCTGAATCTTTGTTCTGAAGGCAGGTGA  250

seq1  CGGCAGAATTCTAATGTCCCTTGTTTAGGGGACATGCTACCCAGAATGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCAGAATTCTAATGTCCCTTGTTTAGGGGACATGCTACCCAGAATGCT  300

seq1  CTGGACTCTGCAGACAGACAAGTTGGAAGAACTGGGTTCTGAGGAGTCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGACTCTGCAGACAGACAAGTTGGAAGAACTGGGTTCTGAGGAGTCCT  350

seq1  GCATGGATTTGGAGAAGCCAGGGAATTTGTAGTGCTGTGGACTTGTCTCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGGATTTGGAGAAGCCAGGGAATTTGTAGTGCTGTGGACTTGTCTCC  400

seq1  TACCTAAACTTTGGCTCCTTTCCCTTCATGGGATCAGAGCGGGGGATGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTAAACTTTGGCTCCTTTCCCTTCATGGGATCAGAGCGGGGGATGGG  450

seq1  GTGAGAGCTAAGAAAGTCTGGAGGAGTGATCAGTTGGACCCCAGGCTTGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGAGCTAAGAAAGTCTGGAGGAGTGATCAGTTGGACCCCAGGCTTGA  500

seq1  GCTGGGGAGGAGTTAACCTGCTTTAGGACAGAGAAATGAGCAGGCTCCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGGGAGGAGTTAACCTGCTTTAGGACAGAGAAATGAGCAGGCTCCCT  550

seq1  TGAGAGGCCCGGGGGACTGTGGGAGTGGTATACACCAACTTTCCAGGTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGGCCCGGGGGACTGTGGGAGTGGTATACACCAACTTTCCAGGTGA  600

seq1  GGCAGCTGGGCAAGGGGACATGGCCCAATGGG  632
      ||||||||||||||||||||||||||||||||
seq2  GGCAGCTGGGCAAGGGGACATGGCCCAATGGG  632

seq1: chr17_48747986_48749101
seq2: B6Ng01-233O09.g_71_1185 (reverse)

seq1  GACAGGCCAGTATGATGCAGCACTGGAATTCATTG-AAAATAGAAAGATG  49
      |||| |||||||||||||||||||||||||||||| ||||||||||||||
seq2  GACA-GCCAGTATGATGCAGCACTGGAATTCATTGAAAAATAGAAAGATG  49

seq1  TCCAGGGAAAGAATAGTGGCC-AATTCCAGAGTGT-GGGAATGGACATCT  97
      ||   ||||  |||||||||| ||||||||||||| ||||||||||||| 
seq2  TC--AGGAAGAAATAGTGGCCAAATTCCAGAGTGTGGGGAATGGACATC-  96

seq1  TGAGACGTTGCAATT-AAGGGTCTTAGCAGTAGA-CAGAT-GCCATTTTA  144
      ||||||||   |||| ||||||| |||||||||| ||||| |||||||||
seq2  TGAGACGTGCAAATTAAAGGGTC-TAGCAGTAGACCAGATGGCCATTTTA  145

seq1  GTAACGCTTGTGTTC-TATCACAAAGAACTACTAGGAAGTTGCCTCCCCT  193
      ||||||| ||||||| ||||||||||||||||||||||||||||| ||||
seq2  GTAACGC-TGTGTTCTTATCACAAAGAACTACTAGGAAGTTGCCT-CCCT  193

seq1  TTCTTTGCCTTTTCAATAAGAAATGAGGGTAATTCTGGGGGGAGGGGTTT  243
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTG-CTTTTCAATAAGAAATGAGGGTAATTCTGGGGGGAGGGGTTT  242

seq1  GCATGAATTGTAACCTGATAGGGTAAAACTTGGAGCCACTAGGGATTTAG  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGAATTGTAACCTGATAGGGTAAAACTTGGAGCCACTAGGGATTTAG  292

seq1  GACGTGTTCTTTCTGGTGAGAGTCCTAGATAACAGCAGGCTTATAGCAGG  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGTGTTCTTTCTGGTGAGAGTCCTAGATAACAGCAGGCTTATAGCAGG  342

seq1  GAAGGGAGAGAGGCCTTAAATAAATGTTATTACTTGTGTTGGAATTAAAA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGAGAGAGGCCTTAAATAAATGTTATTACTTGTGTTGGAATTAAAA  392

seq1  AATACTTCTGTGTATGTGTAAGCATGTGTGCTCCCTACTTGGGTGCCAGT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACTTCTGTGTATGTGTAAGCATGTGTGCTCCCTACTTGGGTGCCAGT  442

seq1  AGAGACCAGAAGAGAGTATGAGATACACCAGATCTAGAGTTACAGGAGGA  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGACCAGAAGAGAGTATGAGATACACCAGATCTAGAGTTACAGGAGGA  492

seq1  AATAAACCATCTAGTGTGGGTCATGGGTACCAAATTTGTGTCCTCTGGAA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAACCATCTAGTGTGGGTCATGGGTACCAAATTTGTGTCCTCTGGAA  542

seq1  GAGCAACTAGGGCTCCTAACCACTGAGTAATCTTTTCAGTCTTGTGACTC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCAACTAGGGCTCCTAACCACTGAGTAATCTTTTCAGTCTTGTGACTC  592

seq1  TTGAGTCTCAGCTTGAGAGGTTTCAACTAGGTGAGGGATCCCTTCCTCAT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGTCTCAGCTTGAGAGGTTTCAACTAGGTGAGGGATCCCTTCCTCAT  642

seq1  CGTTTTCCTTGTCCCTTCATCATACCCCAGGCAGATGATCCATGAGGCAG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTTTCCTTGTCCCTTCATCATACCCCAGGCAGATGATCCATGAGGCAG  692

seq1  GTGGCCCATCTCTGTCAGGTCACTCTATGTCCCTGACTGCTTTGGGGAAC  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCCATCTCTGTCAGGTCACTCTATGTCCCTGACTGCTTTGGGGAAC  742

seq1  TGCCTTTGCCCTCTGGGTCACTGATGCTTTCTGTGGGGGCTGTAAAACAG  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTTGCCCTCTGGGTCACTGATGCTTTCTGTGGGGGCTGTAAAACAG  792

seq1  AGCATGCGATCTGTGAAGGACACACCCAGGCATCAACGACATGGTTGCTC  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATGCGATCTGTGAAGGACACACCCAGGCATCAACGACATGGTTGCTC  842

seq1  CTCACATCCTTGGGTTCTCGGCTACAGAACCAGCTGCACAAAGGCTTGGG  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACATCCTTGGGTTCTCGGCTACAGAACCAGCTGCACAAAGGCTTGGG  892

seq1  ACTTGGTGCTCCACCGACAACGGCGATAGTGTGGAATTCCAAAAGATGAA  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGTGCTCCACCGACAACGGCGATAGTGTGGAATTCCAAAAGATGAA  942

seq1  GGAGGGTTAGGTGCAAGAGACTGATGAGCAGACGCTTTTACAGGTAACAG  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGTTAGGTGCAAGAGACTGATGAGCAGACGCTTTTACAGGTAACAG  992

seq1  TTTCTAGATGATTCACGCTGACCTCGAAAAACAACAGCTGGCCGTGCTGG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTAGATGATTCACGCTGACCTCGAAAAACAACAGCTGGCCGTGCTGG  1042

seq1  TGCACCCCTGCAATCCAGAGGCTGAGGCAGGGGCATCATGAGTTCCAGGT  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACCCCTGCAATCCAGAGGCTGAGGCAGGGGCATCATGAGTTCCAGGT  1092

seq1  GAGTTTGGGCTAATAGTGAATTC  1116
      |||||||||||||||||||||||
seq2  GAGTTTGGGCTAATAGTGAATTC  1115

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information